This article was first published in November 2013 coincided with the Warsaw Climate Summit. 

The upcoming  UN Climate Summit to be attended by 125 world leaders will focus on carbon pricing on behalf of powerful corporations and financial institutions as well as a new agreement to “reduce greenhouse emissions”  

Debate on geo-engineering and environmental modification techniques for military use remains a taboo, not to mention the discussion pertaining to the environmental impacts of war.  

Michel Chossudovsky, September 22, 2014

Politicians, NGOs, scientists and business executives  at the Warsaw Climate Summit have failed to acknowledge the fact, amply documented, that climate can be manipulated as a result of environmental modification techniques (ENMOD).

Discussion of ENMOD is taboo. It is an unspoken truth.  Scientists dare not address it as part of the debate on climate change. While ENMOD is firmly documented, these same scientists will readily assert without evidence that global warming (resulting from excess CO2 emissions) is the cause of tropical storms.

ENMOD technologies not only exist, they are fully operational.  Confirmed by US military documents, a typhoon, a tsunami or an earthquake can be triggered by the use of ENMOD technologies. The issue, therefore, must be addressed by climate specialists.

What we are suggesting is that in investigating the underlying causes of extreme weather events the issue of climatic manipulation can by no means be excluded.

Ironically, the existence of ENMOD technologies was acknowledged more than 30 years back by the  United Nations in a binding 1977 Convention on the Prohibition of Military or Any Other Hostile Use of Environmental Modification Techniques. 

The Convention defined ENMOD as “any technique for changing – through the deliberate manipulation of natural processes – the dynamics, composition or structure of the Earth, including its biota, lithosphere, hydrosphere and atmosphere, or of outer space.”  What is at stake is  “the intentional modification or manipulation of the natural ecology, such as climate and weather, earth systems”. In removing ENMOD from the debate on climate change, the UNFCC is a blatant violation of the 1977 UN Convention.

Environmental modification techniques have been applied by the US military for more than half a century. US mathematician John von Neumann, in liaison with the US Department of Defense, started his research on weather modification in the late 1940s at the height of the Cold War and foresaw ‘forms of climatic warfare as yet unimagined’. During the Vietnam war, cloud-seeding techniques were used, starting in 1967 under Project Popeye, the objective of which was to prolong the monsoon season and block enemy supply routes along the Ho Chi Minh Trail.

Since the heyday of the Vietnam war, ENMOD technologies for military use have evolved significantly. We are dealing with highly sophisticated weapons systems.

The possibility of climatic or environmental manipulations as part of a military and intelligence agenda, while tacitly acknowledged, is never considered as relevant. Military analysts are mute on the subject. Meteorologists are not investigating the matter, and environmentalists are strung on global warming and the Kyoto protocol.

It is worth noting that barely two months prior to the The Philippines Typhoon disaster, CBS This Morning in  an interview with Dr. Michio Kaku, a physics professor at City College New York,  confirmed the existence and use of ENMOD technologies, while casually downgrading their significance and disregarding their strategic and military applications (see video below):

The Involvement of the CIA in Climate Change Technologies

Back in July 2013,  MSN news reported that the CIA was involved in helping to fund a project by the National Academy of Sciences (NAS) focusing on geo-engineering and climate manipulation. The report not only acknowledged these technologies, it confirmed that US intelligence has been routinely involved in addressing the issue of climatic manipulation:

The CIA is helping fund the research because the NAS also plans to evaluate “the national security concerns (that could be) related to geoengineering technologies being deployed somewhere in the world,” Kearney said.

In an emailed statement, Christopher White, a spokesman for the CIA’s office of public affairs, told MSN, “On a subject like climate change, the agency works with scientists to better understand the phenomenon and its implications on national security.”

Although the CIA and the NAS are tight-lipped about what these concerns might be, one researcher notes that geoengineering has the potential to deliberately disrupt the weather for terrorist or military goals.

John Pike, the director of GlobalSecurity.org, a Washington-based firm that specializes in addressing emerging security concerns, says that worries about the potential impact of geoengineering aren’t as paramount as the potential security issues that could arise if the United States doesn’t use the technology.

“A failure to engage in geoengineering could impact the political stability of other countries, and that could lead to trouble for the U.S.,” he said.

The NAS project is supported by the U.S. intelligence community, the National Oceanic and Atmospheric Administration, the National Aeronautics and Space Administration, and the Department of Energy.

historical examples of related technologies (e.g., cloud seeding and other weather modification) for lessons that might be learned about societal reactions, examine what international agreements exist which may be relevant to the experimental testing or deployment of geoengineering technologies, and briefly explore potential societal and ethical considerations related to geoengineering. This study is intended to provide a careful, clear scientific foundation that informs ethical, legal, and political discussions surrounding geoengineering. (See http://www8.nationalacademies.org/cp/projectview.aspx?key=49540)

While geoengineering and weather warfare are nothing new, they are rarely the object of media attention.  Weather-modification for military use has been acknowledged by the US Air Force in document AF 2025 Final Report:

‘[ENMOD]  offers the war fighter a wide range of possible options to defeat or coerce an adversary’, [including] the triggering of floods, hurricanes, droughts and earthquakes… The ability to generate precipitation, fog and storms on earth or to modify space weather… and the production of artificial weather all are a part of an integrated set of [military] technologies.”

In the course of the 1990s, the HAARP program was developed. The High Frequency Active Auroral Research Program (HAARP) based in Gokona, Alaska, has been in existence since 1992. [It was closed down in 2013] It is part of a new generation of sophisticated weaponry under the US Strategic Defense Initiative (SDI). Operated by the Air Force Research Laboratory’s Space Vehicles Directorate, HAARP constitutes a system of powerful antennas capable of creating “controlled local modifications of the ionosphere” [upper layer of the atmosphere]

In a 1990s CBC TV report, weather modification for military  acknowledged that HAARP had the ability of triggering typhoons, earthquakes, floods and droughts:

Directed energy is such a powerful technology it could be used to heat the ionosphere to turn weather into a weapon of war. Imagine using a flood to destroy a city or tornadoes to decimate an approaching army in the desert. The military has spent a huge amount of time on weather modification as a concept for battle environments. If an electromagnetic pulse went off over a city, basically all the electronic things in your home would wink and go out, and they would be permanently destroyed.”

To view CBS documentary, video below:

 

Reeling from history’s biggest double-blow of natural and nuclear disasters, post 3-11 Japan seemed poised to lead the world’s accelerating turn to radical efficiency and renewable energy (the latter accounted for 56% of net additions to global power capacity in 2013).1 After 3-11, then-Prime Minister Kan Naoto quickly initiated regulatory shackles on the country’s nuclear capacity and implemented a feed-in tariff (FIT). These deft moves became core elements in a battering-ram of policy changes and political opposition that forced open a door to profound change in Japan’s power mix and its political economy. The country has seen minimal nuclear power generation in the wake of 3-11, and not one kilowatt between September 15 of 2013 and the present. Japan now appears on track towards the restart of at least some of its remaining nuclear capacity.2 Not without reason, the “smart money” believes Japan’s power choices are dominated by fossil fuels and the resumption of considerable nuclear capacity.3 So it is important to ask whether aggressive efficiency and FIT-incentivized renewable power got through while the door was open or face a suffocating squeeze if significant nuclear generation returns on-line.

This article proceeds by describing the promising role that efficiency and conservation have achieved in Japan’s power mix, reflecting their recent international recognition as a “fuel” in their own right. It then turns to consider Japan’s renewable opportunity and what appear to be the FIT’s most salient inadequacies. The article follows up with recent market surveys and other evidence of what took place in the power business in 2013. These empirical studies suggest that in spite of the FIT’s handicaps, the policy has already had a striking effect on investment, business formation, local-government growth strategies, innovation, and other important items.

In addition, more recent developments in 2014 confirm that Japan’s power economy is very different from what it was three years ago. PM Abe Shinzo’s government confronts this new reality in the midst of a string of important local elections and at a time when its faltering Abenomics has been forced to become a “local Abenomics.” Ironically, those incentives may make Abe and his “local revival” chief Ishiba Shigeru reluctant supporters of the FIT and renewables.

Japan’s Power Cuts as a Growth Opportunity

Japan was the world’s third largest nuclear-power generator prior to March 11, 2011. It had 54 reactors with a total power generation capacity of 49 gigawatts (GW) in 2010. The loss of the Fukushima reactors has since reduced that number to 48 reactors with 42 GW of power capacity. As noted earlier, none of that capacity has been in operation since September 15 of 2013. The most optimistic, politically informed outlook projects only about 20 of these reactors to restart over the next five years.4 Moreover, the attached chart on “Projected cost of fossil fuel imports in fiscal year 2015” shows that even the full restart of all remaining nuclear capacity by 2015 – something that is simply not going to happen – would cut fuel costs by only YEN 2.5 trillion, or roughly 9%. Renewables expert Thomas Gerke argues that the Abe administration ought to reassess its priorities, and emphasize power cuts as well as “an aggressive transformation of the entire energy system, that could effectively reduce Japan’s energy import dependency.”5 The evidence below bears out his assertions.

The very good news from Japan is that power cuts, inescapable in the immediate aftermath of 3-11, appear to have become institutionalized and ingrained in behaviour. These cuts are not incentivized by the FIT. Their drivers include the power-saving campaigns that followed 3-11, power-price increases that averaged 28% in September 2014 versus 4 years earlier,6 and ramped-up subsidy programmes for efficiency. An example of the latter are measures encouraging a more rapid uptake of LEDs – 6 times more efficient than incandescent lights – and other devices in lighting and other areas of power consumption. Japan’s post 3-11 diffusion of LEDs boomed, becoming 11% of a global market of just over USD 90 billion by 2013. Japan’s diffusion rate of 54.1% LEDs in the 2013 domestic lighting market was nearly double the global average of 27.6%. Estimates project Japan’s diffusion rate will rise to 70.8% in 2015 and 80.9% in 2018.7 By contrast, the US Department of Energy forecasts LED diffusion in America to reach just 36% of sales by 2020 and 74% by 2030.8

Japan’s power-saving campaigns also include such innovations as “peak shift” vending machines in the country’s YEN 2.7 trillion vending market. Coca Cola commands 20% of the market share in these devices, ubiquitous throughout Japan, and in January 2013 introduced “Peak Shift” vending machines that power-up late at night, when demand on the grid is low. The machines “can keep soft drinks cool without the use of electricity for up to 16 hours during summer, reducing daytime electricity consumption by 95%.”9 Japanese power demand tends to peak in the early afternoon hours of mid-summer. Adequate power-generation capacity must be on hand to meet that surge, lest there be power outages. So shaving the peak — whether through outright cuts or shifting demand — means a more efficient use of all power infrastructure. It also allows for reductions of the number of expensive “peaker plants” needed only to meet infrequent demand spikes.

These kinds of conservation and efficiency measures saved 78.9 billion kilowatt-hours in 2013, or roughly the output of 13 of Japan’s shut-down nuclear reactors.10 This is very important in growth-challenged Japan. The International Energy Agency (IEA) rightly describes efficiency as the “fifth fuel,” and indeed the cheapest of all. Efficiency is also a global market worth about USD 300 billion in 2012, and almost certain to grow significantly in the coming years.11 Japan’s post 3-11 success with the fifth-fuel is such that some Japanese analysts argue it should become the heart of the country’s growth strategy.12 This would be wise, as the most recent authoritative comparison of efficiency across countries placed Japan tied with United Kingdom at sixth (see “2014 International Energy Efficiency Scorecard”) indicating lots of low-hanging fruit left to pick. Post 3-11 Japan has made impressive gains in power cuts. But it is not the global leader, trailing not only Germany (#1) but also China (#4), and its competitors are also increasingly shifting human, financial, fiscal and other resources into this lucrative sector.13 Japan’s ongoing rollout of smart communities, including district heating, energy-management systems, waste-energy recovery, and other initiatives, have enormous potential if they are not marginalized by vested energy interests and their myopic political-bureaucratic supporters.

Japan’s Bounty of Renewable Resources

We have seen that Japan’s power cuts appear institutionalized and could become a much-needed growth sector. On the other hand, Japan’s expansion of renewable power after 3-11, and especially in the wake of implementing the FIT, does not reflect what is technically feasible. This underperformance is rather odd. After all, Japan was a first-mover in renewable energy, especially solar.14 Japanese firms, including Toshiba and Mitsubishi, command roughly 70% of the global market in geothermal power-related equipment.15 And on September 18, 2014, 3 days after the country went a full year without nuclear power, Japan’s New Energy and Industrial Technology Development Organization (NEDO) held a special symposium celebrating the 40th anniversary of the September 1974 “Sunshine Plan” of solar, geothermal and other new energies.16

Japan does not lack renewable energy resources, as its rich endowment is precisely the reverse of its paucity of conventional energy resources. It is important to stress this fact because “resource-poor Japan” is such deeply embedded conventional wisdom that even Obuchi Yuko, the new (from September 3) minister of economy, trade and industry (METI) appears to echo it. She demonstrated this during a September 21, 2014 debate aired by the national broadcaster, NHK, when she insisted that nuclear restarts were necessary for Japan, “the nation with scarce resources (shigen no toboshii nihon).”17

To paraphrase Upton Sinclair, it will be difficult to get Obuchi to understand something that her cabinet position, as a member of nuclear-restart Team Abe, depends on her not understanding. Yet on November 2, 2012, the same NHK aired a visually rich comparative presentation of Japan’s abundant resources by Amory Lovins, Rocky Mountain Institute Chief Scientist and executive board member of the Japan Renewable Energy Foundation.18 Lovins has repeatedly and convincingly argued, and not just on Japanese NHK broadcasts, that Japan has excellent renewable energy potential but lacks the appropriate policy regime to fully exploit it. And rather than lazily repeat tired slogans, like METI’s Obuchi, he and his researchers went to work and combined assessments of all renewable resources, including intensity of sunlight, average wind speeds, geothermal potential, available biomass, and other pertinent elements. They converted the totals into one common comparison of the annual number of gigajoules of renewable energy potential per square meter (GJ/y/m2). The result shows that Japan is a global leader: Japan’s endowment of 63.1 GJ/y/m2 is far more plentiful than the18.8 in China, India’s 45.5, the EU’s 20.4, North America’s 30.4, and South America’s 28.1.19

The German Energy Shift

Elsewhere, Lovins has used this data to show that Japan’s renewable resource potential is 9 times that of Germany.20 He points out that among large industrial states Germany is the global leader in shifting its energy mix to renewables because of good policy, especially the FIT. The Germans aim at 35% renewable power by 2020 and over 80% by 2050. Even with far less abundant renewable resources than Japan, the Germans appear capable of overcoming the technical challenges of building environmental sustainability as well as competitive new industries.21 In 2013, non-hydro renewables provided just under 24% of Germany’s power, 380,000 jobs in thriving industries, and displaced at least USD 16 billion in fuel imports. The FIT also contributed to more equitable income distribution and enhanced community ties, important positive externalities in our post-Lehman malaise. The multinational audit firm Ernst and Young (EY) emphasize this fact in their September 2014 “Renewable Energy Country Attractiveness Index,” the 42nd edition of this quarterly publication. EY highlight the fact that Germany – along with Denmark – has “demonstrated that citizen participation and regional value creation from decentralized renewable energy production can be the norm, not the exception. In Germany, there are more than 600 energy cooperatives and more than half of renewables capacity is community-owned.”22

Germany’s renewable goals and policy regime are deeply embedded in its political economy. Its renewable commitment and industrial structure endured the dramatic collapse of domestic solar-panel production, when German firms Q-Cells, Bosch Solar, Conergy and others went bankrupt in 2012 and 2013 in the face of unbeatable Chinese price-competition.23 The German state and capital were already collaborating in moving on to power storage, integrating renewable systems and other areas of innovation opened up by their energy transition.24 That smart response is helping German exporters advance up the value chain in a global industry where the simple manufacture of solar panels, per se, has become commodified.25

Japan’s Performance in 2013

Aggressive policy saw Germany secure just under 24% of its power from non-hydro renewables in 2013, whereas renewables provided only 2.2% of Japan’s power supply in 2013. (This total then leapt to 4.4% in April-May of 2014, but for the moment, let us stick with the 2013 data.) To be sure, the amount installed in 2013 was a robust 32% increase over the previous year. A one third increase in solar investment, to USD 28 billion, placed Japan 3rdin the PEW Charitable Trusts analysis of clean tech investment for 2013 (see the attached chart on “Investment by Country and Sector, 2013”). During 2013, Japan installed 7 GW of solar capacity, which nearly equalled the 7.8 GW of all renewable power (5 GW being solar) it had installed under the Renewables Portfolio Standard (RPS) system it had initiated in 2003.26

Japan’s investment in solar in 2013 was impressive, but its deployment of the gamut of renewable power options was not as rapid as many observers had expected.27 Japan’s combination of post 3-11 power needs, its abundant renewable resource-endowment, and the fact that in 2013 it came second in the world in clean energy patents (see chart on “Clean Energy Patents for Top Countries 2013”), suggest it should and could have made more progress. Instead of a dramatic increase in renewables, Japan largely substituted for lost nuclear generation with the power cuts outlined earlier and by increasing fossil fuels in its power mix from roughly 60% before 3-11 to just under 90%. The latter was in large part through expanding the use of existing generation capacity, bringing old “mothballed” capacity back on-line, and building new fossil-fuel plant, especially natural gas and coal.

Preeminent among the factors that hindered a more rapid diffusion of renewable power is the regulatory regime that underpins the Japanese FIT, which became effective from July 1 of 2012. After a brief overview of the Japanese FIT itself, this paper turns to these handicaps.

The Japanese FIT’s Handicaps

The attached Ministry of Economy, Trade and Industry (METI) diagramme “Mechanism of Feed-in Tariff Scheme for Renewable Energy” shows that the FIT is a scheme through which solar, wind, and other types of renewable-power generation (biomass, geothermal and small hydro) are given a guaranteed price – or “tariff” – per kilowatt-hour (kWh) for a designated period. The tariff varies according to the particular system’s output, measured in kilowatts (kW), as is seen in a separate METI chart on “Tariff Rates.” The cost of the premium price is then passed on to ratepayers in their power bill.

 

 

Japan’s 2013 share of clean-tech patents  Source

On paper, the Japanese FIT obligates power companies (meaning Japan’s 10 monopolies, including the infamous TEPCO) to purchase the renewable power generated by duly designated renewable-power projects. But where the Japanese FIT falls short, especially compared to its German counterpart, is in allowing the monopoly utilities to refuse grid connection to projects at their discretion. The Japanese monopolies also have no obligation to expand the power grid, giving access to areas with renewable resource-endowments but limited or nonexistent power lines to transmit it. Among other things, this has allowed the monopolies to freeze out onshore wind power, which is potentially the cheapest among renewable options, relatively quick to install,28 and the backbone of global renewable power. Japan’s onshore wind capacity has grown by only minimal amounts over the past two years. As Lovins points out, “of the 8 GW of renewables brought into operation in the first 20 months after it [Japan] introduced renewable FITs in July 2012, 97.5% was solar and only 1% windpower.”29

Pro-Monopoly Warts and All, Japan’s FIT Works

We have seen that Japan’s FIT did not drive as rapid an expansion of renewables in the power mix as advocates expected. Even so, it is clear that the FIT stimulated a very large and expanding industry. One recent assessment of part of this industry’s scale is see in a Japan Photovoltaic Energy Association (JPEA) analysis, based on August 8, 2014 data from the METI’s New Energy Subcommittee. The total expansion of economic activity in solar is represented by the red bars in the attached chart on “Sales and Employment Japan’s Solar Sector, 2010-2013.” The JPEA analysis shows that the solar business in Japan increased from just over YEN 500 billion in 2010, to 670 billion in 2011, about YEN 1 trillion in 2012 (the initial year of the FIT), and then leapt to YEN 2.5 trillion in 2013. The calculation of business activity includes not just sales of solar panels, but also the power conditioners, inverters and other gear as well as the installation costs. And in terms of direct (the black line) and indirect employment (the green line) in the solar sector, the analysis highlights an expansion to 90,000 direct jobs and 210,000 indirect jobs in 2013, versus a few thousand for both in 2010. Moreover, only 9.3% YEN 2.5 trillion in total business volume represented money that went overseas for the import of panels and other equipment. Over 90% of the economic activity generated in this sector therefore stayed in the domestic economy, leading to the impressive results in employment.30

Another indicator of the growth of Japan’s renewable energy industry is seen in the Tokyo Shoko Research survey of new business creation during 2013 (released on August 8, 2014). There were 210,000 new businesses created in all sectors of the Japanese economy during 2013, a 5.8% increase over the previous year. The survey also revealed that there was a startling 118.1% increase (834 firms to 1,819 firms) in the utilities sector, which includes electricity, gas, heat distribution, and water. Tokyo Shoko directly attributes this increase to the ballooning interest in solar, wind, geothermal and other renewable power generation and related business.31

Tokyo Shoko has been in the business of market surveys since 1892,32 so is not some over-eager front for Greenpeace or Friends of the Earth. It seems important to stress this fact, because 5 days after the above release Tokyo Shoko published a clearly enthusiastic special report that zeroed in on the utility sector, and specifically power.33 This August 13 summary of the survey results confirmed that the bulk of the 1,819 new firms in the utility sector were centred in power, which saw 1,799 new businesses launched in 2013. The attached chart on “Annual Trend in New Power Firms, 2009-2013” graphically illustrates the pace of new business growth. Tokyo Shoko deliberately added the red lines in the chart to help readers visualize the upward spike of business starts in power, represented by the rapidly ascending blue line. The 2013 total of new firms was a striking increase of 2.2 times over the 811 in 2012, and a very dramatic leap of 26.4 times the 68 new firms that were established in 2011. The report also made a point of emphasizing that these results reflect the attractiveness of the FIT.

Annual Trend in New Power Firms, 2009-2013. Number of Firms and Energy Type (with some overlap)  

Of the 1,799 new power businesses in 2013, 67.4% (1,213) were involved in solar. In spite of Japan’s bias towards solar, there were also significant numbers of business starts in other renewable areas as well. On the x-axis of the attached chart (in Japanese) on “Number of Firms and Energy Type (with some overlap),” the topmost energy is solar, followed by wind, water (i.e., small hydro), geothermal, and “bio” (a contraction, referring to biomass and biogas). The 223 new firms in wind in 2013 is impressive on its own, nearly 4 times the total number of new firms in the entire power sector in 2011, and over 10 times the 22 new entrants in 2009. The results for hydro, geothermal and bio-power are similarly noteworthy, when viewed against the past lethargy of Japan’s monopoly-dominated power sector.

The Tokyo Shoko survey also highlights the explosion in the number of firms designated as Power Producer and Supplier (PPS) businesses. The PPS category is a result of the 1999 power-law reform. This reform allowed new entrants into the power-supply market (for over 50 kW) in addition to the existing 10 monopoly utilities, as of April 2005. Tokyo Shoko view this as a very important metric, and hence included the most recent data possible prior to their August 13 survey release. Their numbers show that as of August 4, a total of 313 firms were registered with the METI’s Energy and Natural Resources Bureau. Bear in mind that at the end of March 2012, this number was a mere 53 firms.34 Tokyo Shoko note that the expansion in the number of PPP firms has largely been driven by the increase in renewable power generation, the electricity price hikes of the monopoly utilities, and the impending liberalization of the YEN 7.5 trillion small-lot power market in April 2016.

The Tokyo Shoko specialists do not expect all these new firms in the power sector to survive. Among other challenges, they point to the low capitalization of many of the new businesses. Fully 80% of them are capitalized at YEN 10 million or less, with 40% being under YEN 1 million. In addition, some of the firms are yet to engage in business activity or soon go bankrupt.The analysts thus warn of an impending shakeout in the number of PPS and other new entrants into the power sector. At the same time, they argue that the striking increase in business starts in this important sector is a very positive development. They remind readers that Japan’s growth strategy is aimed at raising the low level of new business starts to 10%. Tokyo Shoko also spotlight Japan’s need for expansion of new business areas in order to shift its industrial structure, moving human and other resources from declining areas to more promising new sectors. The analysts urge smart policymaking, and express optimism that many of the new entrants in the power sector will afford much-needed employment and innovation.

Surveying the New Landscape of Power

We have seen that, even handicapped by rules that privilege the extant power monopolies, Japan’s FIT incentivized significant business activity during 2013. Several more recent developments indicate that the striking increase in the number of players in the Japanese power market, together with many of them deploying renewable energy, are not bubbles but are rather rooted on solid ground. This solid ground includes the fact that many new entrants are large firms, there are significant investment plans in expanding renewable capacity, there are impressive increases in demand for renewable power, and evidence of quite promising innovation.

First, the number of PPS firms, 313 at the time of the Tokyo Shoko study’s release, has continued to increase. As of September 19, 2014, the figure stands at 352.35 As of July 2014, the number of PPS actually producing and selling power was 56. Most of the rest appear to be firms that have formally registered as PPS, but are waiting for deregulation (such as of the retail market in April 2016) to proceed before actually commencing operations. These firms include PPS set up by Nippon Paper Group and other large-scale concerns. Not all of these interests plan to deploy renewable power, but many of them do.

As to investment in renewable capacity, the PPS Orix intends to increase its renewable-power supply capacity by 12 times (to 1 million kilowatts) over the next 5 years in an investment of YEN 300 billion.36 The Orix PPS is an important element of the larger Orix Group of 26,000 employees working in leasing, asset management, eco services, and other areas.37 The firm has at present 4000 business firms as customers and a renewable-power output capacity of 80,000 kilowatts. Most of its investment will go to solar, as it plans to spend YEN 220 billion on 800,000 kilowatts of solar capacity at over 200 locations nationwide (from Hokkaido to Kumamoto). It will also pour YEN 60 billion into biomass, with plant in Fukushima and Fukuoka. On geothermal, it will spend YEN 25 billion at a maximum of 15 sites. It is also thinking about entering wind, but has not yet made any decisions.

This investment plan will put Orix in the number 2 spot among the PPS firms by 2018 in terms of generating capacity. The top PPS is Enetto, which secures its power from excess in-house generation and in 2013 sold 10.6 billion kilowatts. Orix renewable deployment will see its capacity move into the 2.3 to 3 billion kilowatt range.

The Public Sector and PPS

Some local governments are also planning to directly enter the PPS market. Planned additions include Osaka Prefecture’s Izumisano City (population 101, 313) announcement that within 2014 the city would join with a private firm and undertake a PPS (tentatively named Izumisano Power). The PPS would be funded 2/3 by the city and 1/3 by the private firm, and would largely use FIT-supported solar power generated by the city’s solar projects at Kansai International Airport, to supply city facilities from April of 2015. At current power prices, the PPS arrangement is calculated to result in a YEN 1 million reduction of the city’s power bill.38

It is also not uncommon for local governments to shift their power contracts away from the monopolies to active PPS, with all or at least some of the power being renewable. One recent example is the city of Nasukarasuyama (population: 28,633) in Tochigi Prefecture (one of the areas affected by 3-11). The city authorities relate that in response to price increases for power, they have progressively shifted power-supply contracts, via auction, from Tepco. Since August 1 of 2012, they did this for 19 city facilities (schools, day-care centers, municipal waterworks centers, etc). And as of the end of July in 2014, they have completed 3-year contracts (August 1, 2014 to July 31, 2017) with 2 PPS firms (Mitsurou Green Energy and Itochu Enex) for power to a total of 21 facilities (Mitsurou having 15, and Itochu 6) at substantial savings from the Tepco price. The average reduction over the 21 facilities is 21.9%, and the total cost reduction is YEN 3.18 million, which is significant savings for such a small community.39

Other local governments plan to draw on PPS for green power, and aim to make the initiative a model for others to follow. A recent example is Atsugi City’s (population: 225,000) August 22 deal with above-noted Orix as well as Kanagawa Power. The three entities are cooperating on using the power generated by solar panels in the city to supply 15 of the city’s public buildings. This arrangement will see the city cancel its power contracts with the regional monopoly, Tepco, by December. The move is expected to save the city YEN 1.5 million in power costs. But the plan is also designed deliberately to be a template for other local governments’ “local production-local consumption” initiatives to enhance local resilience.40

These kinds of leadership templates are important. Many local governments have plans to expand renewables, but not necessarily the technical sophistication to build the capacity into a larger system. On local renewables, Hitotsubashi University Natural Resource Economics Project team members Fujii Kohei and Yamashita Hidetoshi conducted a survey of “The Actual Conditions And Issues of Renewable Energy Use in the Municipalities” earlier this year. They produced a questionnaire that inquired whether the local governments were deploying renewable energy, in what fashion, and whether they were planning to expand it. Collaborating with the Asahi and Kyodo news agencies, they sent the survey to all of Japan’s 1741 local governments during May and June. They received replies from 288 locals (16.5%) as of May 28, of which 73% reported they had renewable power deployed. Fully 58% of the generation was solar, 14% wind, and 7% biomass. The operator, in 33% of the cases, was the municipality, with outside business being the operator in 28% of cases, and a local business in 22% of cases. Fully 92% reported they were considering more renewables, for environmental as well as resilience reasons.41

And many local governments are simply shifting their power contracts to PPS firms to get a lower price, irrespective of whether the new power is renewables. A recent survey by the Sankei Shimbun, which is quite conservative and overtly pro-nuclear, found that 21 of Japan’s 49 prefectures have shifted power supply for their main offices to PPS firms. This number was apparently a 150% increase on the number of prefectural offices abandoning the monopolies last year.42 While this kind of contract-cancellation does not necessarily advantage renewable, it does bolster the position of the PPS business overall.

Moreover, according to the August 6, 2014 Nikkei Shimbun, contract cancellations with the monopoly suppliers and shifts to new power firms are seen in 41% of firms surveyed by the newspaper during June and July. The survey received usable responses from 78 firms. Of those, 43 were in manufacturing and 35 in non-manufacturing.

The survey showed that 41% of the firms were already purchasing power from the PPS new power firms. It also showed that 12% of the surveyed firms were considering purchasing power from the new power firms. Manufacturing firms tend to use large amounts of power, and the number of manufacturing firms already purchasing power from the new power firms was 44%, with 16% considering purchasing power from new power firms, for a total of 60% either already purchasing power or considering.

As to cost of power, the surveyed firms indicated that their power costs for 2014 would increase by, on average, an estimated 22% over prices prevailing in 2010. All firms indicated that they had made efforts to reduce their power consumption, but that the price increases by the monopoly utilities had effectively made that a wash in terms of costs, and thus the turn to new power producers was a defensive move for their bottom lines. Interestingly, the article’s title was “large firms power cancellations total 11 nuclear reactors worth.”43

Innovation in Energy Services

It is hardly surprising that, in the context described above, significant innovation is evident in energy services. Indeed, in some casesentire business sectors are innovating in the power supply area. One example is outlined in the August 15 Nihon Keizai Shimbun. It details how printing firms (whose businesses have been hit by declining demand due to population decrease and the use of iPads, etc) are designing services for firms in the PPS market. These services include assistance in finding potential customers, various innovative mechanisms to combine power supply to households (from 2016 deregulation) with a variety of ancillary services to encourage conservation.44

Another promising area of innovation is seen in HL Solutions, which offers a package of options (advice on efficiency, PPS, solar deployment, etc) that includes splitting power contracts between the monopoly utility and a PPS. HL Solutions is an energy-services firm that has been active in Kyushu since May of 2012. As of August 1 of 2014, they have expanded their offices from Fukuoka Prefecture’s Ohnojou City (a mid-size city of just under 100,000 people) to Kitakyushu and Kumamoto cities (both large urban “smart city” centres in Kyushu, and the former having been the focusof a “green city” report for the OECD in 201245). HL Solutions will also open offices in Oita City. HL Solutions has already done this “partial supply” contracting for 100 clients as of April 2014, and anticipates a business volume of over 50 clients per month. This innovation has allowed HL Solutions to get over the business problem of still-limited PPS power supply (only 4-5% of capacity). This development possibly not only changes the incentives for HL and other energy service firms but for PPS firms as well as the renewable industry per se. This is because it enhances the ability to use the monopolies’ power capacity while at the same time eroding it. This information on HL Solutions is carried in a August 5, 2014 piece by “Construction Industry,” which portrays the PPS and related expansion of firms (such as HL Solutions) as a boon for the construction industry.46

Again, not all of this activity is due to the FIT, because much of the PPS power is generated by fossil fuels. But the FIT clearly plays a significant role in a larger context. This bears out the arguments of Tokyo Shoko and updates them.

Maximizing the Benefits From the FIT

Though the Japanese FIT clearly works, it very much needs to be adjusted and embraced by a better coordination of energy and environmental policies. This would help Japan accelerate its deployment of renewables as well as cut its costs.

For example, the attached chart on “Renewable Energy Production in Germany” shows that Germany’s striking success at expanding renewable power energy shift relied very heavily on wind from its 2000 adoption of the FIT.

The Germans deployed a lot of expensive wind power a decade ago. Thanks to their and others’ efforts, wind power is cheap. Technical innovations along with increased turbine size have made wind power so cheap in the present that it has become Denmark’s least expensive form of power. New Danish onshore wind projects scheduled for 2016 are set to produce power at less than half the price of coal and natural gas plants.47 Nor is this peculiar to Denmark. The Financial Times reported on September 18, 2014, that “[l]arge wind farms and solar plants are now cost-competitive with gas-fired power in many parts of the US even without subsidy.”48

Faster deployment of onshore wind in Japan is thus one comparatively inexpensive route to expanding renewable power production. The METI chart on “Tariff Rates” shows that at the FIT’s 2012 implementation, the tariff for large wind (over 20 kW) was YEN 23/kWh, far less than the YEN 42/kWh price guarantee for large-scale solar. Getting a lot of onshore wind on-line, creating employment and displacing costly fossil fuel imports and greenhouse-gas emissions, would require expanding grid capacity as well as shortening environmental assessments. In 2013, the opportunity was lost in a briar patch of bureaucratic inertia and the political focus on keeping the tottering monopolies, especially Tepco, viable in the face of massive costs from Fukushima.

But the chance was there, and remains there. This is seen in the fact that expansion of the grid for onshore wind power resources concentrated in the Tohoku region (devastated in the 3-11 disasters) is at present the subject of a survey by METI’s Agency for Energy and Natural Resources.49 Moreover, the present 3-4 years assessment periods for wind and geothermal projects are under review, in a METI Agency for Energy and Natural Resources and Energy initiative set to last between 2014-2016. The review is to select at least 10 new wind-power sites nationwide and monitor them from the beginning of the planning stage with an eye to halving the assessment period.50Only politics stands in the way of accelerating these initiatives, or finding other work-arounds. By contrast, Japan’s Ministry of Environment announced in April of 2013 that it would cut the assessment period for new coal plant from the four or more years at present to just one year.51 This suggests that political priorities, as much as technical possibilities, shape policymaking about the shifting composition of Japan’s power mix. Policymakers need to find autonomy from vested interests, so as to grasp their real resource endowments and the speed of relative price changes globally.

Cutting the FIT

The METI ‘s “Tariff Rate under the FIT Program” diagramme, reproduced earlier in this article, shows that the FIT started with very generous incentives for most renewables. This generosity was to stimulate business activity, and the understanding was that the tariffs would be scaled back after households’ and other potential investors’ interest was whetted. This powerful incentive was arguably especially important in Japan. Previous FIT schemes, as well as the RPS, had been managed by or on behalf of the power monopolies and the nuclear village. Captive bureaucrats in METI were in charge of promoting as well as regulating nuclear power. These actors dominated energy policymaking, and had no interest in seeing distributed renewable generation spread and undermine the economics of their aggressive commitment to centralized – and especially nuclear – power generation.52 Cutting through the toxic mountain of cynicism and investor risk built by these vested interests required a very high initial tariff. And at YEN 42/kWh, the tariff for large-scale solar was especially generous by international standards. Through Japan’s FIT, a large-scale (over 10 kilowatt) system installed in 2012 is guaranteed YEN 42 for every kilowatt-hour it generates over a period of 20 years.

As was planned, these tariffs have been reduced over time. The tariff for large-scale solar has dropped from YEN 42/kWh in 2012, YEN 38/kWh in 2013, to YEN 32/kWh as of April 2014. It is important to point out that tariff reductions (or “degressions,” as FIT experts refer to them) are an essential part of the policy. Scheduled cuts to the FIT tariffs are often interpreted in the press as a withdrawal from renewable energy, but that interpretation is inaccurate.

Tariff degressions apply to renewable power systems installed after the cuts are implemented, not to systems already installed. Degression encourages firms throughout the renewable industry, from the manufacturers to the service firms, to reduce the so-called “hard costs” of equipment and the “soft costs” (or “balance of system” costs) of installation and associated services. Trimming hard costs is primarily achieved by technical and process innovation as well as through economies of scale. Reductions in hard costs appear to have made up most of the decline in overall solar costs over the past few years, largely due to innovation among firms in the EU, Asian and North America, along with the overall industry’s economies of scale through increasing volume.

Cutting soft costs has become a major focus of initiatives in Japan as well as in the United States. Soft costs include four general categories of the “pre-install” aspects, such as preparing the site; “racking and mounting,” involving all phases of getting modules onto the desired spot (such as a roof); “electrical,” meaning wiring up the various elements of the system; and “non-production” that includes delays and down-time during other phases. Cutting these costs include faster and simpler installation as well as – for example – innovating software that simplifies paperwork.53

The good news here is that Japanese system costs have come down by 30 to 40% for solar. In the first quarter of 2010, the cost for residential solar system (under 10 KW) was YEN 598,000/kW, but had dropped to YEN 394,000/kW in the first quarter of 2014. This was a 33% decrease in costs in 4 years. But the drop in system costs for solar in the 10-50 kW class was even more pronounced. In this range, the 2010 cost of about YEN 700,000/kW fell to YEN 383,000/kW in 2013.54

The prospect of a cut in tariffs not only helps trim costs; it also gives investors the incentive to get their projects on-line as soon as possible. Startling declines in solar-system costs, in particular, mean that failure to cut the FIT tariffs might encourage investors to wait while panel prices dropped even further. This seems especially significant in Japan: After years of deflation, Japanese investors and consumers are used to delaying purchases because of the virtual certainty that prices will drop.

Given this backdrop, it would be much better for Japan if the METI minister and others were less concerned about saving the monopoly utilities and more focused on exploiting the incredible opportunity staring them in the face. Poorly designed tariff cuts, in tandem with continued uncertainty about grid access, risks eroding the large and expanding domestic renewable industry’s potential to increase its competitiveness as global costs for solar and other renewable systems drop. An indication of how rapid renewable costs are nosediving is seen in the attached figure, from the August 28, 2014 IEA Medium Term Renewable Energy Market Report (MTREMR).55 The chart shows that between 2010 and the most recent data for this year, the global average cost for various sizes (ie, large-scale utility to small rooftop) of solar systems has plummeted.

Source

These costs seem likely to continue falling dramatically, and almost certainly at a faster rate than predicted by the IEA. This possibility deserves an aside, as it is of direct relevance to Japan’s FIT and its energy policies in general. Renewable-energy experts argue that the new IEA solar cost data reflect an “awakening” for the agency, as it has hitherto been overly cautious in its presentation of the evidence. For example, the IEA MTREMR 2014 calculated average of 2010-2014 solar costs are a substantial reduction from those the IEA presented just a year ago in its MTREMR 2013. Moreover, the attached MTREMR 2014 chart’s projections of system-price declines from 2014 to 2020 are a sharp contrast to the US National Renewable Energy Laboratory and other reputable agencies that expect large-scale solar costs to drop to a level 40% below what the IEA now estimates.56

The IEA certainly deserves to be lauded for accumulating renewable-energy expertise in its ranks from the late 2000s, and then finally bringing out its first MTREMR in 2011. The IEA are tasked with a very difficult job in an era of very rapid and disruptive changes in relative energy costs and technically or economically exploitable resource endowments. At the same time, it has a special responsibility: its annual World Energy Outlook reports, as well as its medium-term reports on coal and other conventional energy as well as renewables (from 2011) and efficiency (from 2012), inform energy policymaking in most countries. And far more than when the IEA was first instituted in 1974, after the first oil shock, energy policymaking is crucial to achieving sustainable and equitable growth in an increasingly resource-scarce and climate-challenged world. So surely the IEA must be very cautious to ensure that its modeling assumptions about the investment costs of solar, the learning curve cost-reduction through each doubling of deployed solar capacity, and other pertinent items are consistent with best practice in specialist agencies as well as with the facts. Yet as Terje Osmundsen details in his February 2014 analysis of “How the International Energy Agency Exaggerates the Costs and Underestimates the Growth of Solar Photovoltaics,”57 the IEA’s analytical tools are clearly not keeping pace with empirical reality. It is to be lamented that the IEA, not unlike Japan’s METI Minister, seems inhibited by the weight of conventional energy staff and their assumptions in its ranks.58

Conclusion

As we have seen, Japan’s FIT has indeed produced some successes and seems set to drive even more productive change. One prominent reason is that the FIT has become linked to other large-scale policy streams, such as Japan’s proliferation of renewable energy and efficiency-centred smart communities. Large swathes of Japan’s business community and local governments appear to have concluded that the promise of cheap nuclear power as the basis for growth is not in the cards. Instead, they have turned to producing energy and innovations locally, especially in the context of smart communities, which afford an attractive base for bolstering local business, fiscal resources, and resilience. Ironically, the Abe regime appears compelled to help. Its Abenomics experiment has not gone as well as voters gambled on and as its boosters claimed it would. As a result, a revised “Local Abenomics” is underway. This is because the Abe regime faces a string of politically important local elections over the next several months.59 Team Abe will have to be careful, as their new emphasis on reviving local economies not only confronts voters doubts60 but also unfolds in the context of a public-private coalition busy implementing “local production and consumption” in energy.

Against the global backdrop of cost compression in solar, as well as similar developments in wind and other renewables, it would be absurd for the managers of the Japanese FIT to respond by maintaining high tariffs. That would mean coddling an expensive solar industry that cannot compete in a world where solar power is – as Citigroup details – already competitive with the retail price of in much of the world, without subsidies, including Japan this year.61 But at the same time, better policy coordination is crucial to further deployment and innovation in the face of monopoly utility opposition. Japan’s remarkable and costly failure on nuclear power has left it with a highly subsidized industry in search of a FIT-like price guarantee62 and monopoly utilities desperate to exclude renewable power and competitors.63 These facts should be uppermost in the minds of FIT managers and the political leadership. Some very politically wrenching choices appear inevitable, with potentially a punishingly high cost for policymaking failure. Surely the last thing one would want to do in the world’s most rapidly ageing society, with the OECD’s worst public-debt burden, is throw good money after bad by failing to exploit an abundance of renewable resources.

Andrew DeWit is Professor in Rikkyo University’s School of Policy Studies and a coordinator of The Asia-Pacific Journal. His recent publications include “Climate Change and the Military Role in Humanitarian Assistance and Disaster Response,” in Paul Bacon and Christopher Hobson (eds) Human Security and Japan’s Triple Disaster (Routledge, 2014), “Japan’s renewable power prospects,” in Jeff Kingston (ed) Critical Issues in Contemporary Japan(Routledge 2013), and (with Kaneko Masaru and Iida Tetsunari) “Fukushima and the Political Economy of Power Policy in Japan” in Jeff Kingston (ed) Natural Disaster and Nuclear Crisis in Japan: Response and Recovery after Japan’s 3/11 (Routledge, 2012). He is lead researcher for a five-year (2010-2015) Japanese-Government funded project on the political economy of the Feed-in Tariff.

Recommended Citation: Andrew DeWit, “A New Japanese Miracle? Its Hamstrung Feed-in Tariff Actually Works”, The Asia-Pacific Journal, Vol. 12, Issue 38, No. 2, September 22, 2014.

Related articles

• Japan’s Rollout of Smart Cities: What Role for the Citizens?

• •Andrew DeWit, Could a US-Japan “Green Alliance” Transform the Climate-Energy Equation?

• Andrew DeWit, Distributed Power and Incentives in Post-Fukushima Japan

• John A. Mathews, The Asian Super Grid

• Andrew DeWit, Japan’s Energy Policy at a Crossroads: A Renewable Energy Future?

• Sun-Jin YUN, Myung-Rae Cho and David von Hippel, The Current Status of Green Growth in Korea: Energy and Urban Security

Notes

1 For the details, see “With Developing Worlds Policy Support, Global Renewable Energy Generation Capacity Jumps to Record Level,” UNEP News Centre, June 3, 2014.

2 On September 10, Japan’s Nuclear Regulation Authority gave its approval for restart of the 2 nuclear reactors at the Sendai plant in Kyushu. Since the assent of local governments is required before actual restart of the plant, they may not come on-line until early 2015. See Kentaro Hamada, “Japan approves nuclear restart amid push to close old reactors,” Reuters, September 10, 2014.

3 For example, note the comments of analysts cited by Jacob Adelman and Chisaki Watanabe in “Japan Rejoining Nuclear Club Leaves Fossil Fuel Appetite,” Bloomberg News, July 29, 2014.

4 On this, see the interview with Wall Street Journal Japanese energy-policy reporter, Mari Iwata, in Clint Richards, “Interview: Japan’s Post-Nuclear Future,” The Diplomat, September 18, 2014.

5 Thomas Gerke, “The debate over restarting nuclear reactors in Japan,” Renewables International, April 9, 2014.

6 See Yuriy Humber, “Nuclear Power-less Japan Must Pay for Fuel Imports in Weak Yen,” Bloomberg Businessweek, September 18, 2014.

7 See (in Japanese) “Mid-Term Report on Conditions and Outlook for SSL, LED and Organic EL Lighting, 2014” EM Data, August 2014.

8 See p. 2 of Christine Holland, “Are LEDs the Next CFL: A Diffusion of Innovation Analysis,” 2014 ACEEE Summer Study on Energy Efficiency in Buildings paper 9-426.

9 “Vending in Japan,” Euromonitor Report, March 2014.

10 These figures are based on the Agency for Natural Resources and Energy “Electricity Survey Statistics,” and compiled by Greenpeace Japan in a September 15, 2014 article celebrating a year without nuclear power. Their summary of the data suggests that compared to 2010, the power savings in 2013 saved YEN 1.7 trillion in fossil fuel costs. See (in Japanese) “Celebrate! One Year of Zero Nuclear Generation,” Greenpeace, September 15, 2014.

11 See “Energy efficiency: a key tool for boosting economic and social development,” IEA Press Release, September 9, 2014.

12 See (in Japanese) Fujinami Takumi, “Making Conservation the Spring for This Country’s Growth: Key Items are Consumers’ Conservation Investment and the Shifting Industrial Structure,” Japan Research Institute New Energy Basic Plan Deliberation Series No. 4, Paper 2014-027, August 21, 2014.

13 For example, as the “Global Cleantech Innovation Index 2014” report comparing 40 countries (including all of the G20 members) notes on its page 8, “Cleantech venture capital is still primarily made up of energy-related technologies (51 percent in 2013), though much less so compared to 77 percent in 2010, and much more of the energy element is around efficiencies, as opposed to renewables generation.” The report is available here.

14 Tawada Yoshihisa, the head of the Japanese Solar Energy Association, stresses this fact in noting that Japanese solar initiatives date back to the mid-1950s. See (in Japanese) “Cutting through the trilemma of the 3 Es and producing a virtuous cycle,” President, September 20, 2014.

15 Masanori Tobita, “Geothermal energy is Japan’s buried treasure,” Nikkei Asian Review, October 30, 2013.

16 The New Energy and Industrial Technology Development Organization (NEDO) is Japan’s top quango for energy R&D. Its September 18, Sunshine Plan 40-Year Anniversary Special Symposium announcement and details (in Japanese) are here.

17 See “Japan’s new minister says energy policy without nuclear difficult,” Reuters, September 21, 2014. Obuchi’s remark came during the regular Sunday debate show on NHK, and the clip is available in the original Japanesehere.

18 Lovins’ profile is available at the Foundation’s web site.

19 Lovins’ comparative figures are nicely visualized (in Japanese) in the first 2 minutes of this November 2, 2012 NHK broadcast “Taking on an Energy Shift”.

20 See Amory Lovins, “How Opposite Energy Policies Turned The Fukushima Disaster Into A Loss For Japan And A Win For Germany,” Japan Renewable Energy Foundation, September 4, 2014.

21 Quirin Schiermier, “Renewable power: Germany’s energy gamble,” Nature, April 10, 2013.

22 See “RECAI Renewable Energy Country Attractiveness Index,” Issue 42, September 2014, p 20.

23 See “Conergy files for insolvency as solar crisis deepens,” Reuters, July 5, 2013.

24 One of the German sites of innovation is Karlsruhe Institute of Technology, or KIT, where storage solutions are a focus of research. See “Largest German Solar Power Storage Park,” KIT Press Release 106/2014.

25 Craig Morris, “German exports of renewable technology,” Energy Transition, August 27, 2014.

26 See Mika Ohbayashi, “Great Achievements of Feed-in Tariff and Challenges for Japan’s Renewable Energy Policy,” Japan Renewable Energy Foundation Renewables Update, September 5, 2014.

27 For the data on Japan’s power, see (in Japanese) “Current conditions and issues concerning renewable energy,” METI Agency for Natural Resources and Energy, June 17, 2014: Agency for Natural Resources and Energy

28 In technical terms, as opposed to regulatory barriers. Fast deployment of onshore wind would require shortening environmental assessments.

29 See Amory Lovins, “How Opposite Energy Policies Turned The Fukushima Disaster Into A Loss For Japan And A Win For Germany,” Japan Renewable Energy Foundation, September 4, 2014.

30 See (in Japanese) Kaneko Kenji, “The JPEA reports that the domestic soalr system market totals YEN 2.5 trillion and 210,000 jobs,” in Nikkei Tekunologii, August 22, 2014.

31 See (in Japanese) “2013 new business starts at about 110,000 firms, 4th year of increases,” Tokyo Shoko Research, August 8, 2014.

32 Its corporate history (in Japanese) is here.

33 See (in Japanese) “2013 new power business starts of 1,799 firms was 2.2 times the previous year,” Tokyo Shoko Research, August 13, 2014.

34 On this, see (in Japanese) “What is a PPS?” Epower-management, August 25, 2013.

35 The number of PPS firms, their power output, and other information is available (in Japanese) here.

36 See (in Japanese) “Orix plans to invest YEN 300 billion in renewable power over the next five years,” Nikkei Shimbun, August 14, 2014.

37 The Orix Group’s very detailed English-language website is here.

38 See (in Japanese) Kaneko Kenji, “Osaka Prefecture Izumisano City is to set up a PPS within the year, using power supplied by megasolar projects at Kansai International Airport,” Nikkei Technology, August 28, 2014.

39 The city describes the details of the contracts and their background, in Japanese, here.

40 On the plan, see (in Japanese) Ishida Masaya, “Energy production and local consumption in Kanagawa Prefecture, cutting power costs by YEN 1.5 million with megasolar,” Smart Japan, August 28, 2014.

41 See (in Japanese) Fujii Kohei and Yamashita Hidetoshi, “The Actual Conditions And Issues of Renewable Energy Use in the Municipalities,” Presentation Overview for Society for Environmental Economics and Policy Studies, SEEPS, September 13-14, 2014.

42 See (in Japanese) “21 prefectures shift power supply for head offices to PPS,” Sankei Shimbun, July 13, 2014.

43 Unfortunately, the article is not accessible online. It is (in Japanese) ““Large firms power cancellations total 11 nuclear reactors worth,” Nikkei Shimbun, August 6, 2014, page 11.

44 See (in Japanese) “Large printing firms in support of PPS,” Nihon Keizai Shimbun, August 15, 2014.

45 See “Green Growth in Kitakyushu, Japan,” OECD, May 23, 2013.

46 See (in Japanese) Tojo Yohei, “Partial supply gives strong following wind to PPS,” Construction News, August 5, 2014.

47 Ari Phillips, “Onshore Wind Power Is Now Cheapest Form Of New Electricity In Denmark,” Climate Progress, July 22, 2014.

48 Ed Crooks, “US solar and wind start to outshine gas,” Financial Times, September 18, 2014.

49 The Agency is investigating whether special purpose companies might be a suitable mechanism for securing grid access fees, construction costs, and other funds from wind producers. On this, see (in Japanese) “The Energy Agency is subsidizing an initiative in 3 areas of Tohoku aimed at expanding grid capacity for wind power,” July 15, 2014.

50 On this, see (in Japanese) “METI Agency for Natural Resources and Energy selects 10 firms for test to cut environmental assessments for wind and geothermal,” Denki Shimbun, August 19, 2014.

51 See “Japan Infrastructure Report: Energy and Utilities, Q4, 2014, Industry Forecast,” BMI Infrastructure Report, October 1, 2014.”

52 On the background, see Andrew DeWit and Iida Tetsunari, “The ‘Power Elite’ and Environmental-Energy Policy in Japan,” The Asia-Pacific Journal Vol 9, Issue 4 No 4, January 24, 2011.

53 See Koben Calhoun and Jesse Morris, “Getting To The Bottom Of US–Germany Solar Soft Cost Differences, & How To Make Solar Cheaper In US Than In Germany,” CleanTechnica, December 6, 2013.

54 See Mika Ohbayashi, “Great Achievements of Feed-in Tariff and Challenges for Japan’s Renewable Energy Policy,” Japan Renewable Energy Foundation Renewables Update, September 5, 2014.

55 The IEA report is available here.

56 See Terje Osmundsen, “Only solar PV is exceeding expectations for clean energy,” REneweconomy, September 11, 2014.

57 See Terje Osmundsen, IEA and Solar PV: Two World’s Apart, Norwegian Climate Foundation Report no. 1/2014.

58 On the anthropological and other problems in energy forecasting in general, including in the IEA, see Steve Yetiv and Lowell Field, “Why Energy Forecasting Goes Wildly Wrong,” Journal of Energy Security, October 23, 2014.

59 On the economic and political challenges for Abenomics, see Linda Sieg and Tetsuji Kajimoto, “Japan’s Abenomics feared in trouble as challenges build,” Reuters, September 2, 2014.

60 See (in Japanese) “Expectations for ‘local revival’ are split 50-50,” Nihonkai Shimbun, September 14, 2014.

61 The July 28, 2014 Citigroup analysis is “Global Energy 2020: The Revolution Will Not Be Televised as Disruptors Multiply,” and it is available here. Note that on pp 46-49 they project an restart of much of the downed nuclear capacity, but do not project nuclear to achieve its 2009 peak of 48.9 Gigawatts of power. Their scenarios for solar, by contrast, see it supplying at least 45.2 Gigawatts of power by 2013 and perhaps as much as 109.7 Gigawatts. They also make note of “wild cards” at the intersection of energy and technology (p. 31), but neglect the items taken up later in this paper.

62 The nuclear village are clearly paying attention to falling renewable prices. On August 21, 2014, the METI formally proposed a UK-style price guarantee for nuclear power, should its cost become uncompetitive. See (in Japanese) “METI is keen to introduce a ‘price guarantee’ for nuclear, but passing costs onto users is meeting stiff criticism,” Reuters, August 21, 2014.

63 For example, on September 19, Kyushu Electric announced that it was considering a halt to purchases of renewable power in its service area, citing concern over capacity of the grid. See (in Japanese) “Kyushu Electric announces that it is considering halting renewable purchases,” Mainichi Shimbun, September 20, 2014.

Sanctions are forcing large volumes of trade and finance out of the ambit of traditional networks, weakening western control over such flows.

Western sanctions are having an unintended effect. They are accelerating the birth of a parallel ecosystem where countries not allied to the West are able to operate without the constant threat of sanctions. Free of western control, this alternative platform is gaining traction at a surprisingly fast pace.

It is worth mentioning at the start that western companies have a huge exposure in the Russian market. In contrast, Russia is primarily an exporter of commodities such as oil, gas, metals and minerals which are in great demand – especially in Asia’s ravenous markets. Bottom line: while western consumer and capital goods can be replaced by Asian manufacturers, Russian commodities are the lifeblood of economies in both Asia and Europe.

SWIFT move

The move towards a non-western world is happening most rapidly in the area of finance. This is hardly surprising because financial flows are easier to reroute – and replace – than say, a shipment of coal or an oil tanker.

Among the dozens of sanctions directed against Russia, the most extreme one was proposed by the UK, which pressed European Union leaders to block Russian access to the SWIFT banking transaction system. The Belgium-based SWIFT, which stands for the Society for Worldwide Interbank Financial Telecommunication, is the financial world’s very arteries.

Restricting Russian usage of SWIFT would no doubt disrupt financial and commercial activities in the country, but according to Richard Reid of the University of Dundee in Scotland it may carry a longer-term downside. “Large chunks of Russian international payments flows would move to much less well monitored and measured financial channels and thus be beyond sanctions at any future point,” he told Bloomberg News.

Although German Chancellor Angela Merkel swiftly rejected the British proposal as too extreme, the damage has been done. It is now abundantly clear to Moscow that the US-UK evil twins are not content with symbolic sanctions but are really out to destroy its economy. Anticipating this blow to its financial jugular, Russia had in July drawn up a law that would create a local equivalent of SWIFT.

The sanctions have also highlighted the synergy between Russia and China. Vesti Finance says sanctions aimed at restricting Russian access to finance will have almost no sense, since Russian companies will find the necessary money in China. And the Chinese are keen to increase the impact of the renminbi and turn it into the world’s reserve currency.

De-dollarisation

The move to a parallel payment system is happening in tandem with the ditching of the US dollar on which the entire US economy – and hegemony – pivots. The dollar’s status as the reserve currency is due to it being the only currency accepted de-dollarizationin the petroleum market, which is why it’s also known as the petrodollar.

That’s about to change as Russia and other emerging powers are planning to drop the petrodollar and end the dollar’s reserve status. But because the dollar’s dominance is so overwhelming in the petroleum trade, it would require someone really big to take it down.

That heavy hitter is Gazprom. Kommersant reports the Russian oil company has started shipping oil from the Arctic and the tankers will arrive in European ports this month, with payment to be received in rubles. Gazprom will also deliver oil via the Eastern Siberia-Pacific Ocean pipeline (ESPO), accepting payment in Chinese renminbi.

Finance portal Zero Hedge says, “Russia is actively pushing on with plans to put the US dollar in the rearview mirror and replace it with a dollar-free system – or a de-dollarised world.”

Citing the Voice of Russia, Zero Hedge says the country’s Ministry of Finance is ready to greenlight a plan to radically increase the role of the ruble in export operations while reducing the share of dollar-denominated transactions.

As Zero Hedge says, “The further the west antagonises Russia, and the more economic sanctions it lobs at it, the more Russia will be forced away from a US dollar-denominated trading system and into one which faces China and India.”

Worth mentioning is that the Siberia-sized $400 billion gas contract with China – which Moscow and Beijing had haggled over for a decade – finally got inked in May 2014, after westerns sanctions kicked in.

Military: That sinking feeling

It is a pointer to the paucity of strategic thinking in France and Germany that they are so easily swayed by the US-UK combine to welch on military contracts already inked with Russia. The built-in penalties aside, the breach of contract is guaranteed to alarm other buyers.

If Germany and France are planning to drive away their weapons customers, then they are doing a pretty good job of it. But look at it this way: perhaps that’s precisely what the US and UK have been planning all along – to attract disillusioned buyers.

military_modernizationAs part of its military modernisation, Russia had hired Germany’s Rheinmetall to build a modern military training facility. But under pressure from the US, Germany cancelled the $134 million contract. Strategy Page says Russia may turn to China to get the training centre built as China has obtained – or rather purloined – the technology and built its own.

The growing list of sanctions against Russia has hit the Russian arms industry particularly hard because new Russian weapons depend on Western suppliers for some of the high tech components needed,” says Strategy Page. “China is taking advantage of this by pointing out it has become a major producer of high-end electronic and mechanical components, and can probably replace Western suppliers now unavailable because of the sanctions. While Russia does not buy a lot of foreign weapons it does buy a lot of high-tech components (especially electronic ones) from the West. A lot of these items are dual use items that China and other East Asian countries also manufacture. China backs Russian (moves in Ukraine) and is hostile to sanctions (which it has been under for several decades). Beijing believes it can replace enough western suppliers to Russia to create about $1 billion a year in additional business for Chinese firms.”

Similarly, India is watching – with a mix of amusement and dismay – France kowtow to the US and letting its $1.6 billion Mistral deal with Russia sink. France has been a reliable supplier of quality combat systems and has never welched on a deal with India. However, that was in the past when France had opted out of NATO. With Paris now syncing its foreign policy with the warlords in Washington, India’s military should be cagey about ‘Made in France’ technology.

Loss-loss for the West

As the US and EU fumble around in the dark, there is considerable activity in countries allied to Russia. As well as market-led movements (food exporters from Asia rushing in to fill Russian supermarket shelves) there are strategic moves afoot. For instance, the US and EU have a monopoly on wide body aircraft and also dominate the middle categories. The sanctions are just the push required to expedite aviation joint ventures, particularly between Russia and China in wide body aircraft and Russia and India in mid-size airliners.

The concept of a “World Without the West” was first articulated by American academics Steven Weber, Naazneen Barma and Ely Ratner. “By preferentially deepening their own ties among themselves, and in so doing loosening relatively the ties that bind them to the international system centred in the West, rising powers are building an alternative system of international politics whose endpoint is neither conflict nor assimilation with the West,” they say.

So in effect, by not playing by the rules and systems set by the West they are creating an alternative arrangement in which they neither enter into conflict situations with the West nor enter into subservient alliances (like those offered to South Korea and Japan).

Years from now, westerners will ruefully look back at the sanctions as the tipping point that ushered in a world without the West.

Smugglers Threw Asylum Seekers Into Mediterranean

September 22nd, 2014 by Global Research News

by Tom Rollins

The journey started like any other.

The migrants paid the smugglers. Buses collected them in groups of around 100 and took them to Damietta, a port on the northeastern edge of the Nile Delta. On Sept. 6, the several hundred migrants from Egypt, the Gaza Strip, Sudan and Syria left Damietta, bound for Italy.

But it wasn’t to be. On Sept. 14, news spread of an almost unprecedented human tragedy in the Mediterranean. The Damietta boat had been deliberately sunk four days earlier by smugglers off the coast of Malta. At the time, around 500 people were believed drowned or missing. Just a handful of survivors remained.

“Najwa,” a refugee who asked to use a pseudonym, was on that boat. She told Al-Monitor, ”I paid 20,000 Egyptian pounds [$2,800] to the smugglers, but each nationality was paying a different price.” Najwa added that the smugglers running the trip were of different nationalities: Egyptian, Libyan and Palestinian.

A Palestinian diplomat suggested that more than half of those missing were Gazan Palestinians escaping conflict, poverty and blockade in a territory crippled by the latest Israeli bombardment. There were more than 100 children on board, Najwa recalled, adding, ”One of the guys I met, his house was attacked in Gaza and so he was trying to escape to get to Sweden to see his family.”

Four days into the journey, the migrants had already changed boats three times. However, the smugglers — in a separate vessel — said they would have to swap again. Everyone was told to clamber into a small fishing boat that the migrants feared would not hold them. People grew nervous. Najwa said, ”We refused to move from the boat where we were to the smaller boat. So they forced us.”

According to eyewitness testimony collected by the International Organization of Migration (IOM), at this point a “violent argument” broke out, with the smugglers “yelling and throwing sticks at the migrants.”Things escalated from there.

“When we refused, they started throwing people in the sea,” Najwa said. “Then they hit our boat several times until it sank.”

One man hanged himself before the boat went down, according to IOM. Around 300 people in the lower deck were trapped and drowned immediately, according to other eyewitness testimony. Familiar faces disappeared amid panic and seawater.

“People were dying,” said Najwa, flatly. “So many people died in front of my eyes. I saw families from my neighborhood [in Egypt]. One of the four people traveling with me lost both his brothers.”

Najwa swam and managed to stay afloat for an hour until a European naval vessel rescued her.

“They detained me for two days, then moved me to shelters with another four people,” she said. “Then they gave us the chance to speak to our families.”

Najwa’s story, corroborated by several survivors interviewed by IOM, points to an almost unprecedented level of cruelty by smugglers in the Mediterranean. ”The smugglers never cared about us or our safety,” she admits. One survivor told IOM the smugglers were laughing as they sailed away from the shipwrecked migrants.

Egypt’s Ministry of Interior has blamed Mediterranean smuggling on organized crime gangs. Interior Ministry spokesman Hany Abdul Latif said, ”There is a mafia of smugglers that work on smuggling illegal immigrants to Italy.”

At least 700 people are estimated to have drowned or gone missing at sea since last week, bringing the total of dead and missing immigrants in the Mediterranean to 2,900 in this year alone.

On Sept. 13, at least 15 Palestinians from Gaza were reported drowned in Egyptian waters after their boat — also bound for Italy — hit a rock and sank off the coast west of Alexandria. More boats off the Libyan coast also capsized, leaving hundreds of African migrants unaccounted for on Sunday night.

Muhammad Kashef, a monitoring and documentation officer at the Egyptian Initiative for Personal Rights in Alexandria, told Al-Monitor that Egypt’s Mediterranean smuggling routes were “halfway between smuggling and human trafficking.”

Khaled, a Syrian refugee who is still planning to head to Italy from Egypt despite the risks, claims smugglers increasingly see migrants as nothing more than financial assets — and treat them accordingly. He knows all too well how dire the conditions during these trips can be after his son, Mahmoud, sailed from Damietta.

“I know I am nothing more than a T-shirt or shoes to them, but what can I do? I must go,” said Khaled.

Mahmoud was held by smugglers in a seaside hut for half a week without food or water while they waited for a boat to take them away. Khaled said, ”They drank the water from the sea. Can you imagine?”

Researchers in Alexandria have been documenting stories like Mahmoud’s. Heba Atallah Mansour, who documents refugee migrations and detentions with Alexandria’s Refugee Solidarity Movement, told Al-Monitor, ”One boat recently stayed in the water for six to seven days, and the migrants themselves contacted the coast guard.” In another case, a boat full of migrants waited at sea for a week, until those onboard finally told the smugglers they wanted to go back. Mansour added, ”Then the migrants heard the smugglers talking about setting fire to the boat and ‘getting rid’ of them.” They were eventually found by the Egyptian coast guard and taken to a detention center.

The Malta incident may be the worst migrant shipwreck in years, but abuses by smugglers are nothing new, and such mistreatment and violence are increasingly becoming the norm in the Mediterranean.

Tom Rollins is a freelance journalist based in Cairo.

Copyright Tom Rollins, Al-Monitor 2014.

When “Men-Only Streets” Are Okay in London

September 22nd, 2014 by Jonathan Cook

Imagine in one of London’s central districts, a Muslim group representing a significant section of the local community puts up notices before a street event telling women to confine themselves to one side of the road only. The posters, in Arabic and English, state: “Women should please walk along this side of the road only.”

How much coverage in the UK media do you think this would receive? Would we see articles about Muslims trying to bring sharia law to the streets of London? Would commentators fall over themselves to decry Islam as a religion of extremism and intolerance? Would our media and politicians call on Muslim leaders to denounce such primitive practices?

From long experience, we all know the answer.

So how to explain the near-silence about exactly this happening last week in the London district of Hackney, except that religious Jews rather than Muslims were the party responsible. The Shomrim organisation put up the signs in preparation for the Torah procession in Stamford Hill. The posters were removed after local residents complained.

But as the Redress website notes, the official response has been decidedly muted. An online search finds this story apparently of interest – and then only marginally – to local London media, plus one low-key story in the national Independent newspaper. And a police spokesman merely expresses concern about a “potential misinterpretation” of the signs, without explaining in what possible way they might be misinterpreted.

He adds that Shomrim “have agreed that next year they will only be written in Hebrew and will be removed more swiftly after the event.”

As Redress observes:

In other words, as long as the Jewish misogynists confine their hateful practice to Hebrew-reading Jewish women, and do so quickly before anyone has had time to ponder why this is happening on the streets of a British city, everything would be fine.

It is worth bearing this story in mind next time you read an Islam scare story in the western media. What standards are used in assessing the Muslim community and how consistently are they being applied to other religious communities? And if there is an inconsistency, what motivates it? Why are news editors regularly playing up a Muslim threat, but playing down a Jewish or Christian or Hindi or Sikh threat?

www.redressonline.com/2014/09/uk-official-implies-jewish-misogyny-is-fine-as-long-as-it-is-confined-to-jews/

- See more at: http://www.jonathan-cook.net/blog/2014-09-22/when-men-only-streets-are-okay-in-london/#sthash.X1BqyZCH.dpuf

Since China fired its first ‘official’ shot across the Petrodollar bow a year ago, there has been an increasing groundswell of de-dollarization across the world’s energy trade (despite Washington’s exclamations of ‘isolated’ non-dollar transactors).

The rise of the PetroYuan has not been far from our headlines in the last year, with China increasingly leveraging its rise as an economic power and as the most important incremental market for hydrocarbon exporters, in the Persian Gulf and the former Soviet Union, to circumscribe dollar dominance in global energy – with potentially profound ramifications for America’s strategic position.

And now, as AP reports, for the first time in history, China has docked a Navy Destroyer in the Southern Iranian port of Bandar-Abbas – right across the Straits of Hormuz from ‘US stronghold-for-now’ Bahrain and UAE.

The rise of the PetroYuan has not been far from our headlines in the last year:

China Fires Shot Across Petrodollar Bow: Shanghai Futures Exchange May Price Crude Oil Futures In Yuan

Guest Post: From PetroDollar To PetroYuan – The Coming Proxy Wars

The Rise Of The Petroyuan And The Slow Erosion Of Dollar Hegemony

And now, as AP reports, for the first time in history, China has docked a Navy Destroyer in a Southern Iranian port of Bandar-Abbas – right across the Straits of Hormuz from ‘US stronghold-for-now’ Bahrain and UAE.

Adm. Hossein Azad, naval base chief in the southern port of Bandar Abbas, said the four-day visit that began Saturday saw the two navies sharing expertise in the field of marine rescue.

“On the last day of their visit while leaving Iran, the Chinese warships will stage a joint drill in line with mutual collaboration, and exchange of marine and technical information particularly in the field of aid and rescue,” said Azad.

The report said the destroyer was accompanied by a logistics ship, and that both were on their way to the Gulf of Aden as a part of an international mission to combat piracy.

Last year a Russian naval group docked in the same port on its way back from a Pacific Ocean mission.

The move is also seen part of off efforts by Iran to strike a balance among foreign navies present in the area near the strategic Strait of Hormuz, the passageway at the mouth of the Persian Gulf through which a fifth of the world’s oil is shipped.

U.S. Navy’s 5th Fleet is based in nearby Bahrain, on the southern coast of the Gulf.

*  *  *

Here’s why it matters…

*  *  *

As we concluded previously,

History and logic caution that current practices are not set in stone. With the rise of the “petroyuan,” movement towards a less dollar-centric currency regime in international energy markets—with potentially serious implications for the dollar’s broader standing—is already underway.

As China has emerged as a major player on the global energy scene, it has also embarked on an extended campaign to internationalise its currency. A rising share of China’s external trade is being denominated and settled in renminbi; issuance of renminbi-denominated financial instruments is growing. China is pursuing a protracted process of capital account liberalisation essential to full renminbi internationalisation, and is allowing more exchange rate flexibility for the yuan. The People’s Bank of China (PBOC) now has swap arrangements with over thirty other central banks—meaning that renminbi already effectively functions as a reserve currency.

Chinese policymakers appreciate the “advantages of incumbency” the dollar enjoys; their aim is not for renminbi to replace dollars, but to position the yuan alongside the greenback as a transactional and reserve currency. Besides economic benefits (e.g., lowering Chinese businesses’ foreign exchange costs), Beijing wants—for strategic reasons—to slow further growth of its enormous dollar reserves. China has watched America’s increasing propensity to cut off countries from the U.S. financial system as a foreign policy tool, and worries about Washington trying to leverage it this way; renminbi internationalisation can mitigate such vulnerability. More broadly, Beijing understands the importance of dollar dominance to American power; by chipping away at it, China can contain excessive U.S. unilateralism.

China has long incorporated financial instruments into its efforts to access foreign hydrocarbons. Now Beijing wants major energy producers to accept renminbi as a transactional currency—including to settle Chinese hydrocarbon purchases—and incorporate renminbi in their central bank reserves. Producers have reason to be receptive. China is, for the vastly foreseeable future, the main incremental market for hydrocarbon producers in the Persian Gulf and former Soviet Union. Widespread expectations of long-term yuan appreciation make accumulating renminbi reserves a “no brainer” in terms of portfolio diversification. And, as America is increasingly viewed as a hegemon in relative decline, China is seen as the preeminent rising power. Even for Gulf Arab states long reliant on Washington as their ultimate security guarantor, this makes closer ties to Beijing an imperative strategic hedge. For Russia, deteriorating relations with the United States impel deeper cooperation with China, against what both Moscow and Beijing consider a declining, yet still dangerously flailing and over-reactive, America.

For several years, China has paid for some of its oil imports from Iran with renminbi; in 2012, the PBOC and the UAE Central Bank set up a $5.5 billion currency swap, setting the stage for settling Chinese oil imports from Abu Dhabi in renminbi—an important expansion of petroyuan use in the Persian Gulf. The $400 billion Sino-Russian gas deal that was concluded this year apparently provides for settling Chinese purchases of Russian gas in renminbi; if fully realised, this would mean an appreciable role forrenminbi in transnational gas transactions.

Looking ahead, use of renminbi to settle international hydrocarbon sales will surely increase, accelerating the decline of American influence in key energy-producing regions. It will also make it marginally harder for Washington to finance what China and other rising powers consider overly interventionist foreign policies—a prospect America’s political class has hardly begun to ponder.

A few days after US Secretary of Defense Chuck Hagel visited Georgia in early September a foreign observer happened to be passing through Tbilisi International Airport. He told this author, “The first thing I saw when I landed on September 10 was a large US Air Force cargo plane taxiing and another on the tarmac being guarded. This was a huge Ukrainian Antonov plane; it was truly awesome in size.”

Usually there are five of these big cargo planes on the runway at Ramstein, a NATO airbase in Germany—on the day of the sighting there were only four.

On Sunday the cargo plane was still there. It was an Antonov model 124-100-150, tail number UR 82072. The US Military plane was still there too, but the one plane spotted seemed to have no number, which is somewhat unusual. Though it was impossible to get close enough to see the entire plane, there were no numbers on the tail, where they would usually be. I did not see the armed guards, but the Antonov at the Tbilisi airport did have a Ukrainian flag. Whatever it was carrying was being handled by soldiers rather than civilian baggage handlers, as they were repeatedly going in and out of the plane, as baggage handlers who work at the airport told me.

This first hand observation is consistent with others being made in the region’s airports, and the fact that defence contractors are being seen in Tbilisi more frequently, as they have been since it became clear that Georgia would sign an EU Association Agreement. It is also consistent with Ukraine’s claim that its NATO friends are now resupplying it with a variety of weapons and non-lethal materials.

Ukrainian Defense Minister Valery Geletey has said that he has held consultations with “the defence ministers of leading countries, those that can help us, and they heard us. We have the supply of arms underway, and I feel that this is exactly the way we need to go”. Ukrainian President Petro Poroshenko, who attended the Sept. 4-5 NATO summit in Wales, also announced following it that he had negotiated direct modern weapons supplies with a number of NATO member states. Although NATO denied this, the Antonov is there, and apparently arrived from a NATO airbase, with an escort, which it would not have unless it were carrying some sort of supplies.

Ratline of weapons

Is supplying an ally with weapons a big deal? Perhaps not. But if not, why the denials, when they come from the very countries which publicly supported the disturbances in Maidan Square and the “cause” they insisted they were about, despite the participants insisting otherwise?

The reason for the denials is that this is not a one-off delivery of legal weapons to an ally. The same ratline has long been used to transport illegal weapons to people who have no right to have them.

If previous experience is a guide, some of the weapons Ukraine says are bound for its Ministry of Defence will never get there. Some, or most, of them will be diverted to ISIS, and some will remain in Georgia as commission for allowing its airport to be used. The Georgian Armed Forces will not see these weapons either, as there are always other customers for such weapons, contacts intensively cultivated by the previous Georgian government to line party members’ pockets and occasionally fill holes in the budget.

Investigative journalist Seymour Hersh is one of those who has raised the issue of these ratlines and the criminality they foster at all levels of state. Hersh has detailed how weapons from Benghazi, spoils of war gained as a result of UN Resolution 1973 and the destruction of Libya, were ultimately transited through Turkey to the rebels, allegedly as part of rogue operations, through a similar illegal CIA ratline rather than any legal, accountable supply route, which cannot be used to supply terrorists.

This article merely confirmed what intelligence insiders have known for years: that America’s “train and equip programs”, offered as “defence partnerships” and “technical assistance” to states prepared to turn a blind eye in exchange for cash, are flimsy fronts for covert operations. These do not only involve trafficking conventional weapons but chemical agents, manufactured at one of the string of Soviet-era labs which are one relic of Communism the West has made no attempt to destroy, contrary to all its Cold War promises.

All this is dangerous enough in itself. But the big picture here is that going along with such schemes is the unspoken quid pro quo for signing trade deals, such as the EU Association Agreement recently signed by Georgia, which these countries need to survive and prosper. The US is setting out, not to spread democracy and respect for human rights, but to deny any country the possibility of earning an honest living. Most citizens of the countries now chained to these schemes, those same who have seen enough death and destruction without them, would not consider this an acceptable price to pay for their bread and butter.

Where and why?

More and more countries are getting involved in these ratlines without their public’s knowledge. Turkey, Jordan and Georgia have long worked together to provide weapons to various hotspots around the world. Libya and Azerbaijan have also become involved in more recent years, their links developing in direct proportion to Western involvement in developing their countries, through regime change in Libya and energy exploitation in Azerbaijan.

The weapons go two ways. Not only are illegal weapons sent from the West but trophies of war and legally supplied Western weapons are intercepted on their way back from Afghanistan and other places to provide a further source of unaccounted-for armaments. This isn’t hard when US military personnel write the manifests at each end, if they are allowed to ask any questions, that is.

Georgia has been subject of an unofficial arms embargo since the 2008 Georgian-Russian war, as too many weapons used in that war suddenly disappeared, and many of those intended for it never got to the Georgian Army in the first place. So if a large cargo plane, probably carrying weapons, is on the runway at Tbilisi Airport it is not carrying legal arms supplies. Nevertheless, such planes, and their escorts, do not land anywhere by accident, or ferry soldiers in and out of them, as airport staff have been watching them doing even when they are nothing to do with the ground crew.

Regional Airports and Supply Lines

Jeffrey Silverman, Bureau Chief for Veterans Today, wrote two years ago that representatives of the so-called Syrian opposition had been in Georgia before the parliamentary elections meeting with Georgian government representatives, most likely with the support of foreign intelligence services. He has supplied full tapes and transcripts of various illegal arms deals involving Georgia to the Georgian Prosecutor’s Office.

It is also significant that John Bass, the former US Ambassador to Georgia and previously Iraq, will be the next Ambassador to Turkey. These three countries are part of a well-established Northern Distribution Route, along which more military bases have been created, hospitals set up and logistics improved. This is being done to lay the groundwork for a possible war with Iran, the only one of the seven US targets identified by General Wesley Clark still standing. Bass has longstanding connections with Bechtel National and KBR and is an expert in logistics and covert operations, being a career professional who specialised in these questions.

ISIS was inserted into Iraq as the fighting force able to state this war and seize the means to pay for it, which the US is too scared to fight in person after its recent failures in Syria, Afghanistan and Iraq. Foreign troops and advisors have been involved with ISIS from the beginning, recruited in Train and Equip Program recipient countries such as Georgia and Turkey. Syria and Iraq are still being used as training grounds for this war, in time honoured Great Power fashion, serving the same purpose as Spain did in the 1930s and Vietnam until the 1970s.

Conclusion

After Chuck Hagel’s visit Georgian Defence Minister Irakli Alasania said that a “silent embargo” on Georgia appeared to have been lifted. “The Pentagon’s foreign military sales system is notoriously slow, but, under the right circumstances, it can move adroitly. It should move more quickly to fulfill Georgia’s orders,” he said. But if it had moved so quickly that a plane full of weapons arrived three days later we would know all about it, as this would be a coup for the present government.

The Antonov plane has had plenty of time to refuel, but is still at the airport at the time of writing. This indicates that Georgia is still a viable transport hub for illegal and legal weapons deliveries to terrorists, all depends on the paperwork, and that include transit via smaller regional airports as well.

Any time Georgia, or any other US ally, wants to make progress it must get further involved in these schemes to do so, as the defence relationships with these countries invariably intensify when economic agreements are signed. This is why stopping terrorism is not as simple as cutting off the arms supplies.

Countries would lose a thousand positive benefits if they tried to withdraw from such schemes. As long as the terrorists and freedom fighters are kept from the government ministers, they are prepared to maintain the lie that politics must always be dirty and no one can ever act honestly if they want to serve their country.

The US created ISIS, the Islamic State, and other nasty groups it now vilifies for one reason. Americans abroad have shown for generations that they can never understand why many people in countries they think they are helping don’t like the USA. The guardian of democracy has now discovered that terrorists are the only people whose language they can understand.

Henry Kamens, columnist, expert on Central Asia and Caucasus, exclusively for the online magazine “New Eastern Outlook”.

by Jim Hoft

Since July 2014, the Obama-backed Free Syrian Army, Al Nusra Front, and ISIS have paired together in order to fight the Syrian Assad regime.

According to one Free Syrian Army commander, the combining of forces with ISIS was needed in order to achieve “the greater good.”

Since around that time ISIS has traveled around the Caliphate in their brand new Toyota Hilux trucks.
Paid for by US taxpayers.

Now this…

The Obama Administration is paying “vetted” Syrian rebels monthly salaries.

Officials said the Obama administration has approved “tens of millions of dollars” to pay the salaries of police officers who joined the rebels.

The US is paying defected Syrian police officers $150 a month to fight with the rebels.

Thousands of “vetted” rebels are being paid a monthly salary by the US government.
The New York Times reported:

In a secret office near the Syrian border here, intelligence agents from the United States and its allies are laying the groundwork for what they hope will become an effective force of Syrian rebels to serve as ground troops in the international battle against the extremist Islamic State.

The office, the Military Operations Command, has slowed funding to Islamist groups, paid salaries to thousands of “vetted” rebels and given them ammunition to boost their battlefield mettle.

But even the program’s biggest beneficiaries — the rebels themselves — acknowledge that turning this relatively small group into a force that can challenge the well-funded and well-armed Islamic State is a challenge that will require tremendous support from its foreign backers.

In President Obama’s strategy of building an international coalition to fight the Islamic State without American troops, these moderate rebels loom large as the best force to fight the extremists in Syria. While the House approved an aid package for the rebels on Wednesday and the Senate followed on Thursday, at present the rebels are a beleaguered lot, far from becoming a force that can take on the fanatical and seasoned fighters of the Islamic State.

Copyright Jim Hoft Gateway Pundit 2014

Historians of the Constitutional Era of the United States (1789-2001, RIP) will recall the Fourth Amendment to the Constitution, the one that used to protect Americans against unreasonable and unwarranted searches.

The Supreme Court had generally held that searches required a warrant. That warrant could be issued only after law enforcement showed they had “probable cause.” That in turn had been defined by the Court to require a high standard of proof, “a fair probability that contraband or evidence of a crime will be found in a particular place.”

The basic idea for more or less over 200 years: unless the government has a good, legal reason to look into your business, it couldn’t. As communications changed, the Fourth evolved to assert extend those same rights of privacy to phone calls, emails and texts, the same rules applying there as to physical searches.

That was Then

It was a good run. The Bill of Rights was designed to protect the people from their government. If the First Amendment’s right to speak out publicly was the people’s wall of security, then the Fourth Amendment’s right to privacy was its buttress. It was once thought that the government should neither be able to stop citizens from speaking nor peer into their lives. Folks, as our president now refers to us, should not have to fear the Knock on the Door in either their homes or The Homeland writ large.

In Post-Constitutional America (2001-Present), the government has taken a bloody box cutter to the original copy of the Constitution and thrown the Fourth Amendment in the garbage. The NSA revelations of Edward Snowden are, in that sense, not just a shock to the conscience but to the concept of privacy itself: Our government spies on us. All of us. Without suspicion. Without warrants. Without probable cause. Without restraint.

The government also invades our privacy in multiple other ways, all built around end-runs of the Fourth Amendment, clever wordplay, legal hacks and simple twisting of words. Thus you get illegally obtained information recycled into material usable in court via what is called parallel construction. You have the creation of “Constitution Free” zones at the U.S. border. The Department of Justice created a Post-Constitutional interpretation of the Fourth Amendment that allows it to access millions of records of Americans using only subpoenas, not search warrants, to grab folks’ emails by searching one web server instead of millions of individual homes. Under a twist of an old “privacy law,” doctors disclose your medical records to the NSA without your permission or knowledge. SWAT raids by local police designed to break into African-American businesses on harassment expeditions are also now OK.

The Center of It All: Executive Order 12333

The most egregious example of such word-twisting and sleazy legal manipulations to morph illegal government spying under the Fourth Amendment into topsy-turvy quasi-legal spying is the use of Executive Order 12333, E.O. 12333, what the spooks call “twelve triple three.” The Order dates from 1981, signed by Ronald Reagan to buff up what his predecessors limited in response to overzealous law enforcement activities. The Gipper would be mighty proud that his perhaps most lasting accomplishment was legalizing surveillance of every American citizen.

Back to today. Despite all the secret FISA court decisions and as yet uncovered legal memos, most collection of U.S. domestic communications and data is done under E.O. 12333, section 2.3 paragraph C.

Specifically, the one sentence that the government believes allows them to bypass the Fourth Amendment says the intelligence community can “collect, retain, or disseminate information concerning United States persons” if that information is “obtained in the course of a lawful foreign intelligence, counterintelligence, international narcotics or international terrorism investigation.”

So, the work-around for the Fourth Amendment is as follows: NSA collects massive amounts of data on foreigners, often by hoovering up every fragment of electronic stuff flowing around the U.S. it can. So, while purportedly looking for a single terrorist email enroute to Yemen (“the needle”), the NSA collects every single email from Google, Yahoo and Microsoft (“the haystack.”) Thus, any American’s emails caught in that net are considered to have been collected “incidentally” to the goal of finding that one terrorist email. The NSA claims that the Executive Order thus makes its mass-scale violations of the Fourth Amendment legal.

Tom Drake, perhaps the best-known NSA whistleblower prior to Edward Snowden, put it in simpler terms: “12333 is now being used as the legal justification for everything.”

Oh and hey reformers: Executive Orders by one president stay in force until another president changes or negates them. We could have one at work today written by George Washington. What that also means is that Congress, should they regain consciousness, can’t change an E.O. Congress could in theory pass a law making the contents of an E.O. invalid, but that presumes someone in Congress knows the order exists and what it says. Many E.O.’s are classified and if they are not, such as 12333, the legal documents behind them and FISA interpretations of them, likely are.

Snowden Knew

Again, as a historical note, executive orders– basically dictates from the president– once did not trump the Constitution. However, in Post-Constitutional America, they do.

As for this realization we have come upon, E.O. 12333, well, we’re all behind the curve. Edward Snowden, while still at NSA, wrote a now-famous email to the spy agency’s legal advisor, asking specifically whether an Executive Order has more legal force than an actual law passed by Congress, or indeed the Constitutional itself. The NSA’s answer was a bit convoluted, but said in a pinch the Constitution wins (wink wink), even while acting as if the opposite is true.

As General Michael Hayden, then head of the NSA, said in a blistering blast of Newspeak, “I am convinced that we are lawful because what it is we’re doing is reasonable.”

Ask Obama This Question

So let’s make it simple: Journalists with access to the president, ask this question directly: Why is E.O. 12333 being used today, interpreted by the FISA court or any other means, stating that the NSA’s surveillance of U.S. citizens is “reasonable,” and thus no warrant is required for the surveillance to continue and remain constitutional under the Fourth Amendment?

Of course getting an answer out of Obama will not happen. After all, he is the Constitutional law professor who studied the document the same way a burglar learns about an alarm system. TO BREAK IT BETTER.

BONUS: The stuff above is real amateur-level writing on E.O. 12333. When you are ready to dig in deep, get over to Marcy Wheeler’s blog. She is the smartest person working in journalism today on the subject. My debt to her is hereby acknowledged.

Peter Van Buren writes about current events at his blog. His book, Ghosts of Tom Joad: A Story of the #99Percent, is available now from Amazon

Climate Science: Is it Currently Designed to Answer Questions?

September 22nd, 2014 by Prof. Richard S. Lindzen

Abstract

For a variety of inter-related cultural, organizational, and political reasons, progress in climate science and the actual solution of scientific problems in this field have moved at a much slower rate than would normally be possible.

Not all these factors are unique to climate science, but the heavy influence of politics has served to amplify the role of the other factors. By cultural factors, I primarily refer to the change in the scientific paradigm from a dialectic opposition between theory and observation to an emphasis on simulation and observational programs. The latter serves to almost eliminate the dialectical focus of the former.

Whereas the former had the potential for convergence, the latter is much less effective. The institutional factor has many components. One is the inordinate growth of administration in universities and the consequent increase in importance of grant overhead. This leads to an emphasis on large programs that never end. Another is the hierarchical nature of formal scientific organizations whereby a small executive council can speak on behalf of thousands of scientists as well as govern the distribution of ‘carrots and sticks’ whereby reputations are made and broken. The above factors are all amplified by the need for government funding.

When an issue becomes a vital part of a political agenda, as is the case with climate, then the politically desired position becomes a goal rather than a consequence of scientific research. This paper will deal with the origin of the cultural changes and with specific examples of the operation and interaction of these factors. In particular, we will show how political bodies act to control scientific institutions, how scientists adjust both data and even theory to accommodate politically correct positions, and how opposition to these positions is disposed of.

1. Introduction.

Although the focus of this paper is on climate science, some of the problems pertain to science more generally. Science has traditionally been held to involve the creative opposition of theory and observation wherein each tests the other in such a manner as to converge on a better understanding of the natural world. Success was rewarded by recognition, though the degree of recognition was weighted according to both the practical consequences of the success and the philosophical and aesthetic power of the success. As science undertook more ambitious problems, and the cost and scale of operations increased, the need for funds undoubtedly shifted emphasis to practical relevance though numerous examples from the past assured a strong base level of confidence in the utility of science. Moreover, the many success stories established ‘science’ as a source of authority and integrity. Thus, almost all modern movements claimed scientific foundations for their aims. Early on, this fostered a profound misuse of science, since science is primarily a successful mode of inquiry rather than a source of authority.

Until the post World War II period, little in the way of structure existed for the formal support of science by government (at least in the US which is where my own observations are most relevant). In the aftermath of the Second World War, the major contributions of science to the war effort (radar, the A-bomb), to health (penicillin), etc. were evident. Vannevar Bush (in his report, Science: The Endless Frontier, 1945) noted the many practical roles that validated the importance of science to the nation, and argued that the government need only adequately support basic science in order for further benefits to emerge. The scientific community felt this paradigm to be an entirely appropriate response by a grateful nation. The next 20 years witnessed truly impressive scientific productivity which firmly established the United States as the creative center of the scientific world.

The Bush paradigm seemed amply justified. (This period and its follow-up are also discussed by Miller, 2007, with special but not total emphasis on the NIH (National Institutes of Health).) However, something changed in the late 60’s. In a variety of fields it has been suggested that the rate of new discoveries and achievements slowed appreciably (despite increasing publications) [2], and it is being suggested that either the Bush paradigm ceased to be valid or that it may never have been valid in the first place. I believe that the former is correct. What then happened in the 1960’s to produce this change?

It is my impression that by the end of the 60’s scientists, themselves, came to feel that the real basis for support was not gratitude (and the associated trust that support would bring further benefit) but fear: fear of the Soviet Union, fear of cancer, etc. Many will conclude that this was merely an awakening of a naive scientific community to reality, and they may well be right. However, between the perceptions of gratitude and fear as the basis for support lies a world of difference in incentive structure. If one thinks the basis is gratitude, then one obviously will respond by contributions that will elicit more gratitude. The perpetuation of fear, on the other hand, militates against solving problems. This change in perception proceeded largely without comment. However, the end of the cold war, by eliminating a large part of the fear-base forced a reassessment of the situation. Most thinking has been devoted to the emphasis of other sources of fear: competitiveness, health, resource depletion and the environment.

What may have caused this change in perception is unclear, because so many separate but potentially relevant things occurred almost simultaneously. The space race reinstituted the model of large scale focused efforts such as the moon landing program. For another, the 60’s saw the first major postwar funding cuts for science in the US. The budgetary pressures of the Vietnam War may have demanded savings someplace, but the fact that science was regarded as, to some extent, dispensable, came as a shock to many scientists. So did the massive increase in management structures and bureaucracy which took control of science out of the hands of working scientists. All of this may be related to the demographic pressures resulting from the baby boomers entering the workforce and the post -sputnik emphasis on science. Sorting this out goes well beyond my present aim which is merely to consider the consequences of fear as a perceived basis of support.

Fear has several advantages over gratitude. Gratitude is intrinsically limited, if only by the finite creative capacity of the scientific community. Moreover, as pointed out by a colleague at MIT, appealing to people’s gratitude and trust is usually less effective than pulling a gun. In other words, fear can motivate greater generosity. Sputnik provided a notable example in this regard; though it did not immediately alter the perceptions of most scientists, it did lead to a great increase in the number of scientists, which contributed to the previously mentioned demographic pressure. Science since the sixties has been characterized by the large programs that this generosity encourages.

Moreover, the fact that fear provides little incentive for scientists to do anything more than perpetuate problems, significantly reduces the dependence of the scientific enterprise on unique skills and talents. The combination of increased scale and diminished emphasis on unique talent is, from a certain point of view, a devastating combination which greatly increases the potential for the political direction of science, and the creation of dependent constituencies. With these new constituencies, such obvious controls as peer review and detailed accountability, begin to fail and even serve to perpetuate the defects of the system. Miller (2007) specifically addresses how the system especially favors dogmatism and conformity.

The creation of the government bureaucracy, and the increasing body of regulations accompanying government funding, called, in turn, for a massive increase in the administrative staff at universities and research centers. The support for this staff comes from the overhead on government grants, and, in turn, produces an active pressure for the solicitation of more and larger grants [3].

One result of the above appears to have been the deemphasis of theory because of its intrinsic difficulty and small scale, the encouragement of simulation instead (with its call for large capital investment in computation), and the encouragement of large programs unconstrained by specific goals [4]. In brief, we have the new paradigm where simulation and programs have replaced theory and observation, where government largely determines the nature of scientific activity, and where the primary role of professional societies is the lobbying of the government for special advantage.

This new paradigm for science and its dependence on fear based support may not constitute corruption per se, but it does serve to make the system particularly vulnerable to corruption. Much of the remainder of this paper will illustrate the exploitation of this vulnerability in the area of climate research. The situation is particularly acute for a small weak field like climatology. As a field, it has traditionally been a subfield within such disciplines as meteorology, oceanography, geography, geochemistry, etc. These fields, themselves are small and immature. At the same time, these fields can be trivially associated with natural disasters. Finally, climate science has been targeted by a major political movement, environmentalism, as the focus of their efforts, wherein the natural disasters of the earth system, have come to be identified with man’s activities – engendering fear as well as an agenda for societal reform and control. The remainder of this paper will briefly describe how this has been playing out with respect to the climate issue.

2. Conscious Efforts to Politicize Climate Science

The above described changes in scientific culture were both the cause and effect of the growth of ‘big science,’ and the concomitant rise in importance of large organizations. However, all such organizations, whether professional societies, research laboratories, advisory bodies (such as the national academies), government departments and agencies (including NASA, NOAA, EPA, NSF, etc.), and even universities are hierarchical structures where positions and policies are determined by small executive councils or even single individuals. This greatly facilitates any conscious effort to politicize science via influence in such bodies where a handful of individuals (often not even scientists) speak on behalf of organizations that include thousands of scientists, and even enforce specific scientific positions and agendas. The temptation to politicize science is overwhelming and longstanding. Public trust in science has always been high, and political organizations have long sought to improve their own credibility by associating their goals with ‘science’ – even if this involves misrepresenting the science.

Professional societies represent a somewhat special case. Originally created to provide a means for communication within professions – organizing meetings and publishing journals – they also provided, in some instances, professional certification, and public outreach. The central offices of such societies were scattered throughout the US, and rarely located in Washington. Increasingly, however, such societies require impressive presences in Washington where they engage in interactions with the federal government. Of course, the nominal interaction involves lobbying for special advantage, but increasingly, the interaction consists in issuing policy and scientific statements on behalf of the society. Such statements, however, hardly represent independent representation of membership positions. For example, the primary spokesman for the American Meteorological Society in Washington is Anthony Socci who is neither an elected official of the AMS nor a contributor to climate science. Rather, he is a former staffer for Al Gore.

Returning to the matter of scientific organizations, we find a variety of patterns of influence. The most obvious to recognize (though frequently kept from public view), consists in prominent individuals within the environmental movement simultaneously holding and using influential positions within the scientific organization. Thus, John Firor long served as administrative director of the National Center for Atmospheric Research in Boulder, Colorado. This position was purely administrative, and Firor did not claim any scientific credentials in the atmospheric sciences at the time I was on the staff of NCAR. However, I noticed that beginning in the 1980′s, Firor was frequently speaking on the dangers of global warming as an expert from NCAR. When Firor died last November, his obituary noted that he had also been Board Chairman at Environmental Defense– a major environmental advocacy group – from 1975-1980 [5].

The UK Meteorological Office also has a board, and its chairman, Robert Napier, was previously the Chief Executive for World Wildlife Fund – UK. Bill Hare, a lawyer and Campaign Director for Greenpeace, frequently speaks as a ‘scientist’ representing the Potsdam Institute, Germany’s main global warming research center. John Holdren, who currently directs the Woods Hole Research Center (an environmental advocacy center not to be confused with the far better known Woods Hole Oceanographic Institution, a research center), is also a professor in Harvard’s Kennedy School of Government, and has served as president of the American Association for the Advancement of Science among numerous other positions including serving on the board of the MacArthur Foundation from 1991 until 2005. He was also a Clinton-Gore Administration spokesman on global warming.

The making of academic appointments to global warming alarmists is hardly a unique occurrence. The case of Michael Oppenheimer is noteworthy in this regard. With few contributions to climate science (his postdoctoral research was in astro-chemistry), and none to the physics of climate, Oppenheimer became the Barbara Streisand Scientist at Environmental Defense [6]. He was subsequently appointed to a professorship at Princeton University, and is now, regularly, referred to as a prominent climate scientist by Oprah (a popular television hostess), NPR (National Public Radio), etc. To be sure, Oppenheimer did coauthor an early absurdly alarmist volume (Oppenheimer and Robert Boyle, 1990: Dead Heat, The Race Against the Greenhouse Effect), and he has served as a lead author with the IPCC (Intergovernmental Panel on Climate Change) [7].

One could go on at some length with such examples, but a more common form of infiltration consists in simply getting a couple of seats on the council of an organization (or on the advisory panels of government agencies). This is sufficient to veto any statements or decisions that they are opposed to. Eventually, this enables the production of statements supporting their position – if only as a quid pro quo for permitting other business to get done. Sometimes, as in the production of the 1993 report of the NAS, Policy Implications of Global Warming, the environmental activists, having largely gotten their way in the preparation of the report where they were strongly represented as ‘stake holders,’ decided, nonetheless, to issue a minority statement suggesting that the NAS report had not gone ‘far enough.’ The influence of the environmental movement has effectively made support for global warming, not only a core element of political correctness, but also a requirement for the numerous prizes and awards given to scientists. That said, when it comes to professional societies, there is often no need at all for overt infiltration since issues like global warming have become a part of both political correctness and (in the US) partisan politics, and there will usually be council members who are committed in this manner.

The situation with America’s National Academy of Science is somewhat more complicated. The Academy is divided into many disciplinary sections whose primary task is the nomination of candidates for membership in the Academy [8]. Typically, support by more than 85% of the membership of any section is needed for nomination. However, once a candidate is elected, the candidate is free to affiliate with any section. The vetting procedure is generally rigorous, but for over 20 years, there was a Temporary Nominating Group for the Global Environment to provide a back door for the election of candidates who were environmental activists, bypassing the conventional vetting procedure. Members, so elected, proceeded to join existing sections where they hold a veto power over the election of any scientists unsympathetic to their position. Moreover, they are almost immediately appointed to positions on the executive council, and other influential bodies within the Academy. One of the members elected via the Temporary Nominating Group, Ralph Cicerone, is now president of the National Academy. Prior to that, he was on the nominating committee for the presidency. It should be added that there is generally only a single candidate for president. Others elected to the NAS via this route include Paul Ehrlich, James Hansen, Steven Schneider, John Holdren and Susan Solomon.

It is, of course, possible to corrupt science without specifically corrupting institutions. For example, the environmental movement often cloaks its propaganda in scientific garb without the aid of any existing scientific body. One technique is simply to give a name to an environmental advocacy group that will suggest to the public, that the group is a scientific rather than an environmental group. Two obvious examples are the Union of Concerned Scientists and the Woods Hole Research Center [9,10]. The former conducted an intensive advertising campaign about ten years ago in which they urged people to look to them for authoritative information on global warming.

This campaign did not get very far – if only because the Union of Concerned Scientists had little or no scientific expertise in climate. A possibly more effective attempt along these lines occurred in the wake of Michael Crichton’s best selling adventure, State of Fear, which pointed out the questionable nature of the global warming issue, as well as the dangers to society arising from the exploitation of this issue. Environmental Media Services (a project of Fenton Communications, a large public relations firm serving left wing and environmental causes; they are responsible for the alar scare as well as Cindy Sheehan’s anti-war campaign.) created a website, realclimate.org, as an ‘authoritative’ source for the ‘truth’ about climate. This time, real scientists who were also environmental activists, were recruited to organize this web site and ‘discredit’ any science or scientist that questioned catastrophic anthropogenic global warming.

The web site serves primarily as a support group for believers in catastrophe, constantly reassuring them that there is no reason to reduce their worrying. Of course, even the above represent potentially unnecessary complexity compared to the longstanding technique of simply publicly claiming that all scientists agree with whatever catastrophe is being promoted. Newsweek already made such a claim in 1988. Such a claim serves at least two purposes. First, the bulk of the educated public is unable to follow scientific arguments; ‘knowing’ that all scientists agree relieves them of any need to do so. Second, such a claim serves as a warning to scientists that the topic at issue is a bit of a minefield that they would do well to avoid.

The myth of scientific consensus is also perpetuated in the web’s Wikipedia where climate articles are vetted by William Connolley, who regularly runs for office in England as a Green Party candidate. No deviation from the politically correct line is permitted.

Perhaps the most impressive exploitation of climate science for political purposes has been the creation of the Intergovernmental Panel on Climate Change (IPCC) by two UN agencies, UNEP (United Nations Environmental Program) and WMO (World Meteorological Organization), and the agreement of all major countries at the 1992 Rio Conference to accept the IPCC as authoritative. Formally, the IPCC summarizes the peer reviewed literature on climate every five years. On the face of it, this is an innocent and straightforward task. One might reasonably wonder why it takes 100′s of scientists five years of constant travelling throughout the world in order to perform this task. The charge to the IPCC is not simply to summarize, but rather to provide the science with which to support the negotiating process whose aim is to control greenhouse gas levels. This is a political rather than a scientific charge. That said, the participating scientists have some leeway in which to reasonably describe matters, since the primary document that the public associates with the IPCC is not the extensive report prepared by the scientists, but rather the Summary for Policymakers which is written by an assemblage of representative from governments and NGO’s, with only a small scientific representation [11, 12].

3. Science in the service of politics

Given the above, it would not be surprising if working scientists would make special efforts to support the global warming hypothesis. There is ample evidence that this is happening on a large scale. A few examples will illustrate this situation. Data that challenges the hypothesis are simply changed. In some instances, data that was thought to support the hypothesis is found not to, and is then changed. The changes are sometimes quite blatant, but more often are somewhat more subtle. The crucial point is that geophysical data is almost always at least somewhat uncertain, and methodological errors are constantly being discovered. Bias can be introduced by simply considering only those errors that change answers in the desired direction. The desired direction in the case of climate is to bring the data into agreement with models, even though the models have displayed minimal skill in explaining or predicting climate. Model projections, it should be recalled, are the basis for our greenhouse concerns. That corrections to climate data should be called for, is not at all surprising, but that such corrections should always be in the ‘needed’ direction is exceedingly unlikely. Although the situation suggests overt dishonesty, it is entirely possible, in today’s scientific environment, that many scientists feel that it is the role of science to vindicate the greenhouse paradigm for climate change as well as the credibility of models. Comparisons of models with data are, for example, referred to as model validation studies rather than model tests.

The first two examples involve paleoclimate simulations and reconstructions. Here, the purpose has been to show that both the models and the greenhouse paradigm can explain past climate regimes, thus lending confidence to the use of both to anticipate future changes. In both cases (the Eocene about 50 million years ago, and the Last Glacial Maximum about 18 thousand years ago), the original data were in conflict with the greenhouse paradigm as implemented in current models, and in both cases, lengthy efforts were made to bring the data into agreement with the models.

In the first example, the original data analysis for the Eocene (Shackleton and Boersma, 1981) showed the polar regions to have been so much warmer than the present that a type of alligator existed on Spitzbergen as did florae and fauna in Minnesota that could not have survived frosts. At the same time, however, equatorial temperatures were found to be about 4K colder than at present. The first attempts to simulate the Eocene (Barron, 1987) assumed that the warming would be due to high levels of CO2, and using a climate GCM (General Circulation Model), he obtained relatively uniform warming at all latitudes, with the meridional gradients remaining much as they are today. This behavior continues to be the case with current GCMs (Huber, 2008). As a result, paleoclimatologists have devoted much effort to ‘correcting’ their data, but, until very recently, they were unable to bring temperatures at the equator higher than today’s (Schrag, 1999, Pearson et al, 2000). However, the latest paper (Huber, 2008) suggests that the equatorial data no longer constrains equatorial temperatures at all, and any values may have existed. All of this is quite remarkable since there is now evidence that current meridional distributions of temperature depend critically on the presence of ice, and that the model behavior results from improper tuning wherein present distributions remain even when ice is absent.

The second example begins with the results of a major attempt to observationally reconstruct the global climate of the last glacial maximum (CLIMAP, 1976). Here it was found that although extratropical temperatures were much colder, equatorial temperatures were little different from today’s. There were immediate attempts to simulate this climate with GCMs and reduced levels of CO2. Once again the result was lower temperatures at all latitudes (Bush and Philander, 1998a,b), and once again, numerous efforts were made to ‘correct’ the data. After much argument, the current position appears to be that tropical temperatures may have been a couple of degrees cooler than today’s. However, papers appeared claiming far lower temperatures (Crowley, 2000). We will deal further with this issue in the next section where we describe papers that show that the climate associated with ice ages is well described by the Milankovich Hypothesis that does not call for any role for CO2.

Both of the above examples probably involved legitimate corrections, but only corrections that sought to bring observations into agreement with models were initially considered, thus avoiding the creative conflict between theory and data that has characterized the past successes of science. To be sure, however, the case of the Last Glacial Maximum shows that climate science still retains a capacity for self-correction.

The next example has achieved a much higher degree of notoriety than the previous two. In the first IPCC assessment (IPCC, 1990), the traditional picture of the climate of the past 1100 years was presented. In this picture, there was a medieval warm period that was somewhat warmer than the present as well as the little ice age that was cooler. The presence of a period warmer than the present in the absence of any anthropogenic greenhouse gases was deemed an embarrassment for those holding that present warming could only be accounted for by the activities of man. Not surprisingly, efforts were made to get rid of the medieval warm period (According to Demming, 2005, Jonathan Overpeck, in an email, remarked that one had to get rid of the medieval warm period. Overpeck is one of organizers in Appendix 1.).

The most infamous effort was that due to Mann et al (1998, 1999 [13]) which used primarily a few handfuls of tree ring records to obtain a reconstruction of Northern Hemisphere temperature going back eventually a thousand years that no longer showed a medieval warm period. Indeed, it showed a slight cooling for almost a thousand years culminating in a sharp warming beginning in the nineteenth century. The curve came to be known as the hockey stick, and featured prominently in the next IPCC report, where it was then suggested that the present warming was unprecedented in the past 1000 years. The study immediately encountered severe questions concerning both the proxy data and its statistical analysis (interestingly, the most penetrating critiques came from outside the field: McIntyre and McKitrick, 2003, 2005a,b). This led to two independent assessments of the hockey stick (Wegman,2006, North, 2006), both of which found the statistics inadequate for the claims. The story is given in detail in Holland (2007).

Since the existence of a medieval warm period is amply documented in historical accounts for the North Atlantic region (Soon et al, 2003), Mann et al countered that the warming had to be regional but not characteristic of the whole northern hemisphere. Given that an underlying assumption of their analysis was that the geographic pattern of warming had to have remained constant, this would have invalidated the analysis ab initio without reference to the specifics of the statistics. Indeed, the 4th IPCC (IPCC, 2007) assessment no longer featured the hockey stick, but the claim that current warming is unprecedented remains, and Mann et al’s reconstruction is still shown in Chapter 6 of the 4th IPCC assessment, buried among other reconstructions. Here too, we will return to this matter briefly in the next section.

The fourth example is perhaps the strangest. For many years, the global mean temperature record showed cooling from about 1940 until the early 70′s. This, in fact, led to the concern for global cooling during the 1970′s. The IPCC regularly, through the 4th assessment, boasted of the ability of models to simulate this cooling (while failing to emphasize that each model required a different specification of completely undetermined aerosol cooling in order to achieve this simulation (Kiehl, 2007)). Improvements in our understanding of aerosols are increasingly making such arbitrary tuning somewhat embarrassing, and, no longer surprisingly, the data has been ‘corrected’ to get rid of the mid 20th century cooling (Thompson et al, 2008). This may, in fact, be a legitimate correction (http://www.climateaudit.org/?p=3114). The embarrassment may lie in the continuous claims of modelers to have simulated the allegedly incorrect data.

The fifth example deals with the fingerprint of warming. It has long been noted that greenhouse warming is primarily centered in the upper troposphere (Lindzen, 1999) and, indeed, model’s show that the maximum rate of warming is found in the upper tropical troposphere (Lee, et al, 2007). Lindzen (2007) noted that temperature data from both satellites and balloons failed to show such a maximum. This, in turn, permitted one to bound the greenhouse contribution to surface warming, and led to an estimate of climate sensitivity that was appreciably less than found in current models. Once the implications of the observations were clearly identified, it was only a matter of time before the data were ‘corrected.’ The first attempt came quickly (Vinnikov et al, 2006) wherein the satellite data was reworked to show large warming in the upper troposphere, but the methodology was too blatant for the paper to be commonly cited [14]. There followed an attempt wherein the temperature data was rejected, and where temperature trends were inferred from wind data (Allen and Sherwood, 2008).

Over sufficiently long periods, there is a balance between vertical wind shear and meridional temperature gradients (the thermal wind balance), and, with various assumptions concerning boundary conditions, one can, indeed, infer temperature trends, but the process involves a more complex, indirect, and uncertain procedure than is involved in directly measuring temperature. Moreover, as Pielke et al (2008) have noted, the results display a variety of inconsistencies. They are nonetheless held to resolve the discrepancy with models. More recently, Solomon et al (2009) have claimed further “corrections” to the data

The sixth example takes us into astrophysics. Since the 1970′s, considerable attention has been given to something known as the Early Faint Sun Paradox. This paradox was first publicized by Sagan and Mullen (1972). They noted that the standard model for the sun robustly required that the sun brighten with time so that 2-3 billion years ago, it was about 30% dimmer than it is today (recall that a doubling of CO2 corresponds to only a 2% change in the radiative budget). One would have expected that the earth would have been frozen over, but the geological evidence suggested that the ocean was unfrozen. Attempts were made to account for this by an enhanced greenhouse effect. Sagan and Mullen (1972) suggested an ammonia rich atmosphere might work. Others suggested an atmosphere with as much as several bars of CO2 (recall that currently CO2 is about 380 parts per million of a 1 bar atmosphere).

Finally, Kasting and colleagues tried to resolve the paradox with large amounts of methane. For a variety of reasons, all these efforts were deemed inadequate [15] (Haqqmisra et al, 2008). There followed a remarkable attempt to get rid of the standard model of the sun (Sackman and Boothroyd, 2003). This is not exactly the same as altering the data, but the spirit is the same. The paper claimed to have gotten rid of the paradox. However, in fact, the altered model still calls for substantial brightening, and, moreover, does not seem to have gotten much acceptance among solar modelers.

My last specific example involves the social sciences. Given that it has been maintained since at least 1988 that all scientists agree about alarming global warming, it is embarrassing to have scientists objecting to the alarm. To ‘settle’ the matter, a certain Naomi Oreskes published a paper in Science (Oreskes, 2004) purporting to have surveyed the literature and not have found a single paper questioning the alarm (Al Gore offers this study as proof of his own correctness in “Inconvenient Truth.”). Both Benny Peiser (a British sociologist) and Dennis Bray (an historian of science) noted obvious methodological errors, but Science refused to publish these rebuttals with no regard for the technical merits of the criticisms presented [16]. Moreover, Oreskes was a featured speaker at the celebration of Spencer Weart’s thirty years as head of the American Institute of Physics’ Center for History of Physics. Weart, himself, had written a history of the global warming issue (Weart, 2003) where he repeated, without checking, the slander taken from a screed by Ross Gelbspan (The Heat is On) in which I was accused of being a tool of the fossil fuel industry. Weart also writes with glowing approval of Gore’s Inconvenient Truth. As far as Oreskes’ claim goes, it is clearly absurd [17]. A more carefully done study revealed a very different picture (Schulte, 2007)

The above examples do not include the most convenient means whereby nominal scientists can support global warming alarm: namely, the matter of impacts. Here, scientists who generally have no knowledge of climate physics at all, are supported to assume the worst projections of global warming and imaginatively suggest the implications of such warming for whatever field they happen to be working in. This has led to the bizarre claims that global warming will contribute to kidney stones, obesity, cockroaches, noxious weeds, sexual imbalance in fish, etc. The scientists who participate in such exercises quite naturally are supportive of the catastrophic global warming hypothesis despite their ignorance of the underlying science [18].

4. Pressures to inhibit inquiry and problem solving

It is often argued that in science the truth must eventually emerge. This may well be true, but, so far, attempts to deal with the science of climate change objectively have been largely forced to conceal such truths as may call into question global warming alarmism (even if only implicitly). The usual vehicle is peer review, and the changes imposed were often made in order to get a given paper published. Publication is, of course, essential for funding, promotion, etc. The following examples are but a few from cases that I am personally familiar with. These, almost certainly, barely scratch the surface. What is generally involved, is simply the inclusion of an irrelevant comment supporting global warming accepted wisdom. When the substance of the paper is described, it is generally claimed that the added comment represents the ‘true’ intent of the paper. In addition to the following examples, Appendix 2 offers excellent examples of ‘spin control.’.

As mentioned in the previous section, one of the reports assessing the Mann et al Hockey Stick was prepared by a committee of the US National Research Counsel (a branch of the National Academy) chaired by Gerald North (North, 2006). The report concluded that the analysis used was totally unreliable for periods longer ago than about 400 years. In point of fact, the only basis for the 400 year choice was that this brought one to the midst of the Little Ice Age, and there is essentially nothing surprising about a conclusion that we are now warmer. Still, without any basis at all, the report also concluded that despite the inadequacy of the Mann et al analysis, the conclusion might still be correct. It was this baseless conjecture that received most of the publicity surrounding the report.

In a recent paper, Roe (2006) showed that the orbital variations in high latitude summer insolation correlate excellently with changes in glaciation – once one relates the insolation properly to the rate of change of glaciation rather than to the glaciation itself. This provided excellent support for the Milankovich hypothesis. Nothing in the brief paper suggested the need for any other mechanism. Nonetheless, Roe apparently felt compelled to include an irrelevant caveat stating that the paper had no intention of ruling out a role for CO2.

Choi and Ho (2006, 2008) published interesting papers on the optical properties of high tropical cirrus that largely confirmed earlier results by Lindzen, Chou and Hou (2001) on an important negative feedback (the iris effect – something that we will describe later in this section) that would greatly reduce the sensitivity of climate to increasing greenhouse gases. A proper comparison required that the results be normalized by a measure of total convective activity, and, indeed, such a comparison was made in the original version of Choi and Ho’s paper. However, reviewers insisted that the normalization be removed from the final version of the paper which left the relationship to the earlier paper unclear.

Horvath and Soden (2008) found observational confirmation of many aspects of the iris effect, but accompanied these results with a repetition of criticisms of the iris effect that were irrelevant and even contradictory to their own paper. The point, apparently, was to suggest that despite their findings, there might be other reasons to discard the iris effect. Later in this section, I will return to these criticisms. However, the situation is far from unique. I have received preprints of papers wherein support for the iris was found, but where this was omitted in the published version of the papers

In another example, I had originally submitted a paper mentioned in the previous section (Lindzen, 2007) to American Scientist, the periodical of the scientific honorary society in the US, Sigma Xi, at the recommendation of a former officer of that society. There followed a year of discussions, with an editor, David Schneider, insisting that I find a coauthor who would illustrate why my paper was wrong. He argued that publishing something that contradicted the IPCC was equivalent to publishing a paper that claimed that ‘Einstein’s general theory of relativity is bunk.’ I suggested that it would be more appropriate for American Scientist to solicit a separate paper taking a view opposed to mine. This was unacceptable to Schneider, so I ended up publishing the paper elsewhere. Needless to add, Schneider has no background in climate physics. At the same time, a committee consisting almost entirely in environmental activists led by Peter Raven, the ubiquitous John Holdren, Richard Moss, Michael MacCracken, and Rosina Bierbaum were issuing a joint Sigma Xi – United Nations Foundation (the latter headed by former Senator and former Undersecretary of State Tim Wirth [19] and founded by Ted Turner) report endorsing global warming alarm, to a degree going far beyond the latest IPCC report. I should add that simple disagreement with conclusions of the IPCC has become a common basis for rejecting papers for publication in professional journals – as long as the disagreement suggests reduced alarm. An example will be presented later in this section.

Despite all the posturing about global warming, more and more people are becoming aware of the fact that global mean temperatures have not increased statistically significantly since 1995. One need only look at the temperature records posted on the web by the Hadley Centre. The way this is acknowledged in the literature forms a good example of the spin that is currently required to maintain global warming alarm. Recall that the major claim of the IPCC 4th Assessment was that there was a 90% certainty that most of the warming of the preceding 50 years was due to man (whatever that might mean). This required the assumption that what is known as natural internal variability (ie, the variability that exists without any external forcing and represents the fact that the climate system is never in equilibrium) is adequately handled by the existing climate models.

The absence of any net global warming over the last dozen years or so, suggests that this assumption may be wrong. Smith et al (2007) (Smith is with the Hadley Centre in the UK) acknowledged this by pointing out that initial conditions had to reflect the disequilibrium at some starting date, and when these conditions were ‘correctly’ chosen, it was possible to better replicate the period without warming. This acknowledgment of error was accompanied by the totally unjustified assertion that global warming would resume with a vengeance in 2009 [20]. As 2009 approaches and the vengeful warming seems less likely to occur, a new paper came out (this time from the Max Planck Institute: Keenlyside et al, 2008) moving the date for anticipated resumption of warming to 2015. It is indeed a remarkable step backwards for science to consider models that have failed to predict the observed behavior of the climate to nonetheless have the same validity as the data [21].

Tim Palmer, a prominent atmospheric scientist at the European Centre for Medium Range Weather Forecasting, is quoted by Fred Pearce (Pearce, 2008) in the New Scientist as follows: “Politicians seem to think that the science is a done deal,” says Tim Palmer. “I don’t want to undermine the IPCC, but the forecasts, especially for regional climate change, are immensely uncertain.” Pearce, however, continues “Palmer .. does not doubt that the Intergovernmental Panel on Climate Change (IPCC) has done a good job alerting the world to the problem of global climate change. But he and his fellow climate scientists are acutely aware that the IPCC’s predictions of how the global change will affect local climates are little more than guesswork. They fear that if the IPCC’s predictions turn out to be wrong, it will provoke a crisis in confidence that undermines the whole climate change debate. On top of this, some climate scientists believe that even the IPCC’s global forecasts leave much to be desired. …” Normally, one would think that undermining the credibility of something that is wrong is appropriate.

Even in the present unhealthy state of science, papers that are overtly contradictory to the catastrophic warming scenario do get published (though not without generally being substantially watered down during the review process). They are then often subject to the remarkable process of ‘discreditation.’ This process consists in immediately soliciting attack papers that are published quickly as independent articles rather than comments. The importance of this procedure is as follows. Normally such criticisms are published as comments, and the original authors are able to respond immediately following the comment. Both the comment and reply are published together. By publishing the criticism as an article, the reply is published as a correspondence, which is usually delayed by several months, and the critics are permitted an immediate reply. As a rule, the reply of the original authors is ignored in subsequent references.

In 2001, I published a paper (Lindzen, Chou and Hou) that used geostationary satellite data to suggest the existence of a strong negative feedback that we referred to as the Iris Effect. The gist of the feedback is that upper level stratiform clouds in the tropics arise by detrainment from cumulonimbus towers, that the radiative impact of the stratiform clouds is primarily in the infrared where they serve as powerful greenhouse components, and that the extent of the detrainment decreases markedly with increased surface temperature. The negative feedback resulted from the fact that the greenhouse warming due to the stratiform clouds diminished as the surface temperature increased, and increased as the surface temperature decreased – thus resisting the changes in surface temperature. The impact of the observed effect was sufficient to greatly reduce the model sensitivities to increasing CO2, and it was, moreover, shown that models failed to display the observed cloud behavior. The paper received an unusually intense review from four reviewers.

Once the paper appeared, the peer review editor of the Bulletin of the American Meteorological Society, Irwin Abrams, was replaced by a new editor, Jeffrey Rosenfeld (holding the newly created position of Editor in Chief), and the new editor almost immediately accepted a paper criticizing our paper (Hartmann and Michelsen, 2002), publishing it as a separate paper rather than a response to our paper (which would have been the usual and appropriate procedure). In the usual procedure, the original authors are permitted to respond in the same issue. In the present case, the response was delayed by several months. Moreover, the new editor chose to label the criticism as follows: “Careful analysis of data reveals no shrinkage of tropical cloud anvil area with increasing SST.”

In fact, this criticism was easily dismissed. The claim of Hartmann and Michelsen was that the effect we observed was due to the intrusion of midlatitude non- convective clouds into the tropics. If this were true, then the effect should have diminished as one restricted observations more closely to the equator, but as we showed (Lindzen, Chou and Hou, 2002), exactly the opposite was found. There were also separately published papers (again violating normal protocols allowing for immediate response) by Lin et al, 2002 and Fu, Baker and Hartmann, 2002, that criticized our paper by claiming that since the instruments on the geostationary satellite could not see the thin stratiform clouds that formed the tails of the clouds we could see, that we were not entitled to assume that the tails existed. Without the tails, the radiative impact of the clouds would be primarily in the visible where the behavior we observed would lead to a positive feedback; with the tails the effect is a negative feedback. The tails had long been observed, and the notion that they abruptly disappeared when not observed by an insufficiently sensitive sensor was absurd on the face of it, and the use of better instruments by Choi and Ho (2006, 2008) confirmed the robustness of the tails and the strong dominance of the infrared impact. However, as we have already seen, virtually any mention of the iris effect tends to be accompanied with a reference to the criticisms, a claim that the theory is ‘discredited,’ and absolutely no mention of the responses. This is even required of papers that are actually supporting the iris effect.

Vincent Courtillot et al (2007) encountered a similar problem. (Courtillot, it should be noted, is the director of the Institute for the Study of the Globe at the University of Paris.) They found that time series for magnetic field variations appeared to correlate well with temperature measurements – suggesting a possible non-anthropogenic source of forcing. This was immediately criticized by Bard and Delaygue (2008), and Courtillot et al were given the conventional right to reply which they did in a reasonably convincing manner. What followed, however, was highly unusual. Raymond Pierrehumbert (a professor of meteorology at the University of Chicago and a fanatical environmentalist) posted a blog supporting Bard and Delaygue, accusing Courtillot et al of fraud, and worse. Alan Robock (a coauthor of Vinnikov et al mentioned in the preceding section) perpetuated the slander in a letter circulated to all officers of the American Geophysical Union. The matter was then taken up (in December of 2007) by major French newspapers (LeMonde, Liberation, and Le Figaro) that treated Pierrehumbert’s defamation as fact. As in the previous case, all references to the work of Courtillot et al refer to it as ‘discredited’ and no mention is made of their response. Moreover, a major argument against the position of Courtillot et al is that it contradicted the claim of the IPCC.

In 2005, I was invited by Erneso Zedillo to give a paper at a symposium he was organizing at his Center for Sustainability Studies at Yale. The stated topic of the symposium was Global Warming Policy After 2012, and the proceedings were to appear in a book to by entitled Global Warming: Looking Beyond Kyoto. Only two papers dealing with global warming science were presented: mine and one by Stefan Rahmstorf of the Potsdam Institute. The remaining papers all essentially assumed an alarming scenario and proceeded to discuss economics, impacts, and policy. Rahmstorf and I took opposing positions, but there was no exchange at the meeting, and Rahmstorf had to run off to another meeting. As agreed, I submitted the manuscript of my talk, but publication was interminably delayed, perhaps because of the presence of my paper. In any event, the Brookings Institute (a centrist Democratic Party think tank) agreed to publish the volume. When the volume finally appeared (Zedillo, 2008), I was somewhat shocked to see that Rahmstorf’s paper had been modified from what he presented, and had been turned into an attack not only on my paper but on me personally [22]. I had received no warning of this; nor was I given any opportunity to reply. Inquiries to the editor and the publisher went unanswered. Moreover, the Rahmstorf paper was moved so that it immediately followed my paper. The reader is welcome to get a copy of the exchange, including my response, on my web site (Lindzen-Rahmstorf Exchange, 2008), and judge the exchange for himself.

One of the more bizarre tools of global warming revisionism is the posthumous alteration of skeptical positions.

Thus, the recent deaths of two active and professionally prominent skeptics, Robert Jastrow (the founding director of NASA’s Goddard Institute for Space Studies, now headed by James Hansen), and Reid Bryson (a well known climatologist at the University of Wisconsin) were accompanied by obituaries suggesting deathbed conversions to global warming alarm.

The death of another active and prominent skeptic, William Nierenberg (former director of the Scripps Oceanographic Institute), led to the creation of a Nierenberg Prize that is annually awarded to an environmental activist. The most recent recipient was James Hansen who Nierenberg detested.

Perhaps the most extraordinary example of this phenomenon involves a paper by Singer, Starr, and Revelle (1991). In this paper, it was concluded that we knew too little about climate to implement any drastic measures. Revelle, it may be recalled, was the professor that Gore credits with introducing him to the horrors of CO2 induced warming. There followed an intense effort led by a research associate at Harvard, Justin Lancaster, in coordination with Gore staffers, to have Revelle’s name posthumously removed from the published paper. It was claimed that Singer had pressured an old and incompetent man to allow his name to be used. To be sure, everyone who knew Revelle, felt that he had been alert until his death. There followed a law suit by Singer, where the court found in Singer’s favor. The matter is described in detail in Singer (2003).

Occasionally, prominent individual scientists do publicly express skepticism. The means for silencing them are fairly straightforward.

Will Happer, director of research at the Department of Energy (and a professor of physics at Princeton University) was simply fired from his government position after expressing doubts about environmental issues in general. His case is described in Happer (2003).

Michael Griffin, NASA’s administrator, publicly expressed reservations concerning global warming alarm in 2007. This was followed by a barrage of ad hominem attacks from individuals including James Hansen and Michael Oppenheimer. Griffin has since stopped making any public statements on this matter.

Freeman Dyson, an acknowledged great in theoretical physics, managed to publish a piece in New York Review of Books (Dyson, 2008), where in the course of reviewing books by Nordhaus and Zedillo (the latter having been referred to earlier), he expressed cautious support for the existence of substantial doubt concerning global warming. This was followed by a series of angry letters as well as condemnation on the realclimate.org web site including ad hominem attacks. Given that Dyson is retired, however, there seems little more that global warming enthusiasts can do. However, we may hear of a deathbed conversion in the future.

5. Dangers for science and society

This paper has attempted to show how changes in the structure of scientific activity over the past half century have led to extreme vulnerability to political manipulation. In the case of climate change, these vulnerabilities have been exploited to a remarkable extent. The dangers that the above situation poses for both science and society are too numerous to be discussed in any sort of adequate way in this paper. It should be stressed that the climate change issue, itself, constitutes a major example of the dangers intrinsic to the structural changes in science.

As concerns the specific dangers pertaining to the climate change issue, we are already seeing that the tentative policy moves associated with ‘climate mitigation’ are contributing to deforestation, food riots, potential trade wars, inflation, energy speculation and overt corruption as in the case of ENRON (one of the leading lobbyists for Kyoto prior to its collapse). There is little question that global warming has been exploited many governments and corporations (and not just by ENRON; Lehman Brothers, for example, was also heavily promoting global warming alarm, and relying on the advice of James Hansen, etc.) for their own purposes, but it is unclear to what extent such exploitation has played an initiating role in the issue. The developing world has come to realize that the proposed measures endanger their legitimate hopes to escape poverty, and, in the case of India, they have, encouragingly, led to an assessment of climate issues independent of the ‘official’ wisdom (Government of India, 2008 [23]).

For purposes of this paper, however, I simply want to briefly note the specific implications for science and its interaction with society. Although society is undoubtedly aware of the imperfections of science, it has rarely encountered a situation such as the current global warming hysteria where institutional science has so thoroughly committed itself to policies which call for massive sacrifices in well being world wide. Past scientific errors did not lead the public to discard the view that science on the whole was a valuable effort. However, the extraordinarily shallow basis for the commitment to climate catastrophe, and the widespread tendency of scientists to use unscientific means to arouse the public’s concerns, is becoming increasingly evident, and the result could be a reversal of the trust that arose from the triumphs of science and technology during the World War II period.

Further, the reliance by the scientific community on fear as a basis for support, may, indeed, have severely degraded the ability of science to usefully address problems that need addressing. It should also be noted that not all the lessons of the World War II period have been positive. Massive crash programs such as the Manhattan Project are not appropriate to all scientific problems. In particular, such programs are unlikely to be effective in fields where the basic science is not yet in place. Rather, they are best suited to problems where the needs are primarily in the realm of engineering.

Although the change in scientific culture has played an important role in making science more vulnerable to exploitation by politics, the resolution of specific issues may be possible without explicitly addressing the structural problems in science. In the US, where global warming has become enmeshed in partisan politics, there is a natural opposition to exploitation which is not specifically based on science itself. However, the restoration of the traditional scientific paradigm will call for more serious efforts. Such changes are unlikely to come from any fiat. Nor is it likely to be implemented by the large science bureaucracies that have helped create the problem in the first place. A potentially effective approach would be to change the incentive structure of science. The current support mechanisms for science is one where the solution of a scientific problem is rewarded by ending support.

This hardly encourages the solution of problems or the search for actual answers. Nor does it encourage meaningfully testing hypotheses. The alternative calls for a measure of societal trust, patience, and commitment to elitism that hardly seems consonant with the contemporary attitudes. It may, however, be possible to make a significant beginning by carefully reducing the funding for science. Many scientists would be willing to accept a lower level of funding in return for greater freedom and stability. Other scientists may find the trade-off unacceptable and drop out of the enterprise. The result, over a period of time, could be a gradual restoration of a better incentive structure.

One ought not underestimate the institutional resistance to such changes, but the alternatives are proving to be much worse. Some years ago, I described some of what I have discussed here at a meeting in Erice (Lindzen, 2005). Richard Garwin (who some regard as the inventor of the H-bomb) rose indignantly to state that he did not want to hear such things. Quite frankly, I also don’t want to hear such things. However, I fear that ignoring such things will hardly constitute a solution, and a solution may be necessary for the sake of the scientific enterprise.

Acknowledgments. The author wishes to thank Dennis Ambler, Willie Soon, Lubos Motl and Nigel Lawson for useful comments and assistance.

Notes

1. This paper was prepared for a meeting sponsored by Euresis (Associazone per la promozione e la diffusione della cultura e del lavoro scientifico) and the Templeton Foundation on Creativity and Creative Inspiration in Mathematics, Science, and Engineering: Developing a Vision for the Future. The meeting was held in San Marino from 29-31 August 2008. Its Proceedings are expected to be published in 2009.
2. At some level, this is obvious. Theoretical physics is still dealing with the standard model though there is an active search for something better. Molecular biology is still working off of the discovery of DNA. Many of the basic laws of physics resulted from individual efforts in the 17th-19th Centuries. The profound advances in technology should not disguise the fact that the bulk of the underlying science is more than 40 years old. This is certainly the case in the atmospheric and oceanic sciences. That said, it should not be forgotten that sometimes progress slows because the problem is difficult. Sometimes, it slows because the existing results are simply correct as is the case with DNA. Structural problems are not always the only factor involved.
3. It is sometimes thought that government involvement automatically implies large bureaucracies, and lengthy regulations. This was not exactly the case in the 20 years following the second world war. Much of the support in the physical sciences came from the armed forces for which science support remained a relatively negligible portion of their budgets. For example, meteorology at MIT was supported by the Air Force. Group grants were made for five year periods and renewed on the basis of a site visit. When the National Science Foundation was created, it functioned with a small permanent staff supplemented by ‘rotators’ who served on leave from universities for a few years. Unfortunately, during the Vietnam War, the US Senate banned the military from supporting non-military research (Mansfield Amendment). This shifted support to agencies whose sole function was to support science. That said, today all agencies supporting science have large ‘supporting’ bureaucracies.
4. In fairness, such programs should be distinguished from team efforts which are sometimes appropriate and successful: classification of groups in mathematics, human genome
project, etc.
5. A personal memoir from Al Grable sent to Sherwood Idso in 1993 is interesting in this regard. Grable served as a Department of Agriculture observer to the National Research Council’s National Climate Board. Such observers are generally posted by agencies to boards that they are funding. In any event, Grable describes a motion presented at a Board meeting in 1980 by Walter Orr Roberts, the director of the National Center for Atmospheric Research, and by Joseph Smagorinsky, director of NOAA’s Geophysical Fluid Dynamics Laboratory at Princeton, to censure Sherwood Idso for criticizing climate models with high sensitivities due to water vapor feedbacks (in the models), because of their inadequate handling of cooling due to surface evaporation. A member of that board, Sylvan Wittwer, noted that it was not the role of such boards to censure specific scientific positions since the appropriate procedure would be to let science decide in the fullness of time, and the matter was dropped. In point of fact, there is evidence that models do significantly understate the increase of evaporative cooling with temperature (Held and Soden, 2006). Moreover, this memoir makes clear that the water vapor feedback was considered central to the whole global warming issue from the very beginning.
6. It should be acknowledged that Oppenheimer has quite a few papers with climate in the title – especially in the last two years. However, these are largely papers concerned with policy and advocacy, assuming significant warming. Such articles probably constitute the bulk of articles on climate. It is probably also fair to say that such articles contribute little if anything to understanding the phenomenon.
7. Certain names and organizations come up repeatedly in this paper. This is hardly an accident. In 1989, following the public debut of the issue in the US in Tim Wirth’s and Al Gore’s famous Senate hearing featuring Jim Hansen associating the warm summer of 1988 with global warming, the Climate Action Network was created. This organization of over 280 ENGO’s has been at the center of the climate debates since then. The Climate Action Network, is an umbrella NGO that coordinates the advocacy efforts of its members, particularly in relation to the UN negotiations. Organized around seven regional nodes in North and Latin America, Western and Eastern Europe, South and Southeast Asia, and Africa, CAN represents the majority of environmental groups advocating on climate change, and it has embodied the voice of the environmental community in the climate negotiations since it was established.
The founding of the Climate Action Network can be traced back to the early involvement of scientists from the research ENGO community. These individuals, including Michael Oppenheimer from Environmental Defense, Gordon Goodman of the Stockholm Environmental Institute (formerly the Beijer Institute), and George Woodwell of the Woods Hole Research
Center were instrumental in organizing the scientific workshops in Villach and Bellagio on Developing Policy Responses to Climate Change’ in 1987 as well as the Toronto Conference on the Changing Atmosphere in June 1988. It should be noted that the current director of the Woods Hole Research Center is John Holdren. In 1989, several months after the Toronto Conference, the emerging group of climate scientists and activists from the US, Europe, and developing countries were brought together at a meeting in Germany, with funding from Environmental Defense and the German Marshall Fund. The German Marshall Fund is still funding NGO activity in Europe: http://www.gmfus.org/event/detail.cfm?id=453&parent_type=E (Pulver, 2004).
8. The reports attributed to the National Academy are not, to any major extent, the work of Academy Members. Rather, they are the product of the National Research Council, which consists in a staff of over 1000 who are paid largely by the organizations soliciting the reports. The committees that prepare the reports are mostly scientists who are not Academy Members, and who serve without pay.
9. One might reasonably add the Pew Charitable Trust to this list. Although they advertise themselves as a neutral body, they have merged with the National Environmental Trust, whose director, Philip Clapp, became deputy managing director of the combined body. Clapp (the head of the legislative practice of a large Washington law firm, and a consultant on mergers and acquisitions to investment banking firms), according to his recent obituary, was ‘an early and vocal advocate on climate change issues and a promoter of the international agreement concluded in 1997 in Kyoto, Japan. Mr. Clapp continued to attend subsequent global warming talks even after the US Congress did not ratify the Kyoto accord.’
10. John Holdren has defended the use of the phrase ‘Research Center’ since research is carried out with sponsorship by National Science Foundation, the National Oceanographic Administration, and NASA. However, it is hardly uncommon to find sponsorship of the activities of environmental NGO’s by federal funding agencies
11. Appendix 1 is the invitation to the planning session for the 5th assessment. It clearly emphasizes strengthening rather than checking the IPCC position. Appendix 2 reproduces a commentary by Stephen McIntyre on the recent OfCom findings concerning a British TV program opposing global warming alarmism. The response of the IPCC officials makes it eminently clear that the IPCC is fundamentally a political body. If further evidence were needed, one simply has to observe the fact that the IPCC Summary for Policymakers will selectively cite results to emphasize negative consequences. Thus the summary for Working Group II observes that global warming will result in “Hundreds of millions of people exposed to increased water stress.” This, however, is based on work (Arnell, 2004) which actually shows that by the 2080s the net global population at risk declines by up to 2.1 billion people (depending on which scenario one wants to emphasize)! The IPCC further ignores the capacity to build reservoirs to alleviate those areas they project as subject to drought (I am indebted to Indur Goklany for noting this example.)
12. Appendix 3 is a recent op-ed from the Boston Globe, written by the aforementioned John Holdren. What is interesting about this piece is that what little science it invokes is overtly incorrect. Rather, it points to the success of the above process of taking over scientific institutions as evidence of the correctness of global warming alarmism. The 3 atmospheric scientists who are explicitly mentioned are chemists with no particular expertise in climate, itself. While, Holdren makes much of the importance of expertise, he fails to note that he, himself, is hardly a contributor to the science of climate. Holdren and Paul Ehrlich (of Population Bomb fame; in that work he predicted famine and food riots for the US in the 1980′s) are responsible for the I=PAT formula. Holdren, somewhat disingenuously claims that this is merely a mathematical identity where I is environmental impact, P is population, A is GDP/P and T is I/GDP. However, in popular usage, A has become affluence and T has become technology (viz Schneider, 1997; see also Wikipedia).
13. The 1998 paper actually only goes back to 1400 CE, and acknowledges that there is no useful resolution of spatial patterns of variability going further back. It is the 1999 paper that then goes back 1000 years.
14. Of course, Vinnikov et al did mention it. When I gave a lecture at Rutgers University in October 2007, Alan Robock, a professor at Rutgers and a coauthor of Vinnikov et al declared that the ‘latest data’ resolved the discrepancy wherein the model fingerprint could not be found in the data.
15. Haqqmisra, a graduate student at the Pennsylvania State University, is apparently still seeking greenhouse solutions to the paradox.
16. The refusal was not altogether surprising. The editor of Science, at the time, was Donald Kennedy, a biologist (and colleague of Paul Ehrlich and Stephen Schneider, both also members of Stanford’s biology department), who had served as president of Stanford University. His term, as president, ended with his involvement in fiscal irregularities such as charging to research overhead such expenses as the maintenance of the presidential yacht and the provision of flowers for his daughter’s wedding – offering peculiar evidence for the importance of grant overhead to administrators. Kennedy had editorially declared that the debate concerning global warming was over and that skeptical articles would not be considered. More recently, he has published a relatively pure example of Orwellian double-speak (Kennedy, 2008) wherein he called for better media coverage of global warming, where by ‘better’ he meant more carefully ignoring any questions about global warming alarm. As one might expect, Kennedy made extensive use of Oreskes’ paper. He also made the remarkably dishonest claim that the IPCC Summary for Policymakers was much more conservative than the scientific text.
17. Oreskes, apart from overt errors, merely considered support to consist in agreement that there had been some warming, and that anthropogenic CO2 contributed part of the warming. Such innocent conclusions have essentially nothing to do with catastrophic projections. Moreover, most of the papers she looked at didn’t even address these issues; they simply didn’t question these conclusions.
18. Perhaps unsurprisingly, The Potsdam Institute, home of Greenpeace’s Bill Hare, now has a Potsdam Institute for Climate Impact Research.
19. Tim Wirth chaired the hearing where Jim Hansen rolled out the alleged global warming relation to the hot summer of 1988 (viz Section 2). He is noted for having arranged for the hearing room to have open windows to let in the heat so that Hansen would be seen to be sweating for the television cameras. Wirth is also frequently quoted as having said “We’ve got to ride the global warming issue. Even if the theory of global warming is wrong, we will be doing the right thing — in terms of economic policy and environmental policy.”
20. When I referred to the Smith et al paper at a hearing of the European Parliament, Professor Schellnhuber of the Potsdam Institute (which I mentioned in the previous section with respect to its connection to Greenpeace) loudly protested that I was being ‘dishonest’ by not emphasizing what he referred to as the main point in Smith et al: namely that global warming would return with a vengeance.
21. The matter of ‘spin control’ warrants a paper by itself. In connection with the absence of warming over the past 13 years, the common response is that 7 of the last 10 warmest years in the record occurred during the past decade. This is actually to be expected, given that we are in a warm period, and the temperature is always fluctuating. However, it has nothing to do with trends.
22. The strange identification of the CO2 caused global warming paradigm with general relativity theory, mentioned earlier in this section, is repeated by Rahmstorf. This repetition of odd claims may be a consequence of the networking described in footnote 7.
23. A curious aspect of the profoundly unalarming Indian report is the prominent involvement in the preparation of the report by Dr. Rajendra Pachauri (an economist and long term UN bureaucrat) who heads the IPCC. Dr. Pachauri has recently been urging westerners to reduce meat consumption in order to save the earth from destruction by global warming.

References

Allen, R.J. and S.C. Sherwood (2008) Warming maximum in the tropical upper troposphere deduced from thermal winds, Nature 25 May 2008; doi:10.1038/ngeo208 1-5

Arnell, N.W. (2004) Climate change and global water resources: SRES emissions and socio-economic scenarios, Global Environmental Change, 14, 31-52.

Bard, E.and G. Delaygue (2008) Comment on “Are there connections between the Earth’s magnetic field and climate?” Earth and Planetary Science Letters 265 302–307

Barron, E.J. (1987) Eocene Equator-to- Pole Surface Ocean Temperatures: A Significant Climate Problem? PALEOCEANOGRAPHY, 2, 729–739

Bush, A.B.G. and S.G.H. Philander (1998a) The late Cretaceous: simulation with a coupled atmosphere-ocean general circulation model. Paleoceanography 12 495-516

Bush, A.B.G. and S.G.H. Philander (1998b) The role of ocean -atmosphere interactions in tropical cooling during the last glacial maximum. Science 279 1341-1344

Bush, V. (1945) Science: the Endless Frontier. http://www.nsf.gov/about/history/vbush1945.htm

Choi, Y.-S., and C.-H. Ho (2006), Radiative effect of cirrus with different optical properties over the tropics in MODIS and CERES observations, Geophysical Research Letters, 33, L21811, doi:10.1029/2006GL027403

Choi, Y.-S., and C.-H. Ho (2008), Validation of the cloud property retrievals from the MTSAT-1R imagery using MODIS observations, International Journal of Remote Sensing, accepted.

Chou, M.-D., R.S. Lindzen, and A.Y. Hou (2002b) Comments on “The Iris hypothesis: A negative or positive cloud feedback?” J. Climate, 15, 2713-2715.

CLIMAP Project (1976) The surface of the ice-age Earth. Science 191:1131-1136

Courtillot, V., Y. Gallet, J.-L. Le Mouël, F. Fluteau, and A. Genevey (2007) Are there connections between the Earth’s magnetic field and climate? Earth and Planetary Science Letters 253 328–339

Crichton, M. (2004) State of Fear, Harper Collins, 624 pp.

Crowley, T. J. (2000) CLIMAP SSTs re-revisited. Climate Dynamics 16:241-255

Demming, D. (2005) Global warming, the politicization of science, and Michael Crichton’s State of Fear, Journal of Scientific Exploration, 19, 247-256.

Dyson, F. (2008) The Question of Global Warming, New York Review of Books, 55, No. 10, June 12, 2008.

Fu, Q., Baker, M., and Hartman, D. L.(2002) Tropical cirrus and water vapor: an effective Earth infrared iris feedback? Atmos. Chem. Phys., 2, 31–37

Gelbspan, R. (1998) The Heat is On, Basic Books, 288 pp.

Government of India (2008) National Action Plan on Climate Change, 56pp.

Happer, W. (2003) Harmful Politicization of Science in Politicizing Science: The Alchemy of Policymaking edited by Michael Gough, Hoover Institution 313 pp (pp 27-48).

Haqq-Misra, J.D., S.D. Domagal-Goldman, P. J. Kasting, and J.F. Kasting (2008) A Revised, hazy methane greenhouse for the Archean Earth. Astrobiology in press

Hartmann, D. L., and M. L. Michelsen (2002) No evidence for iris. Bull. Amer. Meteor. Soc., 83, 249–254.

Held, I.M. and B.J. Soden (2006) Robust responses of the hydrological cycle to global warming,

Journal of Climate., 19, 5686-5699.

Holland, D. (2007) Bias And Concealment in the IPCC Process: The “Hockey-Stick” Affair and its Implications, Energy & Environment, 18, 951-983.

Horvath, A., and B. Soden, ( 2008) Lagrangian Diagnostics of Tropical Deep Convection and Its Effect upon Upper-Tropospheric Humidity, Journal of Climate, 21(5), 1013–1028

Huber, M. (2008) A Hotter Greenhouse? Science 321 353-354

IPCC, 1990: Climate Change: The IPCC Scientific Assessment [Houghton, J. T et al., (eds.)]. Cambridge University Press, Cambridge, United Kingdom and New York, NY, USA, 362 pp.

IPCC, 1996: Climate Change 1995: The Science of Climate Change. Contribution of Working Group I to the Second Assessment Report of the Intergovernmental Panel on Climate Change
[Houghton et al. (eds.)]. Cambridge University Press, Cambridge, United Kingdom and New York, NY, USA, 572 pp

IPCC, 2001: Climate Change 2001: The Scientific Basis. Contribution of Working Group I to the Third Assessment Report of the Intergovernmental Panel on Climate Change [Houghton, J.T., et al. (eds.)]. Cambridge University Press, Cambridge, United Kingdom and New York, NY, USA, 881 pp.

IPCC, 2007:Solomon et al., (eds.) 2007: ‘Climate Change 2007: The Physical Science Basis. Contribution of Working Group I to the Fourth Assessment Report of the Intergovernmental Panel on Climate Change’. Cambridge University Press, Cambridge, United Kingdom and New York, NY, USA. (Available at http://www.ipcc.ch/)

Keenlyside, N. S., M. Latif, J. Jungclaus, L. Kornblueh and E. Roeckner (2008) Advancing decadal-scale climate prediction in the North Atlantic sector. Nature 453 84-88

Kennedy, D., 2008: Science, Policy, and the Media, Bulletin of the American Academy of Arts & Sciences, 61, 18-22.

Kiehl, J.T. (2007) Twentieth century climate model response and climate sensitivity. Geophys. Res. Lttrs., 34, L22710, doi:10.1029/2007GL031383

Lee, M.I., M.J. Suarez, I.S. Kang, I. M. Held, and D. Kim (2008) A Moist Benchmark Calculation for the Atmospheric General Circulation Models, J.Clim., in press.

Lin, B., B. Wielicki, L. Chambers, Y. Hu, and K.-M. Xu, (2002) The iris hypothesis: A negative or positive cloud feedback? J. Climate, 15, 3–7.

Lindzen, R.S. (1999) The Greenhouse Effect and its problems. Chapter 8 in Climate Policy After Kyoto (T.R. Gerholm, editor), Multi-Science Publishing Co., Brentwood, UK, 170pp.

Lindzen, R.S. (2005) Understanding common climate claims. in Proceedings of the 34th International Seminar on Nuclear War and Planetary Emergencies, R. Raigaini, editor, World Scientific Publishing Co., Singapore, 472pp. (pp. 189-210)

Lindzen, R.S. (2007) Taking greenhouse warming seriously. Energy & Environment, 18, 937-950.

Lindzen, R.S., M.-D. Chou, and A.Y. Hou (2001) Does the Earth have an adaptive infrared iris?

Bull. Amer. Met. Soc. 82, 417-432.

Lindzen, R.S., M.-D. Chou, and A.Y. Hou (2002) Comments on “No evidence for iris.” Bull. Amer. Met. Soc., 83, 1345–1348

Lindzen-Rahmstorf Exchange (2008) http://www-eaps.mit.edu/faculty/lindzen/L_R-Exchange.pdf

Mann, M.E., R.E. Bradley, and M.K. Hughes (1998) Global-scale temperature patterns and climate forcing over the past six centuries,” Nature, 392, 779-787.

Mann, M.E., Bradley, R.S. and Hughes, M.K. (1999) Northern Hemisphere Temperatures During the Past Millennium: Inferences, Uncertainties, and Limitations, Geophysical Research Letters,

26, 759-762.

McIntyre, S. and R. McKitrick (2003) Corrections to the Mann et al. (1998) proxy data base and Northern hemispheric average temperature series,” Energy and Environment, 14, 751-771.

McIntyre, S. and R. McKitrick (2005a) The M&M critique of MBH98

Northern hemisphere climate index: Update and implications, Energy and Environment, 16, 69-100.

McIntyre, S. and R. McKitrick (2005b) Hockey sticks, principal components, and spurious significance,” Geophysical Research Letters, 32, L03710, doi:10.1029/2004GL021750

Miller, D.W. (2007) The Government Grant System Inhibitor of Truth and Innovation? J. of Information Ethics, 16, 59-69

National Academy of Sciences (1992) Policy Implications of Greenhouse Warming:Mitigation, Adaptation, and the Science Base, National Academy Press, 944 pp.

North, G.R., chair (2006) NRC, 2006: Committee on Surface Temperature Reconstructions for the Last 2,000 Years, National Research Council, National Academies Press

Oppenheimer, M. and R.Boyle (1990) Dead Heat, The Race Against the Greenhouse Effect, Basic Books, 288 pp.

Oreskes, N.(2004) The scientific consensus on climate change. Science, 306, 1686.

Pearce, F. (2008) Poor forecasting undermines climate debate. New Scientist, 01 May 2008, 8-9

Pearson, P.N., P.W. Ditchfeld, J. Singano, K.G. Harcourt-Brown, C.J. Nicholas, R.K. Olsson, N.J. Shackleton & M.A. Hall (2000) Warm tropical sea surface temperatures in the Late Cretaceous and Eocene epochs Nature 413 481-487

Pielke Sr., R.A., T.N. Chase, J.R. Christy and B. Herman (2008) Assessment of temperature trends in the troposphere deduced from thermal winds. Nature (submitted)

Pulver, Simone (2004). Power in the Public Sphere: The battles between Oil Companies and Environmental Groups in the UN Climate Change Negotiations, 1991-2003. Doctoral dissertation, Department of Sociology, University of California, Berkeley

Roe, G. (2006) In defense of Milankovitch. Geophys. Res. Ltrs., 33, L24703, doi:10.1029/2006GL027817

Schneider, S.H., (1997) Laboratory Earth, Basic Books, 174pp.

Sackmann, J. and A.I. Boothroyd (2003) Our sun. V. A bright young sun consistent with helioseismology and warm temperatures on ancient earth and mars. The Astrophysical Journal, 583:1024-1039

Sagan, C. and G. Mullen. (1972) Earth and Mars: evolution of atmospheres and surface temperatures. Science, 177, 52-56.

Schrag, D.P. (1999) Effects of diagenesis on isotopic record of late Paleogene equatorial sea surface temperatures. Chem. Geol., 161, 215-224

Schulte, K.-M. (2008) Scientific consensus on climate? Energy and Environment, 19 281-286

Shackleton, N., and A. Boersma, (1981) The climate of the Eocene ocean, J. Geol. Soc., London, 138, 153-157.

Singer, S.F. (2003) The Revelle-Gore Story Attempted Political Suppression of Science in

Politicizing Science: The Alchemy of Policymaking edited by Michael Gough, Hoover Institution 313 pp (pp 283-297).

Singer, S.F., C. Starr, and R. Revelle (1991), “What To Do About Greenhouse Warming: Look Before You Leap,” Cosmos 1 28–33.

Smith, D.M., S. Cusack, A.W. Colman, C.K. Folland, G.R. Harris, J.M. Murphy (2007) Improved Surface Temperature Prediction for the Coming Decade from a Global Climate Model

Science, 317, 796-799

Soon, W., S. Baliunas, C. Idso, S. Idso, and D. Legates (2003) Reconstructing climatic and environmental changes of the past 1000 years: a reappraisal. Energy and Environment, 14, 233-296

Thompson, D.W.J., J. J. Kennedy, J. M. Wallace and P.D. Jones (2008) A large discontinuity in the mid-twentieth century in observed global-mean surface temperature Nature 453 646-649

Vinnikov, K.Y. N.C. Grody, A. Robock, RJ. Stouffer, P.D. Jones, and M.D. Goldberg (2006) Temperature trends at the surface and in the troposphere. J. Geophys. Res.,111, D03106, doi:10.1029/2005JD006392

Weart, S. (2003) The Discovery of Global Warming, Harvard University Press, 228 pp.

Wegman, E.J. et al., (2006): Ad Hoc Committee report on the “Hockey Stick” global climate reconstruction, commissioned by the US Congress House Committee on Energy and Commerce, http://republicans.energycommerce.house.gov/108/home/07142006_Wegman_Report.pdf

Zedillo, E., editor (2007) Global Warming: Looking Beyond Kyoto. Brookings Institution Press, 237 pp.

A Pisa il comando delle forze speciali

September 22nd, 2014 by Manlio Dinucci

Si infiltrano nottetempo in territorio nemico senza essere viste, individuano gli obiettivi da colpire, li eliminano con un‘azione fulminea paracadutandosi dagli aerei o calandosi dagli elicotteri, quindi si ritirano senza lasciare traccia salvo i morti e le distruzioni: sono le forze speciali, sempre più impiegate nelle «guerre coperte». L’Italia, che le ha usate finora soprattutto in Afghanistan, fa ora un decisivo passo avanti nel loro potenziamento. Alla caserma Gamerra di Pisa, sede del Centro addestramento paracadutismo, si è appena costituito il Comando delle forze speciali dell’esercito (Comfose), il primo del suo genere in Italia. Esso riunisce sotto un comando unificato il 9° Reggimento d’assalto Col Moschin e il 185° Reggimento acquisizione obiettivi Folgore di stanza a Livorno, il  28° Reggimento comunicazioni operative Pavia di stanza a Pesaro e il 4° Reggimento alpini paracadutisti Ragers con sede presso Verona. A questi si aggiungerà tra poco il 26° Reparto elicotteri per operazioni speciali, destinato a trasformarsi in 3° Reggimento elicotteri per operazioni speciali Aldebaran.

Perché è stata scelta Pisa quale sede del Comfose? Perché l’aeroporto militare della città è stato trasformato in «Hub aereo nazionale dedicato alla gestione dei flussi di personale e di materiale dal territorio nazionale per i teatri operativi, e viceversa, con tempestività e efficacia» (come lo definisce il Programma pluriennale dello Stato maggiore della difesa approvato dalle Commissioni Difesa del Senato e della Camera). Il Comfose, ha spiegato nel discorso inaugurale il generale Zanelli che lo comanda, «è nato per assicurare la disponibilità immediata di uno strumento dedicato, idoneo ad assolvere l’intero spettro delle operazioni speciali». In altre parole, una volta addestrati per «essere in grado di sopravvivere e combattere in ogni ambiente operativo contro avversari estremamente determinati e insidiosi», gli specialisti delle forze speciali potranno essere immediatamete proiettati attraverso l’hub aereo di Pisa nei vari teatri bellici. Quali siano quelli immediati lo ha spiegato, a margine della presentazione del Comfose, il Capo di stato maggiore, generale Graziano: «Nell’Est Europa l’Italia deve essere presente, così come si è riproposto il fronte mediorientale».

L’altra ragione della scelta di Pisa quale sede del Comfose è sicuramente la presenza della limitrofa base Usa di Camp Darby, che rifornisce le forze terrestri e aeree nell’area mediterranea, africana, mediorientale e oltre. E’ l’unico sito dell’esercito Usa in cui il materiale preposizionato (carrarmati, ecc.) è collocato insieme alle munizioni: nei suoi 125 bunker vi è l’intero equipaggiamento di due battaglioni corazzati e due di fanteria meccanizzata. Vi sono stoccate anche enormi quantità di bombe e missili per aerei, insieme ai «kit di montaggio» per costruire rapidamente aeroporti nelle zone di guerra. Questi e altri materiali bellici possono essere rapidamente inviati in zona di operazione attraverso il porto di Livorno e l’aeroporto di Pisa. Serve quindi alla proiezione di forze Usa nei vari teatri bellici.

Come ha chiarito il generale Zanelli, il Comfose manterrà un «collegamento costante» anzitutto con lo «U.S. Army Special Operation Command», il più importante comando statunitense per le operazioni speciali che, formato da 26mila commandos, fornisce circa il 70% delle forze speciali al Comando centrale nella cui «area di responsabilità» rientra il Medio Oriente. Appare dunque chiaro che le forze speciali del Comfose, in parte già formatesi nella guerra in Afghanistan sotto comando Usa, sono destinate ad operare, sempre sotto comando Usa, in Iraq e Siria. Segretamente. Tenendo all’oscuro lo stesso parlamento della Repubblica che, nella sua Costituzione, ripudia la guerra.

Manlio Dinucci

The British government has been warned it may face legal action if it fails to consult Parliament and the public on the redeployment of drones outside declared warzones.

Questions have been raised by Saeed Al Yousefi, a Yemeni man from a province that is a frequent target of US strikes, about the fate of at least ten armed Reaper drones currently based in Afghanistan. Ministers have so far declined to reveal where the weapons, which are piloted remotely from US bases in Nevada and Lincolnshire, will be used after December 2014, when UK operations in Afghanistan finish.

The legal proceedings, notified to the government by legal charity Reprieve and law firm Deighton Pierce Glynn on Mr Al Yousefi’s behalf, ask the UK government to make clear its intentions for the Reapers, and confirm that Parliament will be consulted before any new deployment of the drones.

In July, Defence Minister Mark Francois suggested the government would bypass Parliament, telling MPs: “The UK intends to retain the Reaper capability […] there is no intention for parliamentary approval to be sought prior to each deployment or re-deployment.” Foreign Secretary Philip Hammond has refused to rule out the use of UK drones against Yemen.

Predators and Reapers have been used by the CIA or Joint Special Operations Command (JSOC) to carry out secretive strikes in countries with which the US is not at war, such as Yemen and Pakistan. The strikes have killed hundreds of civilians, and take place with little or no oversight; President Barack Obama has refused to acknowledge formally that such strikes are taking place. This week, the UN’s human rights council launched an inquiry into the legality of the drone strikes, which UK officials were expected to attend.

Reprieve’s Legal Director Kat Craig said: “It is bad enough that the UK already supports the CIA’s secret, illegal drone campaign but there is now a real risk that Britain will follow the US down the slippery slope to an endless, global war without limits and without accountability. The public must be allowed to know when and where our government sends armed drones to carry out deadly strikes – if the government resists this, it will strike at the heart of our democratic traditions.”

Daniel Carey, a solicitor at Deighton Pierce Glynn, said: “Using drones outside of armed conflict will be a step change in UK drone operations, yet the MoD is refusing to tell even parliament what its plans are. Our client does not want to see the UK’s drones in the skies of Yemen. And campaigners do not want the UK to lead the way in drone proliferation and the deterioration of the international legal order.”

Private contractors from LEAR Asset Management

There are very few news stories about government overreach that shock me these days, but this week there were two — both in California. Each came and went with barely a whisper in the media, even from the “liberty” news.

Perhaps we’re so bombarded with mafia tactics by the government that some events just get lost in the chaos. And no, one of these developments is NOT the Los Angeles School District acquiring tanks and grenade launchers, although that’s probably of equal significance. Below is the first of these local stories. The second will be in a follow-up article.

This is probably the scariest development in law enforcement, ever, and I don’t say that lightly. If you thought no-knock SWAT raids to serve warrants for non-violent crimes was the epitome of tyranny, wait until you get a load of private mercenaries conducting special forces-type raids on American citizens.

That’s right, a report out of Mendocino, California admits that Blackwater-like private “security” contractors are now being used to “police pot.” Mysterious soldiers repelled out of unmarked helicopters fully armed for war to raid legal medical cannabis gardens last month. They didn’t identify themselves or present paperwork of any kind. They just destroyed the garden and left. Other witnesses claim this invading army is also “confiscating” product.

Here’s the local CBS news report:


This is the ultimate “feeler” story in the unfolding Totalitarian Tip-Toe if I’ve ever seen one. A quirky local story of “mystery men” used to raise the public threshold of acceptable tyranny, a.k.a. legitimizing private-sector soldiers for law enforcement.

The war machine seems to be gauging how much terror they can inflict on peaceful Americans before they say WTF (See Ferguson) and, perhaps more importantly, to see if the public will allow this vast new market for war profiteers.

It should be a massive media story “private war profiteering at home to terrorize citizens fight crime”. Helicopters, weapons of war, and tactical gear are expensive. Who’s seeding these start-ups anyway?

The manipulation continued a day after this story was reported, when Alex Altman of TIME wrote “Californians Turn to Private Security to Police Pot Country” as if all the citizens of California have agreed to this type of policing. Subtle manipulation.

TIME writes:

Over the summer, residents claimed men in military gear had been dropping onto private property from unmarked helicopters and cutting down the medicinal pot gardens of local residents. Local law enforcement have conducted helicopter raids in the area, but some worried the culprit this time was different: a private-security firm called Lear Asset Management.

The confusion was easy to understand. In the wildlands of California’s pot country, the workings of law enforcement are hard to track, and the rules for growing pot are often contradictory. To add to the mess, the various local, county, state and federal enforcement efforts don’t always communicate with each other about their efforts. The added possibility of private mercenaries, with faceless employers, fast-roping from helicopters raised alarm bells for many farmers.

TIME legitimizes Lear Asset Management and the practice of private policing with a matter-of-fact job description:

They are hired by large land owners to do the work of clearing trespass gardens from private property, and perform forest reclamation, sometimes funded by government grant. Deep in the woods, they cut down illegal pot plants and scrub the environmental footprint produced by the backwoods drug trade. They carry AR-15 rifles, lest they meet armed watchmen bent on defending their plots.

I really don’t have a problem with securing private property from vandals, but did you catch that slip “sometimes funded by government grant”?  That’s when “private security” becomes “law enforcement.” This is the RED ALERT buried in this story. At best our tax dollars are being used to fund private armies for large land owners. At worst, when will we see these warriors policing BLM land (aka National Parks)? Wait for it…

Altman quotes official statistics about how successful Lear and law enforcement are in raiding marijuana farmers, measured in the “street value” of the forbidden crop seized at gunpoint, as if that is still acceptable behavior by society’s peace keepers in the era of legal weed. But Altman just uses it as a segue into a broader “problem” of policing environmental vandalism on large stretches of open land, including “public” land.

More recently, the trespass grow sites have migrated from public land onto the vast plots owned by private citizens and timber companies. Some of them have hired Lear to deal with the problem. The company has run about nine missions across California’s pot country this year, with more planned this fall, Trouette says. And while the company’s special-ops aspect gets much of the attention, most of the work focuses on environmental reclamation.

The public is supposed to believe Lear is merely an environmental clean-up team doing community service who just so happens to have military special ops capability. How quaint. I didn’t know litter maintenance required AR-15s. But who would be opposed protecting the environment? Smart marketing.

TIME goes for the hard close to sell this tyranny by providing legal cover for these raids without warrants, before ending the article as a sponsored post for “regulation” of Lear’s “flourishing” domestic mercenary business as the “best thing for locals.”

Reports of vigilante marijuana raids on private property may simply stem from a lack of legal clarityUnder the so-called “open fields doctrine” set forth by the U.S. Supreme Court, the Fourth Amendment does not protect undeveloped property from warrantless searches. As a result, police may be permitted to cut down private gardens without a warrant. (my emphasis because you need to read and reread every word)

In the meantime, Lear has flourished, despite the concern among some local growers. But like most people in the Emerald Triangle, Trouette thinks thebest thing for the locals would be for the feds to sort out all the confusion. “I think the federal government would do everybody a big favor,” he says, “by regulating this industry.” (my emphasis)

So let me get this straight: a criminal gang of armed thugs commits violence and theft, and the best way to solve that problem is to legalize and regulate those thugs? Sounds like ISIS.

The creepiest thing about this development is that it’s a clever, more professional repackaging of a previous attempt to introduce private police in America. Some of you liberty lovers may recall it being rolled out once before in an eerily similar manner.

In 2009, FOX News wrote U.S. Mystery ‘Police’ Force Has Small Montana City on Edge after a local news report aired showing an extremely well-funded private security contractor going by the name American Police Force (APF) rolling into the town of Hardin in black Mercedes tagged as “Harding Police Department”.

The town contracting a private firm for domestic policing caused massive outrage not just locally in Montana but also around the United States. APF is now referred to as a well-funded fraud perpetuated by a petty con man and the event was swiftly dumped into the dustbin of history.

The Wikipedia entry on APF states:

American Police Force (APF), and under its revised name American Private Police Force, was a fraudulent entity claiming to be a private military company. It never possessed any legitimacy to operate in the United States. The company’s previous logo was an exact copy of the Serbian state coat of arms which caused some controversy and resulted in the Serbian government threatening legal action against APF if it did not remove or change the logo.

In September 2009, US government contract databases showed no record of the company, while security industry representatives and federal officials said they had never heard of it.

APF was registered as a corporation in California by convicted con man Michael Hilton on 2 March 2009.

Interestingly, there are absolutely no follow-up reports of “Michael Hilton” or anyone else being prosecuted or convicted in the APF case. They simply vanished. Think about that for a moment. A heavily-armed foreign force invades a small town in America on false pretenses committing dangerous fraud and the U.S. government does absolutely nothing about it. What does that tell you?

Well, we know the U.S. military uses private contractors in foreign wars, and we know the Pentagon is arming and militarizing domestic police, and we know the U.S. Army is training to enter law enforcement. It seems to me that it’s all part of the plan to keep the war machine churning and to control the population.

Now with a more polished version of private security, minus the flashy Mercedes and foreign accents, and sold to us as environmental guardians, this story has gone largely unnoticed. Yet, if these raid allegations are true, Lear’s actions already far exceed anything APF did in Montana.

Telling It Like It Is On Israel

September 22nd, 2014 by Stephen Lendman

 It’s high time growing numbers of critics speak out forthrightly. 

Israeli high crimes against peace are too egregious to ignore. 

It’s essential to maintain a steady drumbeat of truth. It’s crucial to enlist growing numbers to demand accountability.

Israel’s 20% Arab population is effectively disenfranchised. Their fundamental rights are systematically denied.

Their few Knesset members are treated like potted plants. Like enemies of the state.

They’re scorned. They’re denounced. They’re persecuted. They’re treated like fifth column threats.

Occupied Palestinians face daily state terror. Gaza’s blockade remains despite repeated Israeli promises to ease things.

It’s invaded, bombed and shelled preemptively at Israel’s discretion.

Palestinians are wrongfully blamed for Israeli high crimes against peace. West Bank communities face multiple daily incursions.

Homes are ransacked. Property is damaged, destroyed or stolen. Families are terrorized. Children are traumatized. Dozens of lawless arrests are made.

Gazan fishermen are attacked at sea. Israel does so despite its Operation Protective Edge ceasefire agreement pledge not to do so.

Israeli promises aren’t worth the paper they’re written on. They’re systematically spurned. It works the same way every time. Rogue states operate this way.

Farmers are shot in their fields. Israeli border guards shoot Palestinian children for target practice.

Peaceful protesters are attacked with tear gas, stun grenades, batons, rubber-coated steel bullets and live fire.

Steven Salaita refused to be silent. He acted responsibly. Doing so cost him his tenured University of Illinois Urbana-Champaign American Indian Studies professorship.

His Twitter comments pulled no punches. They touched vital nerves.

He called Israel “a great example of how colonization impairs ethics and compels people to support shameful deeds in the name of atavistic ideals.”

He said “Hamas is the biggest red herring in American political discourse since Saddam’s ‘weapons of mass destruction.’ ”

Claiming “Hamas makes us do it…isn’t new,” he explained. “American settlers used (similar logic) in slaughtering and displacing Natives.”

“Forget biting the hand,” he said. “Israel just devoured Obama’s arm to the shoulder blade.”

It’s the only nation mass “murder(ing) (hundreds of Palestinian children) and insisting it is the victim.”

It’s gets away with murder and mass destruction. It does so because Western leaders able to make a difference do nothing.

They don’t intervene. They don’t give a damn about doing the right thing.

They support Israeli lawlessness. They back its genocidal high crimes. They ignore Palestinian rights. Israeli ones alone matter.

Few outspoken people anywhere match George Galloway. He’s a British politician/broadcaster/writer. He’s a Respect Party Bradford West MP.

He gained prominence in Scottish politics. In 1983, he became London-based War on Want charity general secretary.

He won a Labor party parliamentary seat the same year. He represented Glasgow Hillhead. He later represented its successor Glasgow Kelvin constituency.

He retained the seat until 2005. In October 2003, he was expelled from Labor for opposing Bush/Blair’s naked aggression on Iraq.

Shameless Labor leaders said he brought disrepute to Britain’s Labor party. At the time, he said he’d stand as an independent MP.

He “consider(ed) his position…” He “consult(ed) (anti-war) movement” members.

“I will definitely defend my position in parliament,” he said. “I am not leaving politics.”

He called his expulsion “a travesty of justice, a politically motivated kangaroo court. The verdict was written in advance.”

“It is clear now that Mr. Blair intends to go after” likeminded anti-war advocates. “His response to the disaster is to attack those who opposed” it.

In April, he said if he was “sacked,” what message will (British people) take about the nature of Mr. Blair’s regime from that?”

“If necessary I will defend the new Glasgow Central constituency on a platform of real Labor values, and I believe I shall win.”

In a 50-page deposition, he argued he was wrongfully singled out for punishment. He voiced legitimate criticisms.

Other Labor party members shared them. They included former cabinet members Robin Cook and Clare Short.

At the opening of proceedings against him, he called them a “political show trial.” He said it was more like how Saddam ran things than modern-day Britain.

Former Labor MP Tony Benn defended him. He said Blair described peace protesters disgracefully. He stressed they had “blood on their hands.”

“Serious things were said on both sides,” he added. Labor has no internal appeal process against expulsion.

Galloway was with Labor from age 13. He was saddened to leave party ranks. Labor would “rue the day” it expelled him, he said.

National constitutional committee panel chair Rose Burley issued a statement, saying:

“Following the case brought by the national executive committee of the Labour party to the national constitutional committee and after a two day hearing the unanimous decision of the panel of the national constitutional committee found four of the five charges brought against Mr Galloway proven and the decision of the panel was that Mr Galloway be expelled from membership of the Labour party forthwith.”

Stop The War coalition leaders called his expulsion an “absolute disgrace.”

Coalition convenor Lindsey German said he “told the truth before, during and after the war with Iraq, whereas Tony Blair has told nothing but lies.”

“It is disgraceful that the Labour party is penalizing (him) and giving Blair a standing ovation because that does not reflect the British people’s views.”

London Unison convenor George Martin said:

“This will drive more people away from the Labour party and will make it more difficult to maintain the link between the party and trade unions.”

Labor MP socialist campaign group members called for an emergency NEC meeting. They urged overturning “this contemptible decision and reinstat(ing) Galloway with immediate effect.”

Waging war on Iraq was illegal, Galloway stressed. He urged British troops to disobey “illegal orders.” He asked:

“Why don’t Arabs do something for the Iraqis? Where are the Arab armies? We wonder when the Arab leaders wake up? When are they going to stand by the Iraqi people?”

Galloway remains passionately anti-war. He’s unapologetic about where he stands.

In May 2005, he bested US senators on Capitol Hill. He exposed them. He embarrassed them. He made fools of them.

He gave far more than he took. He accused them of manufacturing “the mother of all smokescreens.”

He did so in refuting wrongful charges about profiting from Iraqi oil sales. He told Senate subcommittee members they conducted a “schoolboy howler” in investigating illicit oil sales.

They tried diverting attention from the aftermath of Bush/Blair’s Iraq aggression. He was powerfully defiant.

He told Republican subcommittee chairman Norm Coleman:

“I know that standards have slipped over the last few years in Washington, but for a lawyer you are remarkably cavalier with any idea of justice.”

“I am here today, but last week you already found me guilty.”

“You traduced my name around the world without ever having asked me a single question, without ever having contacted me, without ever having written to me or telephoned me, without any contact with me whatsoever.”

“And you call that justice.”

Senate subcommittee members targeted Galloway for his anti-war convictions. They had no evidence that he profited from Iraqi oil sales. None existed.

“What counts is not the names on the paper,” he said. “What counts is where’s the money, senator?”

“Who paid me money, senator? Who paid me hundreds of thousands of dollars?

“The answer to that is nobody. And if you had anybody who paid me a penny, you would have produced them here today.”

Senate subcommittee member lied. They claimed Galloway and former French interior minister Charles Pasqua got lucrative oil revenue payouts in return for demanding sanctions imposed on Iraq be loosened.

Galloway and Pasqua denied the accusation. Galloway said so-called documents used against them were “forged.” It’s a “proven fact,” he said.

Rightwing broadsheets published them. They did so to discredit Galloway.

He told Norm Coleman “(y)ou have nothing on me, senator, except my name on lists of names from Iraq, many of which have been drawn up after the installation of your puppet government in Baghdad.”

He assured senators he “never (got) a penny from an oil deal, a cake deal, a bread deal or from any other deal.”

At the same time, he attacked Bush/Blair’s naked aggression. The immorality of post-Gulf War sanctions. The unconscionable harm done to millions of Iraqis.

“Senator, in everything I said about Iraq, I turned out to be right and you turned out to be wrong,” he said.

Bush/Blair waged war based “on a pack of lies,” he stressed. He accused Congress having blood on its hands.

He opposed Saddam’s regime “when British British and American governments and businessmen were selling him guns and (poison) gas,” he said.

“I have a better record of opposition to Saddam Hussein than you do,” he stressed.

Galloway supports Palestinian rights. He’s forthrightly anti-Zionist. It’s a cancer harming Jews and non-Jews alike.

He was involved in Viva Palestina humanitarian aid missions. He’s a powerful speaker. The Spectator named him 2001 Debater of the Year.

He said Israeli products, academics and tourists aren’t welcome in his Bradford West district. He declared it an “Israeli-free zone.” Israelis aren’t wanted here, he stressed.

“We don’t want any Israeli goods. We don’t want any Israeli services. We don’t want any Israeli academics coming to the university or the college.”

“We don’t even want any Israeli tourists to come to Bradford, even if any of them had thought of doing so.”

In response to police questioning, he said:

“This is a monumental – and monumentally expensive – waste of police time set off by people who apparently find it excusable to incinerate innocent children and babies.”

“I will not suffer any attempts to have my freedom of speech curtailed and I am confident that at the end of this charade my right to speak the truth will be upheld.”

Daniel Taub is Israeli UK ambassador. Things escalated after he visited Bradford in mid-August. He held meetings with Jewish groups and prominent councillors.

He claimed Jewish community leaders and Israeli supporters invited him after Galloway said tourists weren’t welcome.

He tweeted a picture of himself holding an Israeli passport outside city hall. Another with an Israeli flag in Bradford’s Greengates area.

Bradford Council of Mosques secretary Zulfi Karim called his actions “deliberate(ly) provocati(ve).”

“For an ambassador to unfurl an Israeli flag by a Welcome to Bradford sign is a deliberate provocation and not the behaviour I would expect of an ambassador of one of the world’s most important countries,” he said.

He urged Galloway and Taub to stop “bring(ing) (their) politics to the streets of Bradford to create disharmony among our communities.”

Galloway urged Bradford’s council to table a no confidence motion against Labor leader Dave Green. He met with Taub at city hall. So did Conservative and Liberal Democrat members.

Green accused Galloway of using Israel’s Gaza war to benefit himself politically locally and internationally. In response, Galloway said:

“I think Labor’s open invitation that ‘Israelis are welcome in Bradford’ and the ambassador’s furtive visit ensured my re-election, no?”

In 2012, Galloway won Bradford West’s byelection overwhelmingly. At the time, he called his victory the “Bradford Spring.”

Separately on September 20, Labor candidate Vicky Kirby was suspended after using social media to criticize Israel. She justifiably called its regime “evil.”

She reportedly said

“(w)e invented Israel when saving them from Hitler, who now seems to be their teacher.”

“I will never forget, and I will make sure my kids teach their children how evil Israel is!”

“Apparently you can ask IS/ISIS/ISIL questions on ask.fm.”

“Anyone thought of asking them why they’re not attacking the real oppressors #Israel?”

Suspending Kirby didn’t surprise. Criticizing Israel is the third rail of Western politics. It’s a potential career ender for those who try.

Galloway is a notable exception. If enough other government representatives and aspirants followed his lead, things might change dramatically.

Israel high crimes would be highlighted. They wouldn’t fade from public attention.

Perhaps accountability would follow. Maybe long overdue justice owed Palestinians.

Stephen Lendman lives in Chicago. He can be reached at [email protected]. His new book as editor and contributor is titled “Flashpoint in Ukraine: US Drive for Hegemony Risks WW III.” http://www.claritypress.com/LendmanIII.html Visit his blog site at sjlendman.blogspot.com. Listen to cutting-edge discussions with distinguished guests on the Progressive Radio News Hour on the Progressive Radio Network. It airs three times weekly: live on Sundays at 1PM Central time plus two prerecorded archived programs.

The next time you visit a hospital, it is your wallet that may end up hurting the most.  All over the United States, it has become common practice for hospitals to wildly inflate medical bills.  For example, it has been reported that some hospitals are charging up to 30 dollars for a single aspirin pill.  And as you will see below, some victims report being billed tens of thousands of dollars for a non-surgical hospital visit that lasts only a few hours.  When something is seriously wrong with us, most of us never stop to ask our health professionals how much it will cost to actually treat us.  In that moment, we are desperate and we just want someone to help us.  Many doctors and hospitals take full advantage of this by billing their “customers” as much as they feel they can possible get away with.  It is a legal scam that is bilking ordinary Americans out of billions of dollars every single year.

Over the weekend, the New York Times reported on one case that is a perfect example of the outrageous medical billing that I am talking about…

Before his three-hour neck surgery for herniated disks in December, Peter Drier, 37, signed a pile of consent forms. A bank technology manager who had researched his insurance coverage, Mr. Drier was prepared when the bills started arriving: $56,000 from Lenox Hill Hospital in Manhattan, $4,300 from the anesthesiologist and even $133,000 from his orthopedist, who he knew would accept a fraction of that fee.

He was blindsided, though, by a bill of about$117,000 from an “assistant surgeon,” a Queens-based neurosurgeon whom Mr. Drier did not recall meeting.

“I thought I understood the risks,” Mr. Drier, who lives in New York City, said later. “But this was just so wrong — I had no choice and no negotiating power.”

The practice known as “drive-by doctoring” has gotten completely and totally out of control.

All over America, doctors are popping into surgeries or are stopping by to talk to another doctor’s patients for a few minutes and are charging thousands of dollars for this “assistance”.

It is a morally reprehensible scam that needs to be stopped.

Another thing that needs to be stopped is the practice that many hospitals have of billing patients for emergency medications at a rate that is thousands of times over cost.

For example, just check out what happened when 52-year-old Marcie Edmonds went in to a hospital in Arizona to get treated for a scorpion sting

With the help of a friend, she called Poison Control and was advised to go to the nearest hospital that had scorpion antivenom, Chandler Regional Medical Center. At the hospital, an emergency room doctor told her about the antivenom, called Anascorp, that could quickly relieve her symptoms. Edmonds said the physician never talked with her about the cost of the drug or treatment alternatives.

Her symptoms subsided after she received two doses of the drug Anascorp through an IV, and she was discharged from the hospital in about three hours.

Weeks later, she received a bill for $83,046 from Chandler Regional Medical Center. The hospital, owned by Dignity Health, charged her $39,652 per dose of Anascorp.

Did that hospital actually need to charge that much?

Of course not.

Hospitals down in Mexico only charge $100 per dose of Anascorp.

And anyone that has ever been in for major surgery knows how outrageous some of these hospital bills can be.

For instance, consider the experience of an NBC News reporter that chose to have neck surgery for degenerative disc disease….

Once I got my itemized bill, the grand total was a little over $66,013.40!   That was for a one night stay and a four level vertebrae fusion surgery.  The charges included $22 for one sleeping pill, $427 for one dissecting tool, and $32,000 for four titanium plates and ten screws.

I brought it to Todd Hill, a fee based patient advocate who helps people decipher their medical bills. “The screws in your procedure were billed at $605 a piece for a total of $6050 dollars. We’ve seen those in our past research for $25 or $30,” he said. “In this case, the markup is tremendous,” he added.

One of the primary reasons why so many Americans die completely broke is because medical bills can run up to astronomical heights if you happen to have a terminal illness.

For example, a while back Time Magazine reported on one cancer patient in California that had run up nearly a million dollars in hospital bills before he died…

By the time Steven D. died at his home in Northern California the following November, he had lived for an additional 11 months. And Alice had collected bills totaling $902,452. The family’s first bill — for$348,000 — which arrived when Steven got home from the Seton Medical Center in Daly City, Calif., was full of all the usual chargemaster profit grabs: $18each for 88 diabetes-test strips that Amazon sells in boxes of 50 for $27.85; $24 each for 19 niacin pills that are sold in drugstores for about a nickel apiece. There were also four boxes of sterile gauze pads for$77 each. None of that was considered part of what was provided in return for Seton’s facility charge for the intensive-care unit for two days at $13,225 a day, 12 days in the critical unit at $7,315 a day and one day in a standard room (all of which totaled$120,116 over 15 days). There was also $20,886for CT scans and $24,251 for lab work.

The sad truth is that the U.S. health care system has become a giant money making scam, and all of us are the victims.

Those that work in this industry should be greatly ashamed for what they are doing to us.

Just consider the following numbers…

-It has been estimated that hospitals in the United States overcharge their patients by about 10 billion dollars every single year.

-Medical bills are the number one reason why Americans file for bankruptcy.  One study found that approximately 41 percent of all working age Americans either have medical bill problems or are currently paying off medical debt.

-According to a report published in The American Journal of Medicine, medical bills cause more than 60 percent of the personal bankruptcies in the United States.

-Health insurance is not nearly as much protection as you might think.  According to a report published in the American Journal of Medicine, of all bankruptcies caused by medical debt approximately 75 percent of the time the people actually did have health insurance.

-Hospitals are not shy about sending debt collection agencies after people with unpaid medical bills.  In fact, collection agencies seek to collect unpaid medical bills from approximately 30 million Americans every year.

-Back in 1980, less than 10 percent of U.S. GDP went to health care.  Today, about 18 percent of U.S. GDP goes toward health care.

-If the U.S. health care system was a nation, it would be the 6th largest economy on the entire planet.

Does anyone out there have any doubt that the system is completely broken?

Please share this article with as many people as you can.  Hospitals all over America are brazenly ripping us off, and we need to stand up and say that enough is enough.

There was much enthusiasm in 2008 that President Barack Obama would bring a saner and more lawful approach to issues of foreign policy and war and peace. Six years later — with Americans still being killed in Afghanistan, Guantanamo Bay still in active operation, US drones killing people in several countries and even American citizens, and now new mischief in Iraq — it is clear that President Obama has done little more than expand the already large war-making powers of his predecessor and fully enabled the vision of a “unitary executive” with unfettered powers in war and peace.

Where is, for example, President Obama’s domestic authorization for the use of force in Iraq against the Islamic State? Obama has taken the position that the 2001 Authorization of Use of Force (“AUMF”) passed by Congress in the wake of the 9/11 attacks, as well as the 2002 AUMF against Iraq passed before that war provide him with the legal basis for further air strikes. None other than John Yoo, the famous ratifier of torture in the George W. Bush Administration, has rushed to Obama’s defense, claiming that Obama has all the legal authority he needs under the 2001 and 2002 AUMFs.

But the notion that these Authorizations support current military action against the Islamic State more than a decade after they were initially passed is highly flawed. The 2001 AUMF was specifically limited to terrorist groups that had planned or aided the 9/11 attacks. There is zero evidence (and no government official has yet argued) that the Islamic State is somehow tied to 9/11. The 2002 AUMF, which provided the domestic legal basis for the Iraq War, is also untenable as justification for this war as it was based on the purported “threat” posed by Saddam Hussein. Indeed, through his National Security Advisor Susan Rice, Obama himself called for the revocation of the 2002 AUMF in July, mere weeks before now claiming it as a renewed basis for the adventurism in Iraq.

The attacks are also bereft of any basis in international law. Under the United Nations Charter, a country may only use armed force against another country in self-defense, or when approved by the United Nations Security Council. There is no resolution that has authorized the US strikes in Iraq; and the notion that the United States must lob bombs into Iraq as a matter of self-defense is simply not credible.

While not made explicitly (at least not yet), the White House will likely rely on a tenuous theory in international law called the “responsibility to protect,” which argues that countries may involve themselves militarily in other countries in order to protect civilians or prevent other imminent humanitarian harms. This was the basis of the bombing campaign against the former Yugoslavia, which never had UN Security Council authorization. Obama’s current Ambassador to the United Nations, Samantha Power, is a well known advocate of this doctrine and she has recently argued that the US has all the legal authorization it needs for the air campaign.

But there is no basis in international law for such a theory, and more clear-minded observers have rightly concluded that the so-called “responsibility to protect” is a thinly-veiled excuse for Western meddling in countries thousands of miles away. As Antony Loewenstein notes:

We never hear any [responsibility to protect] backers pushing for a military intervention in Gaza to protect the Palestinians from Israeli missiles. Nobody is talking about protecting Egyptian civilians from the brutal, US-backed dictatorship in Egypt. Barely a word is raised to protect the repressed activists in Bahrain or Saudi Arabia. Whether it’s dressed up as solidarity, a responsibility to protect, or an intervention to prevent breaches of human rights, from Iraq to Libya these are grotesque experiments on helpless civilians, the conclusions of which are clear for us to see.

The Nuremberg Trials, which outlawed wars not conducted in conformity in international law, made no exceptions for “responsibility to protect,” and in fact labeled any war not conducted with a solid legal footing as the “crime of aggression,” considered the supreme international crime – largely because of the horrific consequences that take place when wars break out. Yet here, too, this White House has recently argued to the Northern District of California that the Nuremberg Trials are “irrelevant” to the determination of whether Presidents can be held accountable for their actions with respect to war and peace.

From a historical point of view, it is ironic that a young senator from Illinois who campaigned in large part agains the Iraq War and who showcased his credentials as a constitutional scholar would be the handmaiden of the permanent “state of exception” described by the National Socialist philosopher Carl Schmitt, who argued that sovereigns should have the right to suspend the legal and juridical constraints of their societies so that they may act outside of law. This is the opposite of the legal constitutionalism that forms the philosophical basis of the American legal order, which can be summarized with the words of Edward Coke: “The King himself should be under no man, but under God and the Law.”

Even six years later, the stings and scars of the Bush-era wars still haunt those who favor civilization over barbarity, and certainly continue to physically affect those who fought on either side, as well as the millions of civilians who always suffer when wars take place.

The failure of President Obama to seek a more rational foreign policy is a disquieting but important lesson:  those pressing for a lawful, constitutional government that resolves international conflicts instead of initiating them have far more work to do and cannot rely on the promises — falsely given — by politicians from any political party. The last Administration was wrong, but it was openly wrong and harbored no pretenses that it sought an imperial Presidency. In contrast, this Administration has cloaked itself in sanctimony even while consolidating the grave excesses of its predecessor. Both parties remain committed to imperialism and the wars that accompany them, or in the immortal words of Tacitus, writing two millennia ago of those who dismantled the ancient republic in Rome in order to create a dynastic and militant empire: “To ravage, to slaughter, to usurp under false titles, they call empire; and where they make a desert, they call it peace.”

D. Inder Comar is legal director at Comar Law. Comar Law is currently litigating a lawsuit against members of the Bush Administration for allegedly committing aggression against Iraq (Saleh v. Bush, N.D. Cal. Mar. 13, 2013, 13-cv-1124 JST). 

The Myth of Syria’s Moderate Rebels

September 22nd, 2014 by Stephen Gowans

Political Islam has a long history of cooperating with Western imperialism at certain times and in certain places, and of turning against it at other times and in other places. For example, Osama bin Laden cooperated with the United States to overthrow a progressive pro-Soviet government in Afghanistan, and then launched a jihad against the domination of the Middle East by the United States. Many Palestinians were sent to Afghanistan in the 1980s by the Muslim Brotherhood to struggle against the atheists in Kabul (much to the delight of Israel) only to return to join a Palestinian national liberation struggle against Israel in the ranks of Hamas.

What separates the rebels in Syria that the United States and its allies arm, train, fund and direct from those it seeks to degrade and ultimately destroy is not a secular vs. Islamist orientation. Even the so-called “moderate” rebels are under the sway of Islamist thinking. Instead the dividing line between the good “moderate” rebels and the bad “extremist” rebels is willingness to cooperate with the United States and the region’s former colonial powers. The “good” ones are under the control of the CIA and other Western intelligence agencies, or aren’t, but are working in directions that comport with Western foreign policy goals, while the “bad” ones are working in ways that frustrate the attainment of the foreign policy objectives of the West. In other words, one set of rebels is cooperating with Western imperialism while the other frustrates it.

The “moderate” Syrian rebels who US officials are counting on to battle the Islamic State as part of the Obama administration’s plan to degrade and ultimately destroy ISIS comprise dozens of groups which report directly to the CIA [1] and are under the sway of Islamist thinking. [2] According to General Abdul-Ilah al Bashir, who led the Free Syrian Army before its collapse at the end of last year, the CIA has taken over direction of the rebel force and FSA groups now report directly to US intelligence. [3]

The groups are run from military command centers in Turkey and Jordan, staffed by intelligence agents of the United States and the Friends of Syria, a collection of former colonial powers and Sunni crowned dictatorships. The command centers furnish the rebels with arms, training, and salaries. The United States provides overall guidance, while Turkey manages the flow of rebels over its border into Syria, and Saudi Arabia and other Persian Gulf states provide much of the funding. [4]

The centerpiece of the CIA-directed rebel grouping is the Hazm Movement, formerly known as Harakat Zaman Mohamed, or Movement of the Time of Muhammad. It is strongly backed by the Muslim Brotherhood, and by key Muslim Brotherhood supporters, Qatar and Turkey. [5]

The US-backed rebels cooperate with the Nusra Front, a branch of al-Qaeda operating in Syria, [6] which the UN Security Council denounced this summer along with ISIS for their “gross, systematic and widespread abuse of human rights” [7] but which the United States has left out of its war on the Islamic State, even though its origins and methods are the same as those of ISIS, and its goals similar. Accordingly, the al-Qaeda franchise in Syria will continue to coordinate operations with CIA-directed rebels, unhindered by US strikes.

Aron Lund, a Syria analyst who edits the Syria in Crisis blog for the Carnegie Endowment for International Peace, deems the idea of the moderate secular rebel a myth. “You are not going to find this neat, clean, secular rebel group that respects human rights…because they don’t exist.” [8]

Andrew J. Tabler, senior fellow at the Washington Institute for Near East Policy, who follows Syrian events, points out that most of the rebels backed by the United States come from “rural, Sunni areas where Islamist thinking has long held sway and often colors their thinking.” [9] They are not moderate fighters for secular liberal democratic values.

Veteran foreign correspondent Patrick Cockburn echoes these views. In his new book, The Jihadis Return: ISIS and the New Sunni Uprising (OR Books), Cockburn observes that there is “no dividing wall” between “America’s supposedly moderate opposition allies” and ISIS and the Nusra Front. [10]

While US officials and Western mass media promote a false narrative of two sets of rebels occupying opposite ends of two different axes—Islamist vs. secular and extremist vs. moderate—the most relevant axis may be one defining the groups’ orientation toward the West.

Reflecting the ideology of their al-Qaeda progenitor, the Nusra Front and ISIS seek to bring historically Islamic regions under Sunni Islamist political control, which means the ejection of the United States and its local marionettes, the destruction of secular regimes, and the elimination of local “heresies”, including Shia Islam and its heterodox Alawi offshoot, to which Syrian president Bashar al-Assad belongs.

The CIA-directed rebels, in contrast, appear to have a more moderate attitude to the United States, and are open to working with Washington and its Arab and NATO allies. Hassan al-Hamada, a leader of one of the CIA-directed rebel groups says, “We want to be hand in hand with the West, and for the future of Syria to be with the West.” [11]

The word “moderate,” then, appears to have but one meaning—a willingness to work with the United States, under the direction of the CIA, and in cooperation with Western imperialism…at least for now.

Notes

1. Patrick Cockburn, “Syria and Iraq: Why US policy is fraught with danger,” The Independent, September 9, 2014.
2. Ben Hubbard, “U.S. goal is to make Syrian rebels viable,” The New York times, September 18, 2014.
3. Cockburn.
4. Hubbard.
5. Suhaib Anjarini, “Harakat Hazm: America’s new favourite jihadist group”, Al Akhbar English, May 22, 2014.
6. Hubbard.
7. UN Security Council Resolution 2170 (2014). http://www.un.org/News/Press/docs/2014/sc11520.doc.htm
8. Ben Hubbard, Eric Schmitt and Mark Mazzetti, “U.S. pins hope on Syrian rebels with loyalties all over the map”, The New York Times, September 11, 2014.
9. Hubbard.
10. Belen Fernandez, “Book review: The Jihadis Return: ISIS and the New Sunni Uprising,” The Middle East Eye, September 3, 2014.
11. Hubbard.

The initial public offering (IPO) of shares in the Chinese Internet trading company Alibaba, which led to a frenzy on Wall Street last Friday, is the latest, and one of the most spectacular, expressions of the parasitism that is now the dominant feature of the global financial system and the world economy more broadly.

Initially priced at $68 per share, the stock began trading on the New York exchange at $92.70, with 100 million shares changing hands in the first ten minutes, before closing at $93.89. The 38 percent rise took the market value of the fifteen-year-old company to $231 billion, more than Amazon, Proctor & Gamble and JP Morgan.

The IPO reportedly made Jack Ma, the company’s founder, China’s richest man, with a net worth of $26.5 billion. It is hard to ascertain what is more repugnant: the scale of the plunder or the extent of the hypocrisy that accompanied it. Ma told the CNBC business TV channel that the issue was not money, but getting “trust from the people.”

Silver Lake Management, which focuses on trading in technology firms, reaped five times its initial outlay on Alibaba. Silver Lake bought into the company in October 2011 in a series of deals that put Alibaba’s market value at around $30 billion. At the end of Friday’s trading, it had reaped profits of $4.6 billion. Likewise, Yahoo stands to gain about $5.1 billion after selling its 121.7 million shares in the company.

The 35 underwriters of the deal collectively raked in around $300 million in fees, with five major banks securing about $45 million each.

The entire operation was a graphic demonstration of the putrefaction of the profit system. The IPO itself was an exercise in insider trading, with some 25 institutions securing more than 50 percent of the shares and the biggest portion of the profits on offer.

Fabulous fortunes were made in a matter of minutes as a result of share trading in a company that produces nothing, but is engaged in e-commerce, that is, facilitating buying and selling through the Internet. The naked display of avarice occurred under conditions of stagnation and slump in the real economy and relentless attacks on the conditions of workers, justified by the claim that “there is no money” for jobs, decent wages or basic social services.

The overall indebtedness of the city of Detroit, now in bankruptcy and at the centre of the assault on the working class, including the shutoff of water to thousands of households, is put at around $18 billion—less than the profits raked in during the first hour of trading in Alibaba shares.

The parasitism involved in the IPO is underscored by a consideration of why the “market value” of Alibaba is so inflated. It is not because it has developed some new form of technology, facilitated an important innovation, or brought forward a more advanced production technique.

Its attractiveness flows from its monopolisation of Internet services in China. It dominates operations that in other countries are run by different companies. It owns Chinese firms that are the equivalent of Amazon and eBay and earns money from transaction fees flowing from the Chinese equivalent of PayPal.

This monopoly position has been facilitated by the company’s close connections to the Chinese Stalinist regime. An article in the Australian Financial Review noted that Jack Ma had fostered “warm relations” with Chinese President Xi Jinping. “Truth be told,” the newspaper reported, “Alibaba couldn’t have reached the heights it already has without the support of the upper echelons of the Communist Party.”

This is a striking revelation of the role played by the Chinese regime in propping up world capitalism, with all its socially destructive consequences, and the global character of the international financial aristocracy.

The Alibaba IPO came at the end of a week in which a report by Wealth-X and UBS showed that the world’s billionaires had an accumulated wealth of $7.3 trillion, an increase of 12 percent in the last year. This increase of wealth at the very top is accompanied by worsening social conditions for the working class in all of the major capitalist centres. These are not parallel processes, but causally connected.

Since the eruption of the global financial crisis in 2008, the economic policies of the ruling elites have proceeded on two main lines: the supply of ultra-cheap money to the banks and financial institutions to finance speculation, and the driving down of the social position of the working class.

The connection between the two has again been illustrated. Within a day of the Alibaba IPO orgy on Wall Street, halfway round the world at a meeting of G-20 finance ministers and central bankers in Cairns, Australia, International Monetary Fund Managing Director Christine Lagarde insisted on the necessity for so-called “labour market” reforms—code words for the destruction of what remains of legal protections for workers.

The frenzy on the financial markets, the surge in corporate stock buybacks, IPOs and takeovers, and the return of the same practices that led to the crisis of 2008 are themselves expressions of the deep and ongoing crisis of the world capitalist system.

The euro zone economies are either stagnating or in outright recession, with production levels still below where they were in 2007. The Japanese economy has experienced no growth this year, despite the massive financial stimulus package carried out under “Abenomics.” Chinese growth is slowing, with mounting questions arising over the stability of the country’s financial system. The American economy has failed to return to anywhere near the growth levels reached before the financial crash.

In other words, money is pouring into the financial system because it has nowhere else to go. The rise of speculation, parasitism and the monopolisation of socially produced wealth by a money-crazed and semi-criminal elite are manifestations of the deep-going historical crisis of the capitalist economic order.

The Alibaba IPO exemplifies the manner in which the capitalist market and monopoly domination turn the Internet, a technological advance that potentially opens up vast prospects for social advancement, into a means for generating fabulous wealth for a mere handful. It is another demonstration of the necessity for the complete overturn of the profit system and the reconstruction of the global economic order on socialist foundations.

Obama Marshals Allies for War on Syria and Iraq

September 22nd, 2014 by Peter Symonds

In the lead-up to this week’s UN General Assembly meetings, the Obama administration is engaged in an aggressive political campaign to justify and marshal support for the extension of its war in Iraq into Syria. Under the pretext of “degrading and destroying” Islamic State of Iraq and Syria (ISIS) militias, the US is engaged in an illegal war of aggression with the objective of ousting Syrian President Bashar al-Assad.

Claims by American officials that Washington has the support of 40 countries cannot obscure the fact that this is another US war based on lies, and in flagrant breach of international law. US warplanes have carried out more than 160 air strikes inside Iraq after being invited to do so by its puppet regime in Baghdad, and its aircraft and drones have already carried out reconnaissance inside Syria. Washington has arrogated to itself the right to conduct air strikes inside Syria, despite the expressed opposition of the Syrian government.

Speaking on the ABC’s “This Week” program last night, US ambassador to the UN, Samantha Power, declared that the US had the “legal basis” for waging an air war on Syria and that there was “universal support” in the international community for attacking ISIS. In fact, Washington lacks even the fig-leaf of a UN resolution to legitimise its new war. When Obama chairs a special UN Security Council session on Wednesday, he is unlikely to seek a resolution supporting air strikes on Syria, as Russia would veto it.

Power made the absurd assertion that military aggression against Syria was justified because Iraq had requested it. “The Iraqis have appealed to the international community to come to their defence not only in Iraq, but also to go after safe havens in foreign countries. And what they mean of course is Syria. And they’re quite explicit about that,” she said. Such “requests” could be engineered to justify an aggressive war against any country in the world.

Power insisted that the US had commitments from allies to join the air war on Syria, but declined to name them. Only two countries—France and Australia—have sent war planes. France carried out air strikes on ISIS targets inside Iraq on Friday, but has ruled out doing so in Syria. The Australian government has dispatched fighter jets and hundreds of military personnel to the Middle East, but has given no public commitment to attacking Syria.

While focussing on ISIS atrocities in a bid to gather support for its war, the Obama administration is already laying the groundwork for moving against Assad. US Secretary of State John Kerry yesterday again accused the Syrian regime of using chemical weapons against civilians. He seized on a report by the Organisation for the Prevention of Chemical Weapons, claiming that it “strongly points to Syrian regime culpability” in the use of chlorine gas. In fact, the report did not assign blame. The Assad government, which has denied any involvement, has far more to lose in carrying out such attacks than the various anti-government militias that are seeking US support.

Likewise, US allies Turkey and Saudi Arabia, which have helped arm and finance right-wing anti-government militias, including ISIS, inside Syria, are now using the Islamic extremists they helped create as a tortured argument for removing Assad. At the UN last Friday, Turkey branded the Syrian regime as a “patron of extremism,” while the Saudi ambassador declared: “ISIL [ISIS] and the Syrian regime are but different sides of the same coin.”

The White House might not be explicitly targetting Assad at present, but other American commentators are. Anthony Cordesman, a prominent strategic analyst with the Center for Strategic and International Studies (CSIS), left no doubt in a comment last Friday that the war “is not a fight directed at Islamic State alone in Syria.” The defeat of ISIS would “leave Syria divided between an Assad regime that has managed to create even more casualties, human suffering and repression than the Islamic State… and some warring rebel faction in the East.”

Other figures in the US foreign policy and military establishment were even more open. Speaking on CBS, former deputy CIA director Mike Morell declared:

“Assad is the key problem here, supported by Iran and supported by Russia. I would support going after him and his leadership team aggressively. But I don’t want to do it in a way that degrades the Syrian military, the Syrian security service, and the Syrian intelligence service because they need to be able to bring stability to that country when Assad goes.”

Morell’s comments underscore the fact that the renewed regime-change operation against Assad is also aimed against its backers—Iran and Russia. The Obama administration shelved its plans for an aerial blitzkrieg against Syria last September in the face of widespread public opposition, disagreements in ruling circles and Russia’s opposition to the war. In the aftermath, the US, in league with Germany, engineered the fascist-led coup in Ukraine in February and a confrontation with Russia, in order to integrate Eastern Europe further into the NATO alliance and weaken Moscow.

Now the Obama administration has launched a new war in the Middle East aimed at removing Russia’s only regional ally and consolidating its own hegemony. Such a conflict threatens to embroil not just Syria and Iraq but the wider region and to drag in other powers, such as Russia, whose interests are under threat. Moreover, the war will require a far greater US military commitment, despite Obama’s denials that American troops will be involved in combat.

Central to Cordesman’s comment was the need to put US troops on the frontline as “advisers and enablers” of Iraqi forces and anti-Assad militias in Syria. While not currently advocating the use of “major combat units,” he insisted that it would require “a limited number of US ‘boots on the ground’ that will effectively be in combat to make the difference.” The “limited number” would “almost certainly need [to be] something more than the 1,400-odd US troops now assigned to these missions.”

174 Palestinians Kidnapped in One Week

September 22nd, 2014 by Tony Seed

File – Image By Palestinian Prisoners Society

The Palestinian Prisoners Society (PPS) reported on September 14 that Israeli soldiers kidnapped 174 Palestinians in the occupied West Bank, in the second week of September, 2014.

The PPS added that most of the kidnappings were focused in the northern West Bank district of Jenin with 69 arrests in different parts of the district.

It added that the soldiers also kidnapped 40 Palestinians in the southern West Bank district of Hebron, 12 in Bethlehem, 17 in Ramallah, and 10 in occupied Jerusalem.

Four more Palestinians have been kidnapped in the Nablus district, four in Qalqilia, five in Tulkarem, while 13 Palestinians have been kidnapped in Tubas and Salfit, in Central West Bank.

There are approximately 7000 Palestinians who are currently held by Israel in 17 prisons and detention camps.

Among the detained Palestinians are 75 Palestinians who have been kidnapped after being released under the Shalit Prisoner Swap Agreement.

30 detainees have been imprisoned since before the First Oslo Agreement of 1993; the longest serving detainee is Karim Younis, who has been imprisoned since at least 32 years.

They were supposed to be released back in late March, but Israel violated its own vows to release them under the fourth and final phase of releasing all veteran detainees.

Information on Palestinian political prisoners held by Israel:

1. 477 detainees are serving life terms.

2. 19 female detainees are currently imprisoned; the longest serving of them is Lina Jarbouni who was taken prisoner more than 12 years ago.

3. 250 Palestinian children are still imprisoned by Israel.

4. 500 detainees are currently held under Administrative Detention orders without charges or trial.

5. Six elected former government ministers are still imprisoned by Israel.

6. 36 elected legislators are still imprisoned by Israel.

7. 1500 detainees suffer with various illnesses, and serious conditions, including cancer, heart conditions, and liver diseases, and paralysis. Fourteen of them permanently staying at the Ramla Prison Clinic that lacks basic supplies.

8. 205 detainees died in Israeli prisons since 1967, due to torture, medical neglect, and due to being shot and killed by the arresting officers or while in prison.

9. Dozens of detainees died shortly after their release due to diseases they contracted in prison, and were not provided the needed medical attention.

www.imemc.org/article/68977

by Lilian Rosengarten

“I need to say again, as a Jew and refugee from Nazi Germany  I am ashamed of Israel, a country I once hoped to love.  Zionism  has succeeded  to activate the rise of anti-Semitism, a result in my view of a grisly, brutal agenda of ethnic cleansing, , apartheid and human rights crimes against Palestinians.”

A submarine, the biggest  ever constructed in Germany is being delivered to the Israeli Navy that has the capacity to carry a nuclear weapon. The cost is more than 1 billion Euros, 33%  has been covered by the German government. This is the 4th German built submarine delivered. That it was built by the Thyssen Krupp marine builders is an odd twist of fate. Krupp Industries employed workers conscripted by the Nazi regime from across Europe. These workers were initially paid, but as Nazi fortunes declined they were kept as slave workers.  Krupp industries was prosecuted after the end of war for its support to the Nazi regime and use of forced labour.(Wikipedia) In 1997 a takeover created Thyssen Krupp Stahl AG. That Krupp industries employed workers forced to work for the Nazi Regime across Europe and to served Hitler in his war against Jews and other “undesirables” underlies an important question. How do we understand Germany’s surreal behavior as it supplies massive U Boats built for war to Zionist Israel? What ambivalence and hidden motives must feed into Germany’s relationship to Israel?

Surreal, terrifying. The nightmare from which I cannot wake is the shame I feel as a Jew to be witness once again to Nationalism and racism in the form of Zionist Israel’s crimes against Palestinians as well as blind collaborative support  of Israel by the US and Germany in particular.  Of course, this support is misdirected for to support genocide is a crime itself.  What drives them in this misguided blindness?  Of course we cannot exclude enormous financial gains in the business of war games that offer enormous monetary wealth through the killing machines. What existential fears create such a corruption of alliances as well as the destruction of the entire Middle East by NATO with the US at its helm. It goes on, reignited again at this moment to fight some other “terrorist” phantom.

I received a report from the Daily Beast It says:  (Nico Hines and Sami Yosafzai  8/11/14)

Obama’s Pentagon Covered Up War Crimes in Afghanistan, Says Amnesty International

“The human-rights group reports the U.S. military systematically ignored evidence of torture and unlawful killings in Afghanistan as recently as last year.”

The U.S. military has systematically covered up or disregarded “abundant and compelling evidence” of war crimes, torture, and unlawful killings in Afghanistan as recently as last year, according to a report by Amnesty International published today in Kabul.

Shameful and not surprising that a nation capable of such evil, can without much conscience support evil.

Germany on the other hand appears to continue to carry leftover guilt of crimes against Jews. That this may be true indicates how the Holocaust has been transformed into big business, a black mark on the memory of the Nazi Holocaust as well as a betrayal of what it means to be Jewish.

I need to say again, as a Jew and refugee from Nazi Germany  I am ashamed of Israel, a country I once hoped to love.  Zionism  has succeeded  to activate the rise of anti-Semitism, a result in my view of a grisly, brutal agenda of ethnic cleansing, , apartheid and human rights crimes against Palestinians. In addition, it has  created  the completely false and destructive label of “anti-Semite “ to those who resist. We see evidence of  “domestic terrorism,” that is  the use of the Nazi Holocaust to create fear and guilt in populations that have an emotional connection and a fear of the  rise of Nazism once again. Insanity is what comes to mind. A twisted ideology  arising from  generations of paranoia , wounds not healed and a Zionist belief  in exceptionalism, better than, superiority, that which lends itself to racism. It is important to reiterate , Zionism and  Judaism have no connection. One is a nationalistic political movement, the other a religion.  It is Zionism that propels the Israel/Palestine into the fantasy of “Jewish State Only.” If there is to be a Democratic Israel/ Palestine, Zionism must cease to exist.

Lilian Rosengarten, author “From The Shadows Of Nazi Germany To The Jewish Boat To Gaza:” translated into German, “ Ein bewegtes Leben von den Schatten Nazi-Deutschlands Zum judischen Boot nach Gaza (Zambon).  Contact : [email protected]

Copyright Lilian Rosengarten, Intifada, 2014

Michael Hayden, the former director of the National Security Agency, has  invaded America’s television sets in recent weeks to warn about Edward Snowden’s leaks and the continuing terrorist threat to America.

But what often goes unmentioned, as the Guardian’s Glenn Greenwald pointed out, is that Hayden has a financial stake in keeping Americans scared and on a permanent war footing against Islamist militants. And the private firm he works for, called the Chertoff Group, is not the only one making money by scaring Americans.

Post-9/11 America has witnessed a boom in private firms dedicated to the hyped-up threat of terrorism. The drive to privatize America’s national security apparatus accelerated in the aftermath of the terrorist attacks, and it’s gotten to the point where 70 percent of the national intelligence budget is now spent on private contractors, as  author Tim Shorrock reported. The private intelligence contractors have profited to the tune of at least $6 billion a year. In 2010,  the Washington Post revealed that there are 1,931 private firms across the country dedicated to fighting terrorism.

What it all adds up to is a massive industry profiting off government-induced fear of terrorism, even though Americans are more likely to be killed by a car crash or their own furniture than a terror attack.

Here are five private companies cashing in on keeping you afraid.

1. The Chertoff Group

Photo: Youtube

On August 11, former NSA head Michael Hayden, the man at the center of the Bush administration’s 2005 surveillance scandal, was defending his former agency on CBS News in the wake of the latest NSA spying scandal. Commenting on President Obama’s half-hearted promises to reform some NSA practices, Hayden told host Bob Schieffer that “the President is trying to take some steps to make the American people more comfortable about what it is we’re doing. That’s going to be hard because, frankly, Bob, some steps to make Americans more comfortable will actually make Americans less safe.”

Former Homeland Security chief Michael Chertoff had a similar message when he appeared on ABC News August 4. Speaking about the purported threat from an Al Qaeda affiliate in Yemen that led to the closure of 19 U.S. embassies, Chertoff said that “the collection of this warning information [about Al Qaeda] came from the kinds of programs we’ve been discussing about, the ability to capture communications overseas.”

CBS and ABC did not see fit to inform viewers that both Hayden and Chertoff are employees of the Chertoff Group, a private firm created in 2009 that companies hire to consult on best practices for security and combatting terrorism. Some of the companies the firm advises go on to win government contracts. Chertoff is the founder and chairman of the group, while Hayden serves as a principal. So they profit off a war on terror they say is crucial to keeping Americans safe.

Though it’s unclear how much in total exactly the firm makes, there are some known numbers. After the failed attempt in 2010 to blow up an airliner on Christmas Day with a bomb hidden in underwear, Chertoff pushed for better airport security procedures. One of the suggestions Chertoff made was for the Transportation Security Agency to use full-body scanners like the ones Rapiscan, one of the Chertoff Group’s clients, made. And sure enough, after the Christmas Day plot, the TSA ordered 300 Rapiscan machines.  The Huffington Post reported that Rapiscan made $118 million from the government between 2009-2010.

2. Booz Allen Hamilton

Photo: The Guardian

This private intelligence contractor has become a household name in the wake of the NSA scandal. Edward Snowden, the man responsible for leaking secret documents that exposed the breadth of NSA surveillance, was working for Booz Allen when he downloaded the documents he handed off to media outlets. As the New York Times reported in June, the company parlays its technology expertise for intelligence uses into massive government contracts. Thousands of employees of the company provide services to the NSA, like analyzing the massive amounts of data the government agency collects every day. The company is also the shining symbol of the government-private security complex’s revolving door: its vice president is the former director of national intelligence, while the current director of national intelligence is a former employee of Booz Allen.

Despite the Snowden security breach, Booz Allen continues to work with the government. And they’re making a lot of money from the U.S. In the last fiscal year, the company made $1.3 billion from working in U.S. intelligence. In total, Booz Allen Hamiltion made over $5 billion last fiscal year. And the cash keeps coming: in January, the company announced that it had won a contract with the Defense Department to provide intelligence services. The amount of money it could make from the deal is up to $5.6 billion.

And like Hayden and Chertoff, Booz Allen’s vice president Mike McConnell has publicly hyped up the threat of terrorism to blast Snowden’s leaks. McConnell told a government contracting conference in July 2013 that Snowden’s leaks have done  “irrevocable damage” to the U.S.’s ability to stop terrorism. “It’s going to inhibit our ability to understand nuclear activity in North Korea, what’s going on in Syria, what might be happening with the Taliban in Afghanistan,” said McConnell.

3. Science Applications International Corporation

Sometimes referred to as “NSA West” because so many former NSA employees go on to work for the formerly California-based Science Applications International Corporation (SAIC), this firm makes a ton of cash off government contracts. And they do so by hawking their expertise in combatting the terrorist threat.

Photo: Forbes

Browse through SAIC’s website and you’re constantly greeted with the words “terrorist threat” and information on how the SAIC can help the government and others battle it. SAIC developed a “Terrorism Protection Manual” for Florida law enforcement that was  developed to fight “today’s national terrorist threat and implement recommended security best practices.” They  boast of their “experience meeting the terrorism incident response training needs of a wide variety of customers, from training for a national Weapons of Mass Destruction (WMD) scenario, applicable at agency response levels, to lesser levels of incidents affecting a city, a military installation or a special facility.”

Back when John P. Jumper, the current CEO of SAIC, was an Air Force general, he said the threat of terrorism is “greater than Nazism, greater than communism. This threat that we have of terrorist zealots is the most dangerous because these are people who care nothing about life. They care nothing about our lives, for sure, and they care nothing about their own lives.” And Larry Prior, a U.S. intelligence veteran who used to run the company’s Intelligence and Security Group, said in an internal newsletter that “the future of the nation rests on their backs,” referring to employees in his group.

SAIC is an immensely lucrative and large company. It boasts 42,000 employees—20,000 of whom hold U.S. government security clearances. It is the NSA’s largest contractor,  according to CorpWatch, and is deeply involved in the NSA’s collection of intelligence. Last year it reported a net income of $525 million.

4. Center for Counterintelligence and Security Studies 

U.S. intelligence agencies aren’t the only sectors of government where the private sector has cashed in on the fear of terrorism. The post-9/11 world has seen the blossoming of a cottage industry of self-styled “experts” on Islam from private companies that market their supposedly ironclad analysis of the threat from Islamists to other federal agencies and state and local law enforcement. These companies have profited from law enforcement taking part in the “war on terror.”

Photo: Flickr

Through Homeland Security grant programs like the State Homeland Security Program and the Urban Areas Security Initiative, the federal government has doled out over billions of dollars to these private companies to provide Islamophobic training. One of these companies is called the Center for Counterintelligence and Security Studies.

Based in Virginia, the center “posits radical Islam as a new global ideological menace on the order of the old communist threat from the Soviet Union,” asPolitical Research Associates (PRA) noted in a 2011 report on private firms doing counter-terror training. Staff members include former FBI, CIA and Defense Department personnel.

Their claim to fame is providing education and training to members of the U.S. national security community—including law enforcement agencies, according to their website. They say they have trained over 67,000 people over the past decade.

It’s unclear exactly how much this firm makes per year. But according to the PRA report, a five-day course for government employees on the “Global Jihadist Threat Doctrine” costs $39,280. The firm also lists the costs of individual courses on their website. For a 30-person class titled “Dying to Kill Us: Understanding the Mindset of Suicide Operations,” the cost is $7,856. For a three-day course for 30 people on “Informant Development for Law Enforcement to FighTerrorism,” the cost is $23,568.

The training pushes anti-Muslim ideology. On the section of their website where they list feedback from participants of the courses, one wrote: “An eye-opener. Especially how many Muslim Brotherhood front organizations there are and that the government doesn’t get it.”

5. Security Solutions International

Security Solutions International is yet another private firm hawking anti-Muslim training to law enforcement. This Miami-based company founded in 2004 uses its Israeli security connections to boost its standing in the market. They use Israeli security trainers in their courses and their president,  Henry Morgenstern, is a dual Israeli-U.S. citizen who says he “developed excellent high level contacts with the Security Establishment [in Israel], making SSI the premiere training company for counter-terror related subjects.”

Photo: Military 1

The company has trained over 700 law enforcement agencies since 2004. Officials from law enforcement agencies like the Massachusetts Bay Transportation Authority and the Department of Homeland Security have participated in the conferences they put on for profit. While SSI claims that they don’t cast aspersions on the whole of Islam, an examination of their trainings, conferences and the speakers they use indicate otherwise.

At a 2009 conference sponsored by Police magazine, an SSI instructor who is the company’s “expert” on Islam used a video that showed a terrorist beheading a hostage. After the course was met with criticism, the company’s CEO said “their religion got linked to terrorism a long time ago.”

The conferences they hold are usually well-attended, and this year SSI is putting on a conference in Orlando, Florida for three days. The  cost for each attendee is $400. The keynote speaker this year is Steve Emerson, a well-known member of what’s been termed the “Islamophobia industry.” SSI also makes money off its Counter Terrorist magazine. A yearly subscription is $35, and the company says it has 15,000 subscribers.

Original: Colonel Cassad LiveJournal
Translated by Daniil Mihailovich / Edited by @GBabeuf 

Preamble: In the midst of a failing ceasefire, punctuated by regular breaches on the part of the Ukrainian Army and Kiev’s punitive battalions, it is important to reflect on the military situation in Novorossiya on the eve of the implementation of the Minsk Protocol. We trust that this note will permit readers to reflect on the changes at the front that we have been witnessing. It is also a good reference point to enable one to guard against revisionism.

The Novorossiya Armed Forces were on the brink of an important military victory before the ceasefire froze the hostilities in a much less favourable status quo, allowing Ukraine to re-establish a meaningful front-line; to reinforce key positions in preparation for an all-out assault that everyone is able to anticipate; to rearm and to replenish its troops. A comparison of the map below with more current versions is very instructive in this regard: and while it may be argued that the additional territory shown here under the control of the NAF was never securely held or that the NAF were thinly stretched, this ignores the very real disarray that was spreading in the enemy’s ranks as far afield as Zaporozhie.

The days leading up to September 1, 2014 clearly demonstrated the consequences of the Junta’s Southern Front disaster.

1. The Militia’s offensive south of Donetsk continues to gain ground. The Junta simply has no forces here to close a huge gap that stretches from Georgiyevka and Karlovka to the Azov Sea. All available forces were sent to defend Mariupol, and to the front-lines west of Donetsk—to prevent a cleaving strike through Selidovo on Krasnoarmeysk and Konstantinovka. Such an attack could lead to a deep encirclement of the Junta forces besieging Donetsk.

[3]

There are simply no available forces to cover this huge hole in the front, so here the Novorossiya Armed Forces (NAF) simply move forward, held up only by its own lack of forces and the necessity of controlling the territory already captured. In essence, only the weakness of the NAF transforms the catastrophe unfolding right before our eyes into a drawn-out process. For example, if the mechanized brigades of the Russian Army were advancing here, then they could have used this operational void to break through all the way to the Dnieper River relatively unhindered—there would have been nothing to stop them. Nevertheless, it is expected that in a few days the Army of Novorossiya will begin encountering some hastily created screens that are supposed to slow down the unfolding of the catastrophe in this area. Also, this week, two or three reinforced, armoured battle-groups are expected to enter combat on the Junta’s side. The remains of the Junta forces by Dyakovo and Ilovaysk are doomed, very few fighters will be able to get out. Needless to say, the NAF will continue to accumulate a lot of trophies.

[4]

By now, the NAF have essentially put Mariupol under operational encirclement. The morale of the encircled troops is low, support of the population is about sixty to forty in our favour (among the politically active residents). The hopes for a naval supply were dashed by the attacks on border-guard boats at sea near Mariupol. This suggests that a complete blockade of the city was planned and that the capture of Mariupol is one of the priority goals. At the same time, the NAF can use this blockade to their advantage—they are now free to deploy their sabotage-reconnaissance groups (SRGs) towards the outskirts of Berdyansk and on the territories bordering Zaporozhie. In essence, there is continuous probing to determine the future directions for further advance—reinforced SRGs and some of the NAF redeploying to the area now will advance where there are no enemy forces, or where the enemy forces are weakest.

 

[5]

One can say that the NAF are currently emulating the tactics of the Junta forces from July and the first half of August, when the Junta similarly looked for gaps in the Militia’s lines and advanced their mechanized groups and SRGs into those gaps. This tactic has already achieved a new operational encirclement of the Junta’s forces: a so-called Volnovakha cauldron has emerged. A semblance of a front-line between Volnovakha and Maryinka collapsed once again, and now the enemy will have either to break out with major losses or, once again, surrender vehicles in order to save personnel.

[6]

Overall, the offensive is developing very successfully here, which influences the situation on the other Novorossiyan fronts. The rout of the Junta’s South Front is equivalent to the Stalingrad defeat of Nazi Germany—the war may continue and it may do so for a while yet, but it is clear that the Junta’s war machine is breaking down and it will no longer be able to achieve a military victory. The tide has turned, and the destruction of Novorossiya is no longer possible.

[7]

2. The rout of the Junta’s South Front forced it to not only pull all reserves up to the breakthroughs south of Donetsk, but also to withdraw forces that were wedged into the NAF positions elsewhere. The Junta had already begun withdrawing forces from Donetsk Airport. It is still partially held for now, but will clearly be abandoned within a week. There is absolutely no sense in keeping hold of this protrusion—it is no longer useful as an airport (both sides damaged it quite heavily) and it lost its meaning as a bridgehead for offensives against Donetsk a week ago, when the front to the south of Donetsk disintegrated.

[8]

The fierce resistance encountered there is only a sign of the Junta’s operational impotence in this area, as the previous assault on Donetsk from the North ran out of steam on the streets of Yasinovataya and in the north-western suburbs—although there was a moment when the NAF were quite pessimistic about the prospects for repelling that offensive. These days, a timid strike by the Junta towards Yasinovataya was a shadow of what it once was—it ended up weak and futile; the NAF did not even have to pull serious forces from the South to parry it.

[9]

Opening up a corridor out of the encirclement near Yelenovka allowed the Junta to save a part of the encircled forces, but, at the same time, led to losses in materiel and the abandonment of important positions that were essential for shelling Donetsk. The Junta group holding Debaltsevo is in a precarious position, as the NAF strikes towards Svetlodarsk unambiguously suggest an intention to encircle all of the Junta forces in the area of Debaltsevo and Uglegorsk, instead of attacking them head-on. The Junta faces an unpleasant choice: either it will have to abandon Debaltsevo and Uglegorsk voluntarily and retreat to Svetlodarsk, or it will persist in defending it, risking the formation of a Debaltsevo cauldron within several days. Overall, the enemy will be gradually driven off from the positions north of Donetsk, too. Approximately in seven or eight days the shelling of Donetsk should cease, and the capital of Novorossiya will then no longer be a front-line city.

[10]

3. The NAF in the Stakhanov/Alchevsk area are still on the defensive, due to a lack of available armour and artillery. They are trying to pin opposing enemy forces in place and are using SRGs to conduct armed reconnaissance in the direction of Severodonetsk and Slavyanoserbsk. Overall, the Ghost Brigade of Alexey Mozgovoi holds the front-line here, allowing the NAF to perform offensive actions in the vicinities of Donetsk and Lugansk.

[11]

However, if additional forces are redeployed to the area of Gorskoe (two to three armoured battle-groups and up to a battalion of infantry with the support of MLRS and tube artillery), the NAF would be quite capable of conducting a strike towards Severodonetsk and Lisichansk. But it is more probable that, while the cauldrons elsewhere are being finished off, the militia here will remain on the defensive.

[12]

4. To the south of Lugansk, the enemy began retreating from Lugansk Airport and is close to being routed; Lutugino is being abandoned as well. In essence, a “wandering cauldron” is forming here, and it will have a very hard time returning to its own side because there is not much to relieve it from the North. The Junta pointlessly wasted the majority of its tanks here in July and August, and the last remaining combat-ready units were ground to dust in heavy fighting by Khryashevatoye and Novosvetlovka. Of course, the fighting here won’t stop immediately—but the retreat from the airport is a clear indication that taking Lugansk is no longer on the agenda. The retreat from Khryashevatoye and Novosvetlovka and the withdrawal from the airport put an end to the Junta’s ambitious plan of encircling Lugansk.

[13]

The fighting in Stanitsa Luganskaya—still partially controlled by the Junta—certainly prevents the NAF from putting more pressure on the encircled troops south of Lugansk. However, this only slows down events without changing their overall course. Having lost aerial superiority in this area, and having lost the majority of tanks and Infantry Fighting Vehicles (IFVs) on the roads near Lugansk, Junta forces north of Lugansk will be forced to maintain a passive defence. Meanwhile, the stragglers to the south of Lugansk will continue their attempts to break out. This will continue until the NAF clears everyone to the south of Lugansk, accumulates sufficient forces and strikes at Shchastye or, bypassing it, Novoaidar.

However, due to the organizational weakness of the LPR and the issues with joint command (some of the commanders continue to fight independently), the offensive here is proceeding fairly slowly, even though the configuration of the front-lines favours routing the Junta.

[14]

5. In general, the military situation is currently favourable for us. The inertia of the offensive and the configuration of the front-lines allows us to expect new tactical and operational successes in the coming days, as well as further losses of personnel and vehicles for the Junta. In light of the Junta’s losses and of the newly won trophies of the Militia (plus the work of the “military surplus store”), and also in the light of the influx of volunteers, the ratio of forces continues to improve.

[15]

Currently, due to its losses, the Junta can deploy no more than forty thousand soldiers against the twenty-nine to thirty-three thousand NAF soldiers. The Junta’s advantage in vehicles is currently no more than two-fold, at best—perhaps even less than that. The Junta’s air force continues to suffer catastrophic losses. Overall, over the last two months of its offensive, the Junta was stripped of its overwhelming advantage in personnel and vehicles, lost its aerial superiority, and now has effectively no significantly greater number of tubed and rocket artillery than the Militia.

[16]

The current trend is that, consequent upon the collapse of the Junta’s Southern Front, the majority of the Donetsk People’s Republic (DPR) will be liberated and combat will commence in the Zaporozhie region. That is to say, combat may soon enter enemy territory that was never originally under the control of the DPR and the LPR.

[17]

6. With respect to politics, backstage dealings about the future of Novorossiya continue. It is already obvious that Novorossiya will exist. Yesterday’s news sensation—that the leadership of Novorossiya is ready to agree to a “United Ukraine”, suggests that the party of “Greater Transnistria” is not abandoning its attempts to limit the results of the rebellion to the territory of the DPR and the LPR. This party continues to inject provocative ideas into the Russian media in order to discredit the leadership of the people’s republics. The latter obviously cannot go against the sentiments of the soldiers and residents of Novorossiya, who are determined to exit Ukraine altogether.

[18]

Nevertheless, it is clear that sooner or later it will come down to negotiations, and so it is critically important that the Army of Novorossiya capture as many cities and districts of the former Ukraine as possible, in order to ensure a more comfortable position in such negotiations. Frankly, continuing the war is beneficial for us, because currently it appears that the Junta will continue to lose more and more ground. For now, the negotiations need to be delayed or disrupted. The fact that the Junta is unwilling to negotiate is actually positive, because this can be used to prevent them from obtaining some kind of at least “honourable peace”.

Judging from official and unofficial announcements, though, the enemy increasingly understands that this war cannot be won and that it is necessary to save that which can still be saved.

[19]

In general, the war will be won by us, and Novorossiya will exist within some as yet undetermined borders, as a rather large unrecognised state. Thus, those who aided our struggle can already feel their involvement in our common victory, which is now assured.

Post Scriptum: A significant number of photos of captured and destroyed vehicles and various trophies.

The Guardian’s resident “Marxist” Richard Seymour has provided us an opportunity to briefly expand upon the prevalent Orientalist narrative oozing throughout the vast majority of modern Western commentary on the Arab and Muslim world.(1)

To frame his latest feebly ambiguous opposition to NATO-bombs on Iraq, Seymour invokes a typically obsfuscating perspective from “muted parts of the Left”. In these unspecified sectors of wrongheadedness, according to Seymour, “Leftists” are apparently in reluctant agreement with the recently commenced American airstrikes in Iraq – likely to extend into Syria –  ostensibly aimed at the fundamentalist insurgency, morphed into an existential threat now known as the Islamic State.

Precisely who these “Lefts” are, and what exactly constitutes their political persuasions within an ever-growing and ever-politically abstract demographic of Western “Lefts” remains a mystery. Are these “Lefts” Marxists, Social Democrats, Liberals, anti-imperialists? Or perhaps imperial core opportunists such as the “socialist” cheerleaders for NATO’s destruction of Libya? Who knows, but the desired effect of endowing these pro-NATO characters so terrified in their suburban dwellings of the ISIS monster – “under their skin, infesting them” – with the abstract title of “Left” allows Seymour to portray them, and their pro-imperialist, pro-war, white supremacist “fear” of the Other Barbarian, their irrational and wholly uninformed “reason” for supporting the civilising mission, as something sensible, something to be quietly debated over a frappaccino slouched on a corduroy Starbucks sofa – as opposed to being vehemently rejected.

Of course Seymour’s pro-war “Lefts” are entirely fictional and built to provide him the opportunity to give his petty bourgeois white western liberal readership the luxury of self-identifying as the all-encompassing benevolent “Left”, while massaging their culturally racist affection for the fantasy of the Noble White Crusader destroying the Evil Arab Savage.

The principle that domination is indeed the ultimate motive of imperialism isn’t really touched upon, no totality of analysis is even attempted. Seymour may perhaps believe, as appears do his “Left” subjects, that US imperialism perceives ISIS – a paramilitary organisation the US itself played the principle role in creating and empowering(2)- as an imminent threat, rather than the reality of a strategic boon(3), and is intent on pursuing its God Given altruistic mission of Vanquishing Evil for the good of all mankind – humanitarian intervention(R2P). But surely no serious Marxist would entertain such subjectivist nonsense. Nevertheless, rather than expose this Orientalist spectacle and the civilising mission pretext it now affords imperialism, Seymour instead opts to furnish it, and proceeds to form his reductive analysis and “explanations” for the Islamic State with idealistic twaddle and Western media’s false premises.

The explanation then, for this somewhat rationalised “Left fear” and consequent support for American imperialism are the “monsters” of ISIS, and by offering this explanation all Seymour achieves is to justify the racist ideology underlying his Western “Lefts” agitprop-incited fear of ISIS and the false altruism masking Western imperial machinations. Of course as any serious analysis shows, the West has no real intention of destroying its Frankenstein ISIS, but merely corralling and manipulating it toward meeting strategic objectives.(4)

But how has this organisation of “monsters” come to be? And how has it been able to engender this supposedly justifiable fear within Seymour’s “muted Western Left”? First and foremost, according to Seymour, is the organisations apparent “widespread support within much of the population it seeks to rule”, support “gained on the basis of vicious sectarianism”.

“..whereas the jihadi ultras of the “war on terror” era were an unpopular, marginalised minority within the Iraqi resistance, always fought and opposed by the mainstream of the Sunni Arab insurgency, Isis succeeds because of the support it enjoys within much of the population it seeks to rule. And this support, be it noted, is gained on the basis of vicious sectarianism.”

And the alleged reason for Seymour’s assertion of widespread support is nothing but a regurgitation of US State Department propaganda, “President [sic] al-Maliki’s repression of Sunni Arabs is now driving an insurgency against his rule, from which Isis is gaining” says Seymour, and this one-sided repression is quite literally all that is offered as explanation for the rise of ISIS.

For at least 8 years, the US, and its Gulf Cooperation Council clients – primarily Saudi Arabia – have led a policy of bolstering “Sunni”(5) militants in the region to incite sectarian aggression against the perception of an expanding “Shia crescent” consisting of Iran, Syria and Hezbollah.(6) No account or even acknowledgement of this – the crucial context for the US’ latest bombing campaign and wider imperial strategy – appears in Seymour’s article. Not a single mention of the three-year NATO/GCC sponsored Wahhabi insurgency across the border in Syria, nor any word on tens of thousands of foreign fighters, thousands of tons of arms and billions of dollars thrown at ISIS and its intermittent “moderate rebel” allies and competitors.(7) Through this sweeping omission of vital historical context, Seymour’s analysis erases the concrete reality of the policy it purports to examine and instead relies on the rhetoric and propaganda of the spectacle being used to further it.

American or British bombs seem to offer a tempting short cut. This is what has always given “humanitarian intervention” its compelling ideological power: while we as citizens watch in horror, we know that there are powerful people in the world who could stop this without breaking a sweat.

Seymour thus successfully reduces the antagonism into an ahistorical idealist binary of a Sunni-Shia divide in Iraq, through which alleged Shia repression of the Sunni community has resulted in the “natural expression” of the Other: the Savage ISIS. Yet this crass assertion isn’t backed up by a single piece of evidence, it is undoubtedly based on the wretched reporting of Western media and the fantasies promoted to obscure ISIS’ material causes and real sources of influence, those being externally supplied money, fighters and weapons. ISIS and Co. rule the areas they invadethrough coercion and violence, not through the ridiculous idea of a “tech-savvy popular base”.

This false perception is further exposed by the fact a large contingent of ISIS fighters are not even Iraqi in origin, or Syrian for that matter. A recent report by the CIA(8) revealed that there are approximately 15,000 foreign fighters in ISIS ranks – a figure that has been consistently undercounted by the “experts” to maintain the fantasy of an indigenous uprising in Syria. This coincides with the Syrian Observatory’s latest death toll – often cited by western media & NGO’s – which tallied up to 15,000 foreign fighters killed in action in Syria. Put another way, that’s roughly 1000 foreign fighters for every month since the Syrian insurgency began. Are we supposed to believe all these fanatics took it upon themselves to travel to Iraq & Syria due to Maliki & Assad’s “sectarian policies”?

Contrary to the one-sided idealistic tales of Seymour and John Kerry, the simplistic portrayal of ISIS & Co. earning “grassroots support” simply through the Sunni community’s alleged persecution is entirely false and built to conflate foreign-sponsored militants and their collaborators with the whole Iraqi Sunni population, while shifting the blame for the massive expansion in militant fundamentalism into a reaction against the alleged oppression of “Shia regimes” and away from its chief protagonists: the Wahhabi clients of NATO imperialism.

Peddling sectarian narratives serve several purposes for the Western commentariat, a consistent example of which is provided by the Independent’s highly regarded Patrick Cockburn, who recently went as far as to suggest that “Sunni’s of Syria in areas under ISIS control prefer it to the Government”, an utterly wrongheaded and misleading sentiment that has been repeatedly debunked in the face of ceaseless propagation on behalf of Western and Gulf media for over three years. Yet these narratives persist as they are the primary ideological camouflage to hide external material causes, those causes being Western imperialism.

In Syria for example, the oft-repeated refrain of a supposedly sectarian “Alawite regime” is largely made up of a Sunni merchant class. The “Alawite army’s” ranks are dominated by Sunni conscripts, along with Christians, Shia, and Druze. But the Assad government has been ceaselessly portrayed as a “sectarian regime” intent on suppressing the Sunni majority. The reality of course is the precise opposite, militant forces of the opposition are of a majority Salafi/Wahhabi fundamentalists, and this has been the case since the very beginning of the Syrian uprising(9) – if you are looking to blame anyone for the rise in sectarianism in Syria then you need look no further than the reactionary Wahhabi clients of Western imperialism.

Equally, blaming the “sectarian policies” of the Maliki government is just as hollow a narrative in the Iraq context(10); the US is responsible for installing the sectarian political system in Iraq in its attempts to divide nationalist resistance to its occupation and ongoing exploitation, a system in which the Maliki government was by no means an innocent bystander.

But the historical record shows that Maliki’s more recent attempts to reverse this destructive process, along with a multitude of other policies which upset US strategic ambitions, including his refusal to allow the permanent installation of US military bases; his governments close alliance with neighbouring independent Iran; their efforts to aid the Syrian government against the NATO-sponsored Wahhabi insurgency; and not least attempts to remove the vassals of the GCC from Iraqi politics–formed the real motives behind the US-Saudi-led campaign to incite Wahhabi fundamentalists against Maliki’s Shia dominated government. Maliki’s “sectarian policies” no doubt existed to an extent in reaction to the circumstances imposed upon it by the dominant aspect driving the antagonism; such policies came about as a result of both the historical legacy of the US occupation and the ongoing US-Saudi-led sectarian incitement and subversion, which in fact forms the historical “social base” for ISIS & Co.(11)

Cockburn and many others within the corporate media circus have continued to peddle these sectarian myths as a useful tool in idealizing the spectacle and extricating wider politics, more specifically culpable external actors. Although rightly regarded as one of the more sensible and rigorous journalists covering the Middle East, Cockburn is nonetheless just as susceptible to selling ahistorical reductive tales in what appear to be attempts at whitewashing or mitigating the role of Western imperialism; often putting repeatedly destructive Western policy down to “mistakes” in lieu of explanation for ceaseless aggression and decades of empowering reactionaries – supposed enemies of “Western Democracy”. The flip side being of course the compassionate West must now attempt to fix its mistakes by means of further intervention, and on and on it goes.

Such narratives are largely premised upon the white supremacist ideal that the Western imperial bourgeoisie inherently seek “progress”, or perhaps even “democracy” within foreign nations, as opposed to the fundamental characteristic of imperialism seeking political reaction all along the line(12). Contrary to Cockburn’s perception of benevolent imperialism, the US does not seek even “stability” within nations unwilling to submit to exploitative Western capital–it seeks their destruction, as has been historically proven time and time again. Yet this concept of “bumbling benevolent imperialist” persists and is drawn from an inability to see past the Noble Western Empire’s altruistic mythology and grasp the reality of a rapacious class destroying its competition.

Imperialism intentionally bolstered ISIS, its predecessors and intermittent Wahhabi allies, in the aim of setting them against Shia dominated political actors and states in the region opposed to US domination. It is now using the ISIS “threat” and spectacle as the moral pretext to both re-invade and divide Iraq, and reinvigorate its regime change and destructive agenda in neighboring Syria.

Instead of attempting to expose these policies in an international totality, Seymour & Co. aim to bolster the white supremacist mythology underlying the imperial civilising mission; on the one hand Seymour Others the Sunni population of Iraq as sympathisers of the ISIS Savage, a racist caricature dutifully embellished in all avenues of Western corporate media. On the other, by portraying “oppressive sectarian (Shia) regimes” as an even worse option than ISIS the entire region and its peoples are painted into a dystopian landscape of Savages and brutal sectarianism; accordingly, Noble Western Empire must save them from their own barbarity.

Moreover, by blaming Iraqis for the barbarism imposed on them externally, Seymour & Co. successfully extricate imperialism from its principal culpability in fomenting and sustaining sectarian antagonism in the Middle East. It therefore needs repeating that ISIS in Iraq is but a continuation of the imperialist-sponsored insurgency in neighboring Syria and the longstanding support to militant fundamentalism preceding it. The states acting under the autonomy of US imperialism responsible for arming and funding said insurgency hold the same principal objectives in Iraq as those pursued in Syria for the last three years, namely: the destruction of state sovereignty; weakening the allies of an independent Iran; the permanent division of Iraq and Syria along sectarian lines establishing antagonistic “mini-states” incapable of forming a unified front against US/Israeli imperial domination.

Notes:

1.) Bombs wont solve the ISIS problem – Richard Seymour: http://www.theguardian.com/commentisfree/2014/sep/15/bombs-isis-beheadings-iraq

2.) How the West created the Islamic State – Nafeez Ahmed: https://medium.com/@NafeezAhmed/how-the-west-created-the-islamic-state-dbfa6f83bc1f

3.) ISIS: an expression of imperialism in Iraq: http://notthemsmdotcom.wordpress.com/2014/06/18/isis-an-expression-of-imperialism-in-iraq/

4.) US Intervention Is Not Humanitarian and Will Not Protect the People of Iraq – Sami Ramadani:http://mrzine.monthlyreview.org/2014/ramadani080814.html

5.) While consistently referred to as “Sunni” within Western and Gulf media it should be stressed that the ultra-conservative strains of Islam practiced by the majority of both “moderate rebels” in Syria and their overtly fundamentalist counterparts within ISIS, Al Qaeda, Jabhat al Nusra et al, are of the Wahhabi/Salafi doctrine and largely rejected by the majority of practicing Sunni muslims outside of the reactionary Gulf Kingdoms where such doctrine is enforced. By applying the Sunni label, authors such as Seymour enable the crude conflation of ISIS & Co. with the indigenous population, furthering Orientalist dehumanization and false sectarian narratives.

6.) The Redirection – Seymour Hersh: http://www.newyorker.com/magazine/2007/03/05/the-redirection?currentPage=all

7.) How Saudi Arabia helped ISIS take over the North of Iraq – Patrick Cockburn: http://www.independent.co.uk/voices/comment/iraq-crisis-how-saudi-arabia-helped-isis-take-over-the-north-of-the-country-9602312.html

8.) CIA says ISIS numbers under-estimated: http://www.aljazeera.com/news/middleeast/2014/09/cia-triples-number-islamic-state-fighters-201491232912623733.html

9.) The Reactionary Essence of the Syrian Insurgency: http://notthemsmdotcom.wordpress.com/2014/01/07/the-reactionary-essence-of-the-syrian-insurgency/

10.) Nouri al-Maliki: the scapegoat in Iraq -Ali Raza: http://lubpak.com/archives/315192

11.) The strange case of Nouri al-Maliki – Eric Draitser: http://journal-neo.org/2014/07/03/the-strange-case-of-nouri-al-maliki/

12.) Imperialism and the Split in Socilaism – V.I. Lenin: https://www.marxists.org/archive/lenin/works/1916/oct/x01.htm

The great German newspaper, German Economic News, headlined on Saturday, September 20th, “Welcome Russia at the G20 summit: End of Isolation” (German original:  “Ende der Isolation: Russland bei G20-Gipfel willkommen”), and reported that,

“Because the USA needs Russia in its fight against terror-IS, the G20 speculation to isolate Russia in the world community has been shelved. The conflict in the Eastern Ukraine is therefore classified as [being only] regionally [important].” Moreover, “Americans and Russians agreed behind the scenes on a division of the Ukraine. … The Ukrainian government and the rebels in the east have agreed on the establishment of a buffer zone in the east of the country. … The resulting 30 km wide buffer zone along the [battle] front will be monitored by observers from the Organization for Security and Cooperation in Europe (OSCE).”

This is, essentially, the announcement introducing truce-lines, such as were established at the end of the Korean War and many others.

However, the foreign-affairs leader of the Ukrainian separatists says that their efforts to get Russia’s President Vladimir Putin to accept their territory as being a part of Russia have been firmly rejected by Putin’s Government; and, so, “We will build our own country.”

This important statement from the foreign-affairs leader Andrei Purgin on Wednesday, September 17th, was not headlined nor even the topic of any U.S. news report; it was instead inconspicuously buried halfway through an AP news story that focused on “East Ukraine Casualties.” It’s common for propagandistic news reports, such as characterize the U.S. media, to bury what’s important in the news story, and not even to headline that crucial information, when that information violates the regime’s propaganda that they’ve been trumpeting. So: this information was buried, and was not headlined. The American media had portrayed Putin as the aggressor behind Ukraine’s war, and had hidden that Obama was actually the aggressor. The extremely violent February 22nd overthrow of Ukraine’s President Viktor Yanukovych was, as this proves, a fascist coup by the U.S. And as the transcript of the phone conversation between two EU officials shown here documents, they recognized on February 25th that it had been precisely that. Furthermore, President Obama’s agent, Victoria Nuland, on February 4th, had already selected Arseniy Yatsenyuk, whom she affectionately referred to there as “Yats,” to run the country. And her U.S.-engineered coup in Ukraine didn’t occur until February 22nd, and it then installed “Yats” to run the country.

So, this news, that Putin didn’t even want the Ukrainian rebels’ territory, was not something that U.S. media intend the U.S. public to recognize suddenly; it’s instead like the non-existent “Saddam’s WMD” that they had trumpeted during 2002 and 2003 but that were all lies — something to be laid only gradually upon their deceived public, so the masses won’t even notice that they had been lied to.

Russia’s Government has thus now made clear that it is not seeking to add to its territory. While Russia has accepted the approximately million refugees who have fled to Russia from Ukraine’s civil war, Russia does not want any part of Ukraine’s territory.

Crimea was a different case: traditionally part of Russia, throughout the period 1783-1954, until the leader of the Soviet Union gifted Crimea to Ukraine (the nation that was called the Ukrainian Soviet Socialist Republic) in 1954, but the residents of Crimea never accepted that, and they overwhelmingly considered themselves still to be Russians. Furthermore, the Russian Navy’s lease on the Crimean port of Sebastopol for its Black Sea Fleet extended till 2042, and the February 2014 coup-installed Ukrainian Government wanted to cancel it, which threatened crucial Russian national defense. Furthermore, many of those new, Obama-installed, Ukrainian leaders wanted a nuclear war against Russia. So, Putin needed to be concerned about the Black Sea Fleet, and he accepted Crimea back into Russia, but he will not admit more than that from Ukraine, as being added to Russian territory — at least not now.

Crimea is viewed as not being an addition to Russia, but instead as voluntarily rejoining Russia, irrespective of the new Ukrainian Government’s campaign to eliminate ethnic Russians from Ukraine’s southeast. No other part of post-1954 Ukraine had previously been part of Russia, and this includes the southeastern portion of Ukraine, whose residents ethnically descended from Russian immigrants who had settled there.

Consequently, the ethnic-cleansing campaign that has been going on by the new, Obama-installed, Ukrainian Government, against the residents in Ukraine’s southeast, will no longer have Washington’s support. Obama’s hope for that ethnic-cleansing to continue at least long enough for the surviving residents there to shrink to a small enough proportion of the total Ukrainian national electorate so that a nationwide Ukrainian election (which hasn’t been held in Ukraine since the February 2014 coup) will choose leaders who are acceptable to the U.S. Government, appears to have ended. On the basis of his hope to grab all of Ukraine, he had planned and financed that February coup. But now he settles for only the remaining western stump of it. The eastern part he won’t get. Only by killing and driving out enough of those people – the ones in the areas that overwhelmingly voted for the man whom Obama overthrew – would it become possible for an intact entire Ukraine that allies itself with the U.S. to be democratically stable, not reversed by the election of a pro-Russian leader of Ukraine. But instead, Ukraine will lose the land and resources that it had been trying to conquer back from the people who live in Ukraine’s pro-Russian region.

President Putin and President Obama have regularly been in direct contact with one-another ever since Obama’s coup occurred in February. Perhaps Putin’s declining to accept Ukrainian territory into Russia is part of an agreement between the two leaders, in which Obama is, for his part, declining the urgings from congressional Republicans and conservative Democrats for the U.S. to provide weapons to the Ukrainian military to expedite America’s ethnic cleansing campaign in Ukraine.

Obama seems to have decided that his desire to grab Ukraine for the U.S. aristocracy (international corporations) must be abandoned now, because it’s not politically practical at the same time when the U.S. is also escalating its military involvements in the Middle East, where the control of oil is an even bigger factor than the matter of gas is in Ukraine.

Obama is folding his Ukraine deck. And Putin doesn’t want it.

The result will be at least two failed states in the former Ukraine: the western part, which will be a bankrupt burden mainly to regular taxpayers in the EU, and the eastern part, which will be a bombed-out wreck right next door to Russia. Already, Russia is sending in food, clothing, and other aid, to the people still left where Ukraine was bombing and killing them, and was destroying their homes and infrastructure.

And, as this scenario plays itself out, it will all come to the public as if it is new news, and the public won’t even much care that they had been lied to, yet again. When the press is carefully managed, there is no accountability. That’s what the owners of the press want, and it’s why they buy it — to be able to sell to other aristocrats that non-accountability. It’s their racket.

“Climate March” Hides Real Culprits and Real Solutions

September 22nd, 2014 by Tony Cartalucci

Big business and the big political parties and politicians they own have converged in what is being disingenuously called the “People’s Climate March.”  MSNBC would report in an article titled, “The largest climate march in history kicks off in New York,” that:

They’re calling it the largest mobilization against climate change in the history of the planet. On Sunday morning, protesters from all over the United States and the world are converging on Manhattan to demand that global leaders take action to avert catastrophic climate change. Earlier this week Bill McKibben, founder of the environmental group 350.org, projected that the march would consist of “hundreds of thousands” of participants.

Not surprisingly little in terms of actual solutions are mentioned by the organizers and instead the march is meant to set the stage for political and financial deals to be made at the 2015 Climate Change Conference in Paris, France. Organizing the march are institutions funded by the very governments and corporate-financier special interests that have helped create devastating environmental and socioeconomic disasters across the planet over the past several decades in the first place.

Also involved are profiteers who have taken advantage of the general population’s genuine concern for the environment to propose and benefit from scams consisting of everything from land-grabbing thousands of acres in Africa to peddling “carbon credits” and other financial gimmicks that make immense profits from doing literally nothing at all in terms of production and by creating a false sense of security, may even be compounding environmental catastrophes.

For those drawn to such “marches” and who are dismayed or disillusioned by the disingenuous nature of those trying to hijack their good intentions to peddle self-serving political and financial gimmicks, what can they do to develop and actually make good on the vague promises being made during this year’s “People’s Climate March?”

The Climate Always Changes – We Must Always Be Prepared 

The climate is always changing, and nearly everything human beings and nature do, both on Earth and beyond it, has an impact on it. A changing climate, like earthquakes and volcanoes driven by the constantly changing geological state of our planet, or diseases that sweep animal and human populations amid a perpetual biological arms race, will be a challenge humanity will always have to face.

Of course, human activity has an impact on the climate. The construction of our cities creates microclimates, emissions change the constitution of our atmosphere – regardless of how much or little – contributing to a much greater array of natural and anthropocentric variables that collectively drive and change the planet’s climate, among other things.

Image: Late Cretaceous period saw CO2 levels many times higher than they are today, with higher sea levels and Antarctica covered in temperate forests and teaming with dinosaurs. The climate has shifted radically long before humanity rose, and will continue to change regardless of what we do. We can prepare for it, minimize our impact on it, but we cannot stop it. 

 

Additionally, there is no way to predict with certainty, nor manipulate reliably the climate – at least not with the technology we currently possess – and surely not with the political solutions pushed forward by the very corporate-financier special interests staging stunts like the “People’s Climate March.”

While reducing humanity’s impact on the planet should be one of many goals we collectively pursue, even if we managed to reduce our impact to zero, the climate would still change, and would still change for both the better and for the worse of the ecosystems that inhabit this planet. Evolutionary, astronomical, and geological processes have all contributed to massive extinction events. Humanity must understand that the only way to truly protect this planet is not to “stop climate change,” which is impossible, but rather hedge and protect against it  through innovations that can weather climatic changes no matter what they may be or what may be driving them.

In many ways, agriculture itself is an expression of this. So is exploration and architecture. Continuing along the road of these evolving disciplines will give us the tools we need to always be prepared no matter what the climate throws at us.

Reducing Humanity’s Impact on the Environment 

Reducing humanity’s impact is a topic that in fact does get brought up by the ringleaders of the climate change movement. However, their vision of the future is one where the population lives in utter austerity under a planetary regime but a handful control. Left unscathed are the corporate-financier special interests that will create this planetary regime that, not surprisingly, will also bestow upon these special interests, unprecedented power, wealth, and influence. And despite the austerity they have planned for the masses, none of their measures seem to address what will happen if the climate continues to change – as it has for millions upon millions of years before humans walked the Earth.

There is an alternative solution that is often never mentioned – one that doesn’t hamstring human progress or demand resource rationing, or the curtailment of energy use or food consumption. It is not political in nature and does not involve one group of people dictating the lives and allowances of others.

It is never mentioned because it would be a direct, coordinated, global decentralization of the big-business monopolies and their socioeconomic and environmentally disastrous supply-chains, factory farms, sweat-shops, and the iron grip they possess over so-called “intellectual property” and research and development in all fields from energy production to biotechnology to medicine and mass transportation.

Local Development 

Local development of, by, and for the people, leveraging technology, open source collaboration, and focusing on pragmatic, technical solutions to our problems, including reducing our impact on the environment and hedging against natural disasters whatever their cause, is indeed the solution.

Consider the journey made by a plastic trinket found on the shelf of Walmart. It began in a sweatshop literally on the other side of the planet, hammered, pressed, painted, packed, and shipped off by people working under slave-like conditions using unhealthy chemicals and processes that would be unacceptable in the West.

The trinkets are driven by trucks to docks where they are placed upon ships that traverse the Earth’s oceans burning tons of diesel fuel, releasing scorching clouds of fumes behind them as they churn up the sea and all life within it. The trinkets arrive on Western shores where they are moved by trucks, vans, or planes from the docks, to distribution centers, to the mega-retail outlet it is finally destined for.

To pick up your trinket, you must drive your car to Walmart, walk beneath hundreds of lights burning sometimes 24 hours a day, 7 days a week over its warehouse-sized consumerist troughs, purchase the trinket, and drive back home.

Consider an alternative – a 3D printer on your desk. Open source designs can be downloaded and shared over the Internet with anyone in the world. Projects can be coordinated between designers and hobbyists anywhere on the planet. When you have obtained or designed the trinket of your choice, you print it out directly on your desktop. There is no car drive, no ships, no trucks, no burning lights over shelf after shelf in a mega-retail outlet. You print exactly what you want, exactly how many you want, without the waste associated with consumerist-driven assembly lines and mass production.

Even the plastic fed into 3D printers can be derived from plant oils grown locally. Plastic and other materials can also be recycled locally. Gone are the sweat shops, truck convoys, merchant fleets, and all the unwarranted power and influence their existence grants the handful of special interests they serve.

The innovations in manufacturing technology that are placing the means of production literally into the hands of the masses will be followed by similar breakthroughs and paradigm shifts in biotechnology, agriculture, and medical technology. Communities are already developing what could be called local collaborative institutions where technology is leveraged to solve the problems and desires of their residents. And while they are “local,” they are by no means isolated. They are connected globally to similar local institutions cropping up across the planet by information technology. Innovations will progress in parallel rather than in secret within the profiteering grip of traditional corporations, governments, and global institutions.

It will be these local institutions that pragmatically put an end to the waste, fraud, and abuse of immense corporate-financier interests and the negative socioeconomic and environmental impact they are demonstrably causing.

Personal manufacturing like 3D printing would do (and is already doing) more alone to undo harmful consumerist practices, faster, and in parallel than any top-down political solution cooked up at the Climate Change Conference in Paris could dream of doing.

What You Should Be Doing Instead of “Marching” 

Instead of standing shoulder-to-shoulder with the very special interests that have created the current global system devouring our planet, activists genuinely concerned with human progress and the health and longevity of our planet’s environment should be shoulder-to-shoulder with local innovators seeking to solve local problems and in parallel with other innovators globally. Local hackerspaces or makerspaces, fabrication laboratories (FabLabs), DIYbio community labs, and other collaborative projects are providing the tools and resources needed to solve problems without the “help” of the very troublemakers that created them in the first place – big business and big government.

 

Image: Building solutions themselves, rather than begging corporations and
governments to do it for them – local institutions like hackerspaces and
makerspaces set new precedents in how we organize ourselves to work and
solve problems.  

-

After all, it is local people who understand best the challenges they face socioeconomically and environmentally. They understand the quality of their food, water, and air and what needs to be done to clean it up – not those attending the Climate Change Conference in Paris. And it is local people who will be motivated above all others to truly solve these problems as efficiently and as quickly as possible.

And if we decide not to act locally, and instead defer to politicians to “save us,” we can expect the same tricks and unfulfilled promises politicians make in every other regard. People who are willing to march in the streets, but not dirty their hands to come up with actual solutions to these problems are not genuine in their cause. Others who are willing to get their hands dirty should be spending their time exclusively doing so, rather than encouraging hot air from politicians and their self-enriching gimmicks that will cost us, not aid us in moving humanity forward with our best interests and the planet’s health in mind.

The earth’s climate is changing. Sea levels are rising. We are all at risk. The role of humans in climate change is undeniable. Capitalism is to blame. Governments must fix the problem.

These are the mantras of the environmental movement on display at the People’s Climate March being held on September 21.

The talking points of foundation-funded doomsayers reverberate in unison because their financing is dependent on publicizing a specific message and agenda. The otherwise critical minds supporting what passes for rebelliousness overlook the sponsorship and tacit control wielded by powerful private interests.

https://www.youtube.com/watch?v=0Autx79iHJs

Scratching the surface, one finds that the most salient proponents of the carbon-centric global warming worldview are largely dependent on such funding. For example, Bill McKibben, a principal organizer of the People’s Climate March, has built a career around the false notion that minuscule increases in carbon dioxide are a principal cause of “extreme weather” events.

[Image Credit: baltidome.wordpress.com]

mad_billAs this author has noted,

McKibben’s 350.org project is the public face of his 501(c)(3) 1Sky Education Fund, which between its founding in 2007 and 2009 took in close to $5,000,000 in foundation money and “public contributions.” In 2010 the Rockefeller Brothers Fund gave 1Sky $200,000. The key “scientific” paper McKibben points to as support for his dire warnings on climate change, “Target Atmospheric CO2: Where Should Humanity Aim,” coauthored by NASA scientist James Hansen, was partially funded through Rockefeller Foundation money.[1]

A seemingly radical, anti-establishment veneer is helpful in lending the environmental movement some degree of legitimacy. Canadian journalist and author Naomi Klein is the most recent voice of climate alarmism. Klein’s previous works, No Logo (2000) and The Shock Doctrine (2007), have afforded her with considerable notoriety and some degree of credibility, particularly among those on the progressive-left.

Klein’s most recent book, This Changes Everything: Capitalism vs. The Climate, suggests that drastic measures must be taken to save the environment from destructive human activities. This Changes Everything is published by Simon & Schuster, a subsidiary of the publicly-traded CBS Corporation, which boasted revenues of $15.284 billion in 2013 alone.[2] Like McKibben’s Rockefeller sponsors, Simon & Schuster and CBS are typically uninclined toward promoting genuinely anti-establishment thought and discourse.

Klein is one of the few in the progressive-left cavalcade to recognize that geoengineering and weather manipulation pose extreme threats to the environment. “Well, so, one of the geoengineering methods that gets taken most seriously is called ‘solar radiation management,’” Klein remarks on the foundation-funded Democracy Now! news hour,[3] another promoter of the People’s Climate March.

Solar radiation management, managing the sun. So, what you—so the idea [sic] is that you would spray sulfur aerosols into the stratosphere, then they would reflect some of the sun’s rays back to space and dim the sun and cool the Earth. So, climate change is caused by pollution in the lower atmosphere, and so they’re saying that the solution to that pollution is pollution in the stratosphere. And, you know, it’s really frightening when you look at some of the modeling that is being done about what the possible downsides of this could be [sic].[4]

In fact, there is substantial evidence–patents, government documents, and scientific papers–that such organized contamination projects have been underway since at least the late 1990s and are almost certainly a major factor in the “extreme weather events” pointed to with such alarm by figures like McKibDN_Kleinben.

Yet Klein deceptively suggests that geoengineering is still in the planning stages and has not begun. Indeed, to acknowledge that such plans are well-advanced and now fully operational would call into question the anthropogenic climate change hypothesis she and her adherents proclaim as the rationale for opposing “capitalism.” It would also likely jeopardize a lucrative publishing contract with a global media conglomerate.

[Image Credit: democracynow.org]

Foundation-funded and corporate-promoted environmentalism is notable not only for its hypocrisy, but also for what it leaves obscure to its well-intentioned devotees.

With this in mind, the purpose of such artificial dissent is arguably to repackage the threat of extreme weather that has been manufactured by military and government programs over the years as the basis for strategic socio-political and economic changes to which the public would never freely submit.

To curb humankind’s environmental excesses, today’s state-backed corporatism mistakenly decried as capitalism must further expand into the everyday lives of individuals, where an “internet of things” will inevitably catalog, regulate and control all consumable resources and biological entities.

“A really efficient totalitarian state,” Aldous Huxley once observed, “would be one in which the all-powerful executive of political bosses and their army of managers control a population of slaves who do not have to be coerced, because they love their servitude.”[5]

Along these lines, establishment environmentalism’s continued feigned urgency and spectacle of protest ingeniously disguises the deeper belief that humanity’s salvation lies in its own subservience to technocratic control.

Notes

[1] James F. Tracy, “Chemtrails: The Realities of Geoengineering and Weather Modification,” Global Research, November 8, 2012.

[2] “CBS CORP 2013 Annual Report Form (10-K)” (XBRL). United States Securities and Exchange Commission. February 14, 2014.

[3] James F. Tracy, “Manufactured Dissent: The Financial Bearings of the Progressive-Left Media,” Global Research, August 3, 2012.

[4] Amy Goodman, “Naomi Klein on Motherhood, Geoengineering, Climate Debt & the Fossil Fuel Divestment Movement,” Democracy Now! September 18, 2014.

[5] Aldous Huxley, Brave New World and Brave New World Revisited, Harper Perennial, 2005.

An insider in the U.S. military’s covert drone war has confirmed what critics of the killing program have long-warned: the program is far more “dangerous” than the government admits.

In an op-ed published in Salon on Tuesday, the unnamed former Air Force imagery analyst writes, “I was the only line of defense between keeping someone alive and providing the intelligence for a strike using technology not accurate enough to determine life and death.”

The military veteran—published under the name AFISR Predator (for Air Force Intelligence, Surveillance, and Reconnaissance)—goes on to describe how a drone pilot’s success was partly determined by the number of “enemy kills.” The analysts were encouraged to fly missions “even when there was nothing of consequence to see, no targets to strike and no American ground forces to protect,” wrote the veteran.

Despite calls for greater transparency, President Barack Obama has yet to acknowledge or provide any accounting for the number of civilians killed by the U.S. drone program. The Bureau of Investigative Journalism estimates that in Yemen roughly 135 civilians were killed by either confirmed or possible drone strikes since 2014 and in Pakistan over 950 civilians have been killed by confirmed strikes.

Countering claims made by the CIA director John Brennan that the use of drones will “dramatically reduce,” if not eliminate, the danger to U.S. personnel, AFISR Predator describes the prevalence of spousal, alcohol and drug abuse among his 100-person unit; two members had even taken their lives.

“The psychological pressure of not knowing if strikes were accurate was debilitating at times,” AFISR Predator writes.

“Our team worked between 12- and 14-hour shifts in a Sensitive Compartmented Information Facility, sometimes flying for hours seeing nothing, sometimes seeing unspeakable carnage,” AFISR Predator continues. “Then we returned home to spouses and families, where our security clearances prevented us from sharing our experiences in an effort to decompress from what we had witnessed.”

AFISR Predator concludes by saying that the military must “reconsider” their reliance on killer drones. “They are not as legal, targeted or accurate as the government makes them out to be, and they are not without consequences for our troops.”

A nurse who works at a private hospital in Mersin, a city and province on the Mediterranean coast of Turkey, has told Turkish authorities and Parliament that she is sick and tired of treating members of the terrorist organization the Islamic State in Iraq and the Levant (ISIL), which now calls itself the “Islamic State.”

The nurse, who was identified only by her initials, E.G., in a news story published by the Taraf daily on Wednesday, said of ISIL militants: “We treat them, and they go on to decapitate people. I am sick of treating wounded ISIL militants.” E.G. has also written a letter to Parliament and the National Police Department, saying she and her colleagues are extremely disturbed by the fact that they have to treat people “who chop off heads.”

Taraf reported that other health workers in Mersin and other provinces close to the Syrian border are uneasy about having to help wounded ISIL militants, who are responsible for extreme violence and bloodshed in northern Iraq and Syria.

In the letter she wrote to Parliament and the Police Department, E.G. said she has been employed at a private hospital in Mersin for a long time. She said her hospital has treated many wounded Syrians so far, who have introduced themselves as “opposition members.”

However, she noted that she had found out that most of the Syrians recently admitted to the hospital were ISIL members. “I was extremely distressed about this. I am very sorry about this situation. I am disturbed by the fact that these people are being treated in our hospitals while our people are being held by them,” she wrote, according to Taraf’s report.

ISIL has been holding 46 Turks, and three consulate staff who are not Turkish citizens, as hostages for the past three months.

E.G. further wrote that she was “ashamed” to have played a role in the treatment of the militants. She also stated that the ISIL militants were checked into the hospital under fake names. She said an ISIL commander was treated at the hospital where she works in August.

“The ISIL commander named Muhammet Ali R. who was admitted to our hospital on Aug. 7 was treated at room number 323. Many of his bodyguards kept watch around the hospital. Many other ISIL commanders like him and soldiers have been treated at our hospital, and returned to war after the completion of their treatment. I don’t want to help these people. I want you to inspect these hospitals. And I am referring the owners of the hospital and its management to God.”

The accelerating drive to a new US war in the Middle East, extending from Iraq to Syria and potentially beyond, has laid bare a stark contradiction between President Barack Obama’s public rejection of any US “boots on the ground” and increasingly assertive statements by top generals that such deployments cannot be ruled out.

Underlying this semi-public dispute between the US president—the titular “commander-in-chief”—and the military brass are the realities underlying another war of aggression being launched on the basis of lies for the second time in barely a decade.

It is being foisted on the American public as an extension of the 13-year-old “global war on terror,” with Obama warning this week that the Islamic State of Iraq and Syria (ISIS) “if left unchecked… could pose a growing threat to the United States.”

In reality, the ISIS threat, such as it is, stems entirely from US imperialist interventions that have ravaged first Iraq, through a war and occupation that claimed some one million lives, and then Syria, in a US-backed sectarian war for regime-change—in which ISIS was the beneficiary of arms and aid from the US and its regional allies—that has killed well over 100,000 and turned millions into refugees.

The collapse of Iraq’s security forces in the face of an ISIS offensive that was part of a broader Sunni revolt against Iraq’s US-installed Shi’ite sectarian government is now being used as the justification for a US military intervention aimed at reasserting US military dominance in Iraq, intensifying the war to overthrow the Assad regime in neighboring Syria, and escalating the confrontations with the key allies of Damascus—Iran and Russia.

Such strategic ambitions cannot be achieved with such unreliable proxy forces as the Iraqi military and the so-called Syrian “rebels.” They require the unrestrained use of Washington’s military might. This is why the generals are publicly challenging the blanket commitment made by Obama ruling out any US ground war in Iraq or Syria.

Over the past several days, both White House and Pentagon spokesmen have issued “clarifying” statements in an attempt to smooth over what increasingly suggests something close to insubordination by the top uniformed brass against the president.

The Washington Post pointed to the conflict Friday in a lead article entitled “In military, skepticism of Obama’s plan,” writing, “Flashes of disagreement over how to fight the Islamic State are mounting between President Obama and US military leaders, the latest sign of strain in what often has been an awkward and uneasy relationship.”

The first major public airing of the divisions between the military command and the White House came Tuesday in congressional testimony in which Gen. Martin Dempsey, the chairman of the Joint Chiefs of Staff, stated that circumstances in Iraq and Syria could require the introduction of US ground troops and he would not rule out their deployment. He added that the commander of CENTCOM, which oversees US military operations in the Middle East, had already proposed the intervention of US troops in the campaign to retake the Mosul dam last month, but had been overruled by the White House.

A day later, Obama appeared to rule out such action even more categorically, telling a captive audience of US troops at MacDill Air Force Base Wednesday: “As your commander-in-chief, I will not commit you and the rest of our Armed Forces to fighting another ground war in Iraq.”

This hardly settled the question, however. Speaking on the same day as the president, Gen. Ray Odierno, the Army chief of staff and former top US commander in Iraq, told journalists that air strikes would prove insufficient to achieve Washington’s ostensible goal of destroying ISIS. “You’ve got to have ground forces that are capable of going in and rooting them out,” he said.

Odierno intensified his argument on Friday, telling reporters that air strikes alone would grow increasingly problematic as ISIS forces intermingled with Iraq’s civilian population.

“When you target, you want to make sure you are targeting the right people,” the Army commander said. “The worst thing that can happen for us is if we start killing innocent Iraqis, innocent civilians.” He added that US ground forces would be needed to direct the bombing campaign.

Odierno referred to the 1,600 US troops the Obama administration has already deployed to Iraq as “a good start,” but added that as the US military campaign developed, so too could the demand for further deployments. “Based on that assessment we’ll make further decisions,” he said.

The Army chief warned that the US was embarking on a protracted war in the region. “This is going to go on,” he said.

“This is not a short term—I think the president said three years. I agree with that—three years, maybe longer. And so what we want to do is do this right. Assess it properly, see how it’s going, adjust as we go along, to make sure we can sustain this.”

As to US ground troops entering combat together with Iraqi units, Odierno stated, “I don’t rule anything out. I don’t ever rule anything out, personally.”

Even more blunt was Marine Corps Gen. James Mattis, the former commander of CENTCOM, who retired only last year. Testifying before the House Intelligence Committee, he directly attacked Obama’s public position of “no boots on the ground,” stating, “You just don’t take anything off the table up front, which it appears the administration has tried to do.”

Mattis added:

“If a brigade of our paratroopers or a battalion landing team of our Marines would strengthen our allies at a key juncture and create havoc/humiliation for our adversaries, then we should do what is necessary with our forces that exist for that very purpose.”

Even Obama’s defense secretary, Chuck Hagel, appeared to contradict the president’s assertion about no ground troops, telling the House Armed Services Committee Thursday, “We are at war and everything is on the table.” Hagel also revealed that the 1,600 “trainers” and “advisers” who have been deployed to Iraq are receiving combat pay.

It is apparent that the Obama administration is using a hyper-technical definition of “combat troops” to exclude the military’s special operation units from this category, even if they end up engaged in combat.

The position taken by the generals has found ample political support from the right-wing editorial board of the Wall Street Journal as well as congressional Republicans. The Journal argued in an editorial Friday that Obama’s “promise never to put ground troops into Iraq or Syria is already undermining the campaign before serious fighting begins against the Islamic State. Few believe him, and they shouldn’t if Mr. Obama wants to defeat the jihadists.”

The editorial compared Obama’s denial about “combat troops” to the claims made at the beginning of the Vietnam War that US troops were acting only as “advisers,” warning that the president could face the same fate as Lyndon Johnson, who “gave the impression of looming victory… only to have to escalate again and again.”

Rep. Howard “Buck” McKeon (Republican of California), the chairman of the House Armed Services Committee, told the Washington Post that Obama should “follow the … professional advice of the military” and “not take options off the table.”

The assertiveness of the top military brass in contradicting the White House is fed by the subservience and cowardice of civilian authorities, including the president and Congress. The latter adjourned this week after voting in both the House and Senate for Obama’s plan to shift $500 million in Pentagon funding to the arming and training of so-called “moderate rebels” in Syria. The measure was inserted as an amendment to a continuing resolution to fund the federal government through mid-December.

No serious debate, much less direct vote, was taken on the region-wide war that Washington is launching in the Middle East. The legislators have no inclination to be seen taking a position on this action—much less an interest in exercising their constitutional power—for fear that it will reverberate against them at the polls in November. Any debate has been postponed until Congress reconvenes after the elections and, undoubtedly, after the war is well under way in both Syria and Iraq.

Kagame Started the Genocide in Rwanda, then Congo

September 21st, 2014 by Global Research News

To the City of Atlanta, former Mayor Andrew Young and Bernice King:

Individuals and organizations listed below have come to know that the President of Rwanda, Paul Kagame, is organizing what he calls Rwanda Day, a meeting with the Rwandan Diaspora and the American public in the city of Atlanta.

We, the Congolese and Rwandan Diaspora, indigenous of the Congo and Rwanda, together with friends of these two countries, denounce and strongly condemn the fact that the president of Rwanda is allowed to organize such a meeting on American soil with the blessing of the authorities of the City of Atlanta.

Our condemnation is based on the fact that the people of the African Great Lakes regions have suffered from the abuses committed by Paul Kagame and his government for 24 years now.

We would like to bring the following basic facts about Paul Kagame to the attention of all Americans who are committed to peace and social justice:

  • In 1990, Gen. Paul Kagame invaded Rwanda heading a detachment of the Ugandan army dominated by Rwandan Tutsis like himself. He destabilized the country and committed numerous mass murders in the north of Rwanda.
  • In 1994, when the city of Kigali was surrounded by camps filled with desperate refugees fleeing Kagame’s army in the north, President Kagame pushed the country into a state of panic, terror and genocidal violence by ordering the assassination of the Rwandan and Burundian presidents as they returned from peace talks in Arusha, Tanzania, which were meant to end the conflict.

Rwandans and Congolese joined forces to protest the first Rwanda Day, held in Chicago, Illinois, in 2011, and at each Rwanda Day since.
Image: Rwandans and Congolese joined forces to protest the first Rwanda Day, held in Chicago, Illinois, in 2011, and at each Rwanda Day since.

  • In 1996 and 1998, Gen. Paul Kagame joined Gen. Yoweri Museveni in invading the Democratic Republic of the Congo, creating havoc in the country which resulted in deaths that the International Rescue Committee estimated to be as high as 5.4 million between January 1997 and January 2008. Since at least seven years of war and conflict were not counted in the IRC’s epidemiological study, the death toll is no doubt much higher.
  • Gen. Paul Kagame has never stopped plundering the Democratic Republic of the Congo since his first raids and today Rwanda is a major exporter of coltan (ore used in the manufacture of mobile phones, playstations and military electronics), although Rwanda itself has no coltan reserves.
  • Gen. Paul Kagame has fueled wars in the Democratic Republic of the Congo by creating and supporting proxy militias such as the M23 that have helped him cover up his plundering of the country.
  • Gen. Paul Kagame rules Rwanda with an iron fist. Political space is locked down favor of a minority. Nonviolent political challengers to Kagame, including Victoire Ingabire and Deo Mushayidi are incarcerated.

A protester at Rwanda Day in Boston in 2012 held up a poster calling for the freedom of Rwandan political prisoner and opposition leader Victoire Ingabire Umuhoza.

Image: A protester at Rwanda Day in Boston in 2012 held up a poster calling for the freedom of Rwandan political prisoner and opposition leader Victoire Ingabire Umuhoza.

  • Gen. Paul Kagame does not hesitate to resort to political assassination inside and outside Rwanda’s borders. In 2010, journalist Jean Leonard Rugambage was gunned down in the streets of Kigali, after letting the editor of the publication he wrote for know that he was about to release evidence of Kagame’s complicity in the attempt to assassinate his former general, Kayumba Nyamwasa, in Johannesburg, South Africa. Kagame’s former intelligence chief, Patrick Karegeya, was the last known to pay with his life for becoming a critic of the Kagame regime. Karegeya was found hanging in a Johannesburg hotel on New Year’s Day this year. This case is still under investigation, but Kagame’s response to the murder was to warn Rwandans, in a public speech, that “you can’t betray Rwanda without paying the price.”

All statements mentioned above have been duly documented by various U.N. reports, documented news reports including video footage, and legal judgments:

  • In July 16, 1997, the U.S. House of Representatives hearings before the Committee on International Relations about the Democratic Republic of the Congo revealed that Paul Kagame’s RPF (Rwandan Patriotic Front) had invaded Congo-Zaïre and that it was assassinating Hutu refugees in Eastern Congo-Zaïre. In 2006, President Obama, who was then a senator from Illinois, authored the Congo Relief Security and Democracy Promotion Act. Section 101(5) and (6) of Obama’s 2006 Congo legislation reads:“(5) The most recent war in the Democratic Republic of the Congo, which erupted in 1998, spawned some of the world’s worst human rights atrocities and drew in six neighboring countries.“(6) Despite the conclusion of a peace agreement and subsequent withdrawal of foreign forces in 2003, both the real and perceived presence of armed groups hostile to the Governments of Uganda, Rwanda, and Burundi continue to serve as a major source of regional instability and an apparent pretext for continued interference in the Democratic Republic of the Congo by its neighbors [Uganda, Rwanda and Burundi].”

Rwanda Day protest, London 2012

Image: Rwanda Day protest, London 2012

  • In 2008, The Spanish National Court indicted 40 Rwandan officers on charges of mass murder, crimes against humanity, terrorism, genocide against Rwandans, Congolese and Spanish citizens in the aftermath of the 1994 Rwanda genocide. Judge Fernando Andreu of Spain’s National Court also declared that he had sufficient evidence to implicate current Rwandan President Paul Kagame, but he also added that he could not indict him because of his presidential immunity.
  • The U.N. Office of the High Commissioner for Human Rights (UNOHCHR) issued a report on the Congo called “The United Nations Mapping Exercise Report.” This report affirms that the Rwandan government is responsible for the most serious violations of human rights and international humanitarian law in the Congo. Moreover, the observation of some of the crimes committed in the Democratic Republic of the Congo has led investigators to say that some elements “if proven before a competent court, could be characterized as crimes of genocide.”
  • On April 15, 2013, the Report of Foreign & Commonwealth Office (FCO) expresses concerns about the political space in Rwanda. It observes that there are many political constraints and that freedom of association and expression is not guaranteed. It also raises the question of the imprisonment of opposition leader Madame Victoire Ingabire.
  • In a letter dated Dec. 12, 2013, from the Group of Experts on the Democratic Republic of the Congo addressed to the chair of the Security Council Committee established pursuant to Resolution 1533 (2004) concerning the Democratic Republic of the Congo, the U.N. experts argue that Rwandan Defense Minister James Kabarebe was commanding the M23 militia then terrorizing DR Congo and that Rwanda provided continuous support to M23 from Rwandan territory. The most consistent forms of support were through recruitment and provision of arms and ammunition, particularly during periods of combat. M23 also received troop reinforcements directly from the Rwandan army in August. During the October fighting, Rwandan tanks fired into DRC in support of M23.
  • On Sept. 10, 2014, Magistrate Stanley Mkhari sentenced four men each to eight years in prison in a South African court, saying that they had been proven guilty of a ‘‘politically motivated’’ attempt to assassinate Kayumba Nyamwasa, Paul Kagame’s former defense chief, in June 2010. The plot, the judge wrote, originated in Kigali, the capital of Rwanda.

Kagame Day protest, Toronto 2013

Image: Kagame Day protest, Toronto 2013

The United States, which takes pride in its democratic history, and the City of Atlanta, which played such a proud role in the American Civil Rights Movement led by Dr. Martin Luther King, cannot want to appear to the world as supporters of dictatorship and mass murder, but allowing Paul Kagame to organize “Rwanda Day” in Atlanta tells the world that they are.

The violation of human rights is no more acceptable in Africa than in the United States or anywhere else in the world. We like to believe that human beings, wherever they are, are entitled to justice and that it is a denial of justice to host an event created to let a regime with bloody hands promote itself, while the millions it killed remain compelled to silence in death because we do not have the courage to speak for them and say enough is enough.

A message from a Congolese citizen, Philippe Lomboto Liondjo: “Please do not insult Martin Luther King’s memory and the spirit of the honorable struggle for Civil Rights by allowing a killer such as Gen. Kagame to organize his Rwanda Day in Atlanta.”

Coalition

BK Kumbi, spokesperson, Don’t Be Blind This Time (Switzerland-DRC)
Don’t Be Blind This Time, Swiss citizen movement
Bruce Dixon, Managing Editor, Black Agenda Report (USA)
Glen Ford, Executive Editor, Black Agenda Report
Milton Allimadi, Editor-in-Chief, Black Star News (USA)
Frank LeFever, retired neuroscientist, Pacifica WBAI Local Station Board member (USA)
Ann Garrison, Journalist and Victoire Ingabire Umuhoza Democracy and Peace Prize Winner (USA)
Maurice Carney, Executive Director, Friends of the Congo (USA)
Kambale Musavuli, Student Coordinator and Mining Researcher, Friends of the Congo (USA-DRC)
Kweku Lumumba, Secretary General, World African Diaspora Union, Georgia (USA)
Christopher Black, ICTR Defense Counsel (Canada)
David Peterson, co-author of the upcoming book, “Enduring Lies: The Rwandan Genocide in the Propaganda System, 20 Years Later” (USA)
Claude Gatebuke, Rwandan Genocide survivor, Executive Director, African Great Lakes Action Network
Theophile Murayi, Foundation for Freedom and Democracy in Rwanda
June Terpstra (USA)
Lisanga, Congolese political association (France)
La LUCHA, mouvement citoyen RD Congo
Soledad Mora, Comités Umoya-Madrid (Spain)
Magloire Mpembi, doctor and novelist (Canada-DRC)
Jean-Mobert N’Senga-la, LUCHA, (DRC)
Momi M’Buze Noogwani Ataye Mieko, Congolese writer and activist
Monique Mbeka, Congolese film maker (Belgium-DRC)
Philippe Lomboto Liondjo, Congolese performer, actor and activist (Switzerland-RDC)
Olivier Mukuna, Journalist (Belgium)
Lopango Ya ba Nka, Congolese music band (Germany-RDC)
Willie Ratcliff, Publisher, San Francisco Bay View National Black Newspaper
Mary Ratcliff, Editor, San Francisco Bay View National Black Newspaper
JR Valrey, Producer, Block Report Radio, Associate Editor, SF Bay View (USA)
Anne Onidi, Journalist (Switzerland)
Nicolas-Patience Basabose (RSA)
Elengo (Switzerland-DRC
Victoria Dimandja (GB-DRC)
Youyou Muntu-Mosi (France-DRC)
Nadine Bena (France-DRC)
Jean-Jacques Tadoum (USA)
Leopold Mbala (USA-DRC)
Ekutsu Mambulu (DRC)
N’siala Kiese Patrick (Belgique-Drc)
Meta Nabou Cisse (Belgique)
Derrick Onyeri (Denmark-Uganda)
Nadia Nsayi (Belgiques-DRC)
Jean-Baptiste Paul (France-Haïti)
Rosa Moro, Journalist (Spain)
Flavia Garrigos Cabanero (Spain)
Dina Martinez (Spain)
Damiàn Socías Picornell (Spain)
Pedro Espinosa Bote (Spain)
Ana María Martínez Rodamilans (Spain)
Fuencisla de Andrés (Spain)
Ana Espinosa González (Spain)
Pedro Espinosa (Spain)
Maite Cobas (Spain)
Jaime Lara (Spain)
José Hernández (Spain)
Mingu Haro (Spain),
Marlene Ibarra (Ecuador)
Nella Azana (GB-DRC)
Vincent Conrad Ball (GB)
Kibsoo Diallo (Egypt)
Djallil Saada (Switzerland)
Benjamin Itzkovich (Switzerland)
Dieudonne Aoche (USA-DRC)
Lucie N’goma (France)
Paul Alain (France)
Judith Bass (Switzerland)
Juan Carlos Hernandez (Switzerland)
Mang Holenn Christian (RSA)
Leslie Luboloko Lusinda (RSA)
Patrick Kegbia (RSA)
Billy Lukinu (Angola)
Stacey Koyenyi (GB)
Kitondua Diasivi (France)
Ive Mass (GB-RDC)
Matondo Kapella (RDC)
Gloria Omoyi (France-RDC)
Gugu Ngwenya (RSA-RDC)
Owandji Olenga Lokolo Lopaka (RDC)
Sosthene Banda Badou (Poland-Tchad)
Bebelle Dembo (North Irland)
Anthea Harris (GB)
Claudine Mamona-Cullin (Austria)
Sala Naambwe (Canada)
Demunga Hassani (Canada)
S. Mathieu Gnonhossou (USA-Rwanda)
Philippe Faradja Byaombe , Congolese Student Organisation-Pretoria (RSA)
Aimant Lutonadio (Germany-RDC)
Sophie Teuwen (Senegal)
Ibrahim Touré (Algeria-Mali)
Dadao Mupulu (RDC)
Kalengula Wha Kalengula (USA-RDC)
J.L. Bondoko Ekolonga (RDC)
Motaouakkil Abdellatif (Morocco)
Paul Otshudi Loma (GB)
Dolly Kimpiatu Fofo Lukata (USA-DRC)
Raphaël Berland (France)
Beatrice Léonard Lomami (USA-DRC)
Freddy Aigle (DRC)
Ambrose Nzeyimana (GB-Rwanda)
Dady Dalla (USA-DRC)
Dalila Choukri (France)
Kakiese Nicole (Belgium-DRC)
Dominique Diomi (USA-DRC)
Joachim Mbala (GB-DRC)
Patience Ngoba-Mushidi (Germany-DRC)
Joyce Mbaya (USA-DRC)
Yiokito Ilangwa (RSA-DRC)
Patricia Athena (Sweden
Yaa-Lengi Ngemi, President, Congo Coalition
Nii Akuetteh, Founder, The Democracy & Conflict Research Institute (DCRI)
Ed Herman, co-author of the upcoming book, “Enduring Lies: The Rwandan Genocide in the Propaganda System, 20 Years Later”
Keith Harmon Snow, human rights investigator and war correspondent, Conscious Being Alliance
Robin Philpot, Baraka Books Publisher, author of “Rwanda and the New Scramble for Africa
Kevin Alexander Gray, author of “The Decline of Black Politics: From Malcolm X to Barack Obama,” contributor to Counterpunch and The Progressive
Nita Evele, Congo Coalition – Stop the Genocide in Congo-Zaire
Phil Taylor, Taylor Report Producer and Host, CIUT 89.5 FM, University of Toronto, former defense investigator for the ICTR
Kumbi Bénédicte Ndjoko, historian and activist, Don’t Be Blind This Time
Jean Nepomuscene Manirarora, Secretary-General, Foundation for Freedom and Democracy in Rwanda
Jennifer Fierberg, Contributor, African Global Village

For more information, contact Friends of the Congo, 202-584-6512 or 718-865-6512 and Committee for Unity of Black Immigrants and Americans, 404-401-8817.

Hotel Propaganda: What Really Happened in Rwanda in 1994

September 21st, 2014 by Antony C. Black

On the evening of April 6th 1994 a plane carrying the Hutu leaders of both Rwanda and Burundi was shot down as it approached Kanombe airport[1]. The assassins had little trouble targeting the flight as only one of the two runways was open, the other having been closed two months earlier on the orders of Canadian General Romeo Dallaire. Simultaneous to the shootdown, that is on the eve of April 6th, a 30,000 RPF  (Tutsi) army based in Uganda invaded from the north. At the same time, hundreds of covert armed RPF cells came to life in and around Kigali and began attacking Rwandan government forces (FAR). The population, roughly 85% Hutu, and encompassing at least a million refugees in and around Kigali displaced by previous RPF incursions from Uganda, began to panic.  A genocide was about to begin.
 
But it was a genocide neither against, nor by, the actors cited in the ‘official’ narrative. Indeed, Rwanda circa 1994, is, in all likelihood, if not the, then certainly one of the greatest propaganda swindles of all time. This is the story of that swindle and of the scandalous truth that lies buried beneath it.
 
Historical Context

Prior to the arrival of Europeans, Rwanda was a feudal kingdom ruled by a Tutsi minority over a Hutu majority. Following the Berlin Conference of 1885 Rwanda came under the suzerainty of Germany which was, itself, replaced as colonial overlord following WW1, by Belgium. Rwanda’s feudal order remained intact, however, until 1956 when the Belgians finally organized elections. Then, in November 1959, the Hutu majority overthrew the Tutsi monarchy. Many Tutsis fled, the majority ending up, significantly, in Uganda. It was from this perch in Uganda that the exiled Tutsi aristocracy launched, between 1960 and 1973, a series of violent attacks against the Rwandan regime. These were repulsed and for the next decade and a half Rwanda enjoyed a period of relative peace.

It is worth noting at this juncture that, though much of the Tutsi aristocracy fled in 1960, those Tutsis who remained were well integrated into Rwandan society and body politic. Thus, both the government and army contained significant numbers of Tutsi personnel even through the height of the crisis in April 1994. In fact, the Rwandan Army (FAR) continued as a multi-ethnic organization even as it was forced to retreat into the forests of the Congo in July of 1994; this after having run out of ammunition due to a Western embargo on arms supplies – an embargo not applied to the RPF.

Up until 1990 there was no further interference in Rwanda from Uganda. Nevertheless, by then the Tutsis exiles living there had become one of the main elements of the Ugandan Army. As such, when Museveni came to power – having been handpicked by the US and Britain to oust the socialist, Milton Obote – a third or more of his army consisted of Tutsis. Many of these held high office, including Paul Kagame.

Kagame had been (and remains) an erstwhile client of Washington from well before he claimed to have ‘saved Rwanda from further genocide’ in 1994. Not only had he served as director of Ugandan military intelligence in the 1980s, but he had also received training at Fort Leavenworth, Kansas,[2] and had been the beneficiary of constant US material and diplomatic support from the moment he assumed control of the RPF.

Upon the collapse of the USSR in 1989/90 the US and the UK began a general militarist expansion which included the targeting of Yugoslavia and Rwanda; Yugoslavia as it was the last real bastion of working socialism in Europe, and Rwanda as it was a working model of socialist development in Africa. In addition, the US had turned against Mobutu (of Zaire, now the Democratic Republic of the Congo) as he was beginning to ally himself politically with China.

The Rwandan president, Habyarimana, was subsequently approached by Washington to allow his country to be used as a staging ground for an attack on Zaire (to this day, a cornucopia of precious resources prized by the West). His refusal caused the US to look to other agents in furthering its strategic interests. They found the Tutsis in Uganda, ever thirsting for restoration of their hegemony in Rwanda. Furthermore, Museveni had begun to feel uneasy about the numbers of Tutsis in his ranks and was looking to be rid of them. The opportunity to satisfy these disparate desires soon came.

On October 1, 1990 the self-styled Rwandan Patriotic Front (RPF) launched a surprise attack from Uganda. Though calling themselves a force of ‘liberation’ the offensive was a thinly disguised invasion by Uganda itself. Initially, the justification for the invasion put out by the RPF was that of attaining the right of return of Tutsi refugees. This claim, however, was belied by the fact that Rwanda had, under UN auspices, already agreed a few weeks earlier to the return of all Tutsis who wished to do so. That accord required Tutsi representatives to travel to Kigali to determine both the logistics of that population movement and their subsequent accommodation within Rwanda. The delegation was expected at the end of September, 1990. They never arrived.

The attack killed tens of thousands of Rwandan civilians. These crimes, though well documented, have never been accounted for, nor did the UN or ‘international community’ ever seek to account for them. Indeed, there was not even a shred of condemnation of the Ugandan/RPF  invasion, this despite the clamour raised only two months earlier with regard to the advance of Iraqi forces into Kuwait. In point of fact, the US and its allies supported the aggression against Rwanda and US Special Forces operated alongside the RPF from the beginning. This support notwithstanding, the small Rwandan army (with some help from a Congolese battalion) was eventually able to repel the invading forces.

Following this attempt using a proxy force to overthrow the state, the United States brought political and economic pressure to bear upon Rwanda’s one-party socialist state (MRND). The President, Juvenal Habyarimana, instead of resisting, agreed to alter the constitution and in 1991 Rwanda became a multi-party democracy. Though the Rwandan government effected this as an offer of peace, what followed was anything but peace. Thus, rather than work towards reconciliation, the RPF turned from the tactics of open warfare to those of guerrilla terrorism.

In 1992, and whilst RPF forces were busy planting mines, assassinating politicians and blaming it on the MRND, a coalition government was formed with the front parties of the RPF. These agents, with US backing, quickly seized control of key ministries and succeeded in appointing the Prime Minister. They also gained control of the intelligence services which they then began to dismantle. In essence, the ‘power sharing’ arrangement had largely given over control of the country to the very forces long bent on its destruction.

The RPF itself, meanwhile, engaged in a ‘talk and fight’ strategy; always agreeing to a ceasefire, pressing for more power, then launching new attacks on the civilian population. The most egregious of these assaults was their breaking of the ceasefire and the launching of a major offensive in February of 1993. Seizing the town of Ruhengeri, RPF forces murdered some 40,000, mostly Hutu, civilians. Once again, the ‘international community’ remained dutifully silent.

The Rwandan army, though hamstrung by the civilian ministries, managed to repulse the RPF attack. Finally, in August of 1993, the Arusha Accords were signed under pressure from the United States and its allies, and from which the RPF obtained major concessions. The Accords dictated the formation of a broad-based transition government to be followed by general elections.[3] But for the RPF – as for the United States – there was a fatal fly in the electoral ointment. To wit, the RPF knew that they could not win such elections; this not only because they were unpopular with the majority (85%) Hutu population, but also because they had precious little support amongst many of Rwanda’s internal Tutsis whose lives and businesses they had destroyed. Rather than prepare for elections, the RPF prepared for something different.

UN reports document the massive build-up of men and weapons coming in from Uganda during this period. In fact, the UN force (UNAMIR) supposedly deployed to ensure a peaceful transition acted, instead, as a cover for the US and its allies, i.e. Britain, Belgium, Canada, to assist the illegal build-up. General Romeo Dallaire, the Canadian general in charge of the UN force, hid this build-up not only from the Rwandan Army and the President, but also from his immediate superiors, Jacques-Roger Booh-Booh and UN Secretary General Boutros Ghali. These machinations were accompanied by death threats against Habyarimana, threats made all the more significant by the murder of the first Hutu president of neighbouring Burundi, Melchior Ndadaye, by Tutsi officers in October 1993.[4]

The result of the 1993 RPF offensive was the forced migration of hundreds of thousands of Hutus from northern Rwanda towards Kigali so that by April, 1994 over a million refugees were encamped close to the capital and hundreds of thousands more in camps to the south. The RPF, meanwhile, did all it could to paralyze the functioning of the government, to exacerbate racial tensions, and to prepare for war.

Who Killed Habyarimana

The triggering event in the ‘Rwandan genocide’ of 1994 is generally agreed to be the shooting down, on April 6, 1994, of the plane carrying Juvenal Habyarimana, the Hutu president of Rwanda, and Cyprien Ntaryamira, the Hutu president of Burundi. The official story has it that unidentified ‘Hutu rebels’ were the villains who targeted their own countrymen in some vague attempt to gain power. No evidence was ever adduced in support of this threadbare thesis, but in any case, even if so, the official villains failed spectacularly in their objectives as the country quickly fell to invading Tutsi forces leaving a small minority (Tutsi) population to rise like the Phoenix to its former position of national privilege and oligarchical control. No one in the Western mainstream media has ever commented on the exceeding peculiarity of this bizarre turn of events, never witnessed before, in which the supposed victims of a genocide end up as the victors of the conflict.

The paradox is soon resolved, however, if we countenance the much more likely scenario that the decapitation of the state leadership was the first stage in a final offensive of a war started four years earlier. That the assassination was part of an RPF coup d’etat is given further support by the fact that a 30,000 man RPF force was already marching against Kigali hours before the plane was destroyed, and that RPF forces inside Kigali were attacking government positions within hours of the shootdown. The Western audience, naturally, was, and has never since, been informed of these rather pertinent contextual facts surrounding the events of April 6, 1994. To boot, the official response to Habyarimana’s assassination was and has remained one of determined indifference; a strange thing given that it involved the highest official in the land. Even stranger given that, and according to virtually every independent expert on the subject, the ‘genocide of 1994’ simply would not have happened had Habyarimana not been assassinated. Nevertheless, though all the circumstantial evidence points towards the assassination being part and parcel of a US-backed RPF coup d’etat against the government of Rwanda, it would yet be helpful if there was direct evidence implicating RPF forces in the murder. There is.

As in one of those classic ‘B movie’ plot twists where the bad guys inadvertently hire a good guy who turns the table on his benefactors, so too did the lead official of the International Criminal Tribunal for Rwanda (ICTR) hire an investigator into the crash who turned out to be an honest man. Reporting back to Chief Prosecutor Louise Arbour in 1996/97, Australian lawyer, Michael Hourigan, found evidence directly linking the RPF (and the CIA) to the assassination. Far from pleasing Arbour, however, Hourigan’s diligence was rewarded with censure. According to Hourigan, Arbour became “aggressive” and “hostile” when informed of his findings. What Hourigan didn’t know at the time is that Arbour, after having launched the investigation, had been directed by US Secretary of State Madeleine Albright (who had handpicked her for the job) to quash the inquiry. And so she did. Arbour would later (again under the aegis of Albright) be promoted to Canadian Supreme Court Justice and thence as UN High Commissioner for Human Rights.

Hourigan’s report, though suppressed at the time, would, nevertheless, surface many years later in the hands of one of the defense teams at the ICTR. The report would also have its findings later corroborated by numerous sources. Thus, the French anti-terrorist judge Jean-Louis Bruguiere, having been called in to investigate the deaths of three French nationals who were aboard Habyarimana’s doomed flight, launched an exhaustive eight-year investigation. He concluded that the plane had indeed been destroyed by the RPF and that the assassination was part and parcel of Kagame et al’s plan to take over Rwanda by force. Bruguiere went on to issue nine warrants for the arrest of high-ranking members of the RPF whilst also requesting that the ICTR take up Kagame’s prosecution.

What’s more, not only have other French – and Spanish – legal officials since confirmed Bruguiere’s findings, but many highly placed members of the RPF have stepped forward publicly to implicate Kagame and the RPF in the assassination[5]. All have suffered the same fate of official international silence and suppression, and some of the latter have suffered assassination themselves.[6]

This culture of suppression and official silence has also plagued the ICTR from its inception. In particular, it became the explicit policy of the ICTR to forcibly limit its mandate solely to the investigation of ‘genocidal intent’ by Hutu government figures, i.e. without any reference whatsoever either to the political context of the conflict or to the mounting evidence implicating the RPF as invaders and genocidaires.  In short, the ICTR, much like its sister tribunal, the International Criminal Court for the Former Yugoslavia (ICTY), proved itself from the outset to be little more than a Washington-sponsored kangaroo court.[7]

This transparently politicized policy has continued apace throughout the trials. When, for instance, the more independently-minded Carla Del Ponte replaced the pliable Louise Arbour, she was quickly terminated as Chief Prosecutor after calling for a ‘Special Investigation’ into the actions of the RPF; this despite making a case for such an investigation with then UN Secretary-General Kofi Anan. Of course, Anan’s refusal to look into the crimes of the RPF should come as no surprise as it was he who, a) was head of the peacekeeping operations in 1994, and is thus implicated in the events, and b) was handpicked by the US to replace his predecessor, Boutros-Ghali.

Boutros-Ghali, It might be remembered, had come uncomfortably close to scuttling the entire US/RPF invasion scenario when, in May of 1994, he acceded to a request by the Rwandan government to send 5500 UN troops to Rwanda to reinforce the 2500 already stationed there; this so as to stabilize the country at a time when reports of growing ‘chaos’ were issuing forth daily in the world press. These efforts were, however, categorically thwarted by the Clinton regime which used its influence to remove the proposal from the UN agenda. Instead, the UN troops already stationed there, far from being reinforced, were withdrawn. Later, Boutros-Ghali, in conversation with Rwandan expert Robin Philpot, would expand on these matters declaring that, “The genocide in Rwanda was 100% the responsibility of the Americans!”[8] Hardly any wonder, then, that in 1996 US Ambassador to the UN, the ubiquitous Madeleine Albright, would veto his re-election making Boutros-Ghali the only UN Secretary General in history not to be granted a second term in office.

Inconvenient Truths

On August 26, 2010 the French newspaper Le Monde revealed the existence of a draft UN report detailing the most serious human rights violations in the Democratic Republic of Congo over an eleven year period (1993 – 2003). The report described how, following the RPF’s takeover of Rwanda in 1994, it proceeded to carry out “systematic and widespread attacks” against Hutu refugees who had fled to neighbouring DRC. These attacks it stated, “could be classified as crimes of genocide.”

Save for it having been leaked to Le Monde, it is clear that the report was well on its way to being buried alive, its cover-up a near certainty. But this was hardly the first instance of a cover-up of a UN report vis a vis Rwanda. As early as October 11, 1994, Robert Gersony, an employee of the US Agency for International Development (USAID), then attached to the UN High Commissioner for Refugees, made an oral presentation to the UN Commission of Experts on Rwanda. Gersony had been dispatched to survey the situation inside Rwanda to determine if conditions were right for return of the Hutu refugees who had fled the RPF. Instead, he found that the RPF had been committing massacres of the Hutu population in Rwanda starting in April 1994 through the date of his presentation. On page 4 of the UN record of Gersony’s presentation (a record which surfaced in the defense proceedings at the ICTR), we read,

“Significant areas…have been the scene of systematic and sustained [emphasis added] killing and persecution of the civilian Hutu population by the Rwandan Patriotic Front…..These actions were consistently reported to be conducted in areas where opposition forces of any kind – armed or unarmed, or resistance of any kind….were absent. Large scale indiscriminate killings of men, women and children, including the sick and elderly were consistently reported.”

Now, I remind the reader that the killings detailed here were being perpetrated not, as in the official narrative, i.e. by  Rwandan government troops, but by the supposed saviours of the country, i.e. the RPF.

Though much evidence surfaced early on that the official genocide narrative was in sharp disagreement with reality, all later independent reports have continued to corroborate this finding. In a 2004 paper, for instance (and reinforced in a more recent 2009 report), US academics Christian Davenport and Allan Stam concluded that, of the many hundreds of thousands of deaths (possibly as high as two million)[9] that occurred in Rwanda from April through July of 1994, the “majority of victims [at least two thirds] were likely Hutu and not Tutsi”. Noteworthy is the fact that Davenport and Stam were initially sponsored by the ICTR – that is until their findings contradicted the official narrative whence they were sent packing.

Still, Davenport and Stam have refrained from taking the implication of their own research to its logical conclusion, i.e. that Kagame’s forces were the only agents responsible for committing “systematic” killings in the areas they overran, or that such systemic violence was part of a pre-existing plan by the US-backed RPF to invade and overthrow the legitimate government, the latter in order to install a formerly privileged minority – and Western comprador elite[10] – to power within Rwanda.

If the academics have been content to sit on the fence, not so one of the more famous lay figures of the Rwandan debacle. It is ironic in the extreme that Paul Rusesabagina, the real-life hero of the movie Hotel Rwanda – a film unashamedly promoting the official narrative – has himself, in numerous interviews, completely gainsaid that narrative. He has, thus, repeatedly denounced the RPF as the real genocidaires, and has called a Kagame a “war criminal” and “dictator” who is responsible for mass killings not only during the takeover of Rwanda in July 1994, but ever since both in Rwanda and in his US-backed incursions into the Congo. Indeed, so fervent have the denunciations been that Rusesabagina is now officially listed as a ‘terrorist’ and ‘genocide denier’ (a prisonable offence in Rwanda) by the Kagame regime.

No matter, the movie continues to circulate, sans critique; Rusesabagina’s views and denunciations, do not.[11]

Whose Genocide(s)?
 
It is something of an embarrassment to the US architects of the ICTR that the tribunal, though explicitly tasked with indicting only members of the Hutu government, have failed singularly in successfully prosecuting any of them[12]. Not only have the most senior members of the MRND – through the spirited efforts of the various defense teams – been acquitted, but the mass of evidence so assembled has stood the entire official narrative on its head, and has implicated, au contraire, the RPF – and its foreign accomplices – in the genocide.

There was, however, one highly publicized piece of evidence proffered at the tribunal by prosecutors as they sought to prove a ‘planned genocide’ by the MRND government. This was the so-called ‘genocide fax’ allegedly sent to the New York UN headquarters on the night of January 10th, 1994. That this was the only piece of documentary evidence claiming direct planning of a genocide put forward in the trial is, itself, telling. Had there actually been such a plan (by the MRND), the logistics would have left a paper and/or electronic trail a mile wide. Instead, there are no orders, minutes of meetings, notes, cables, faxes, radio intercepts or any other type of documentation indicating that such a plan ever existed. And then, of course, there are the actual events on the ground which, as we have seen (and shall see further), suggest nothing of the sort. Nonetheless, there is the lone sepulchre of the ‘genocide fax’. What to make of it?[13]

To make a long story short, the fax is a forgery. There was a fax sent to the UN headquarters on January 10th, 1994 (a copy of a cable sent by Romeo Dallaire to another Canadian, General Baril), but this was not the fax that was entered into evidence in the Military II trial (ICTR vs Ndindiliyimana)[14] in October, 2005. Ndindiliyimana’s defense counsel was able to definitively establish that the original fax dealt only with ‘weapons caches and seeking protection for an informant’, whereas the fax subsequently entered as evidence, having first had time stamps, dates and paragraphs altered, had mysteriously sprouted an addendum about government plans to kill Tutsis and Belgian soldiers.[15] Conflicting testimony both between Dallaire’s earlier and later statements, and between statements made by Dallaire and Lt. Col. Claeys (a Belgian officer who claims to be one of the authors of the original cable), further proved the document’s inauthenticity. Such was only reinforced when Dallaire’s immediate superior, Jacques Roger Booh-Booh, stated that he had never seen nor heard of the fax or any of its alleged inflammatory contents. Eventually, the ‘genocide fax’ was simply withdrawn as evidence by the court. Puff! One might wonder, then, why tens of thousands of MRND personnel are today still in prison, this whilst not one RPF figure has even been indicted. But so it is.

If documents supporting a pre-meditated plan by the MRND have failed to materialize, not so it turns out when it comes to the RPF. In the same trial that saw the outing of the fraudulent ‘genocide fax’, evidence was presented suggesting nothing other than a master plan by Kagame and “our Belgian, British and American collaborators” for the taking not only of Rwanda, but of Zaire. In a letter from Kagame to fellow Tutsi, Jean-Baptiste Bagaza of Burundi, dated August 10, 1994, Kagame thanks Bagaza for his help in “taking Kigali”. He then relates his communications with “our big brother Yoweri Museveni” and talks of “some modifications of the plan” noting that:

“We have found that the presence of large numbers of Rwandan refugees at Goma, and the international community, can cause our plan for Zaire [emphasis added] to fail. We cannot occupy ourselves with Zaire until after the return of these Hutus….In any case, our external intelligence services continue to crisscross the east of Zaire, and our Belgian, British and American collaborators [emphasis added] the rest of Zaire. The action reports are expected in the next few days.”

Now, what this letter seems to indicate is that the attack on Rwanda (from 1990 onward) was not the prime objective of Kagame and crew after all, but was, rather, merely the gateway to an attack on Zaire/Congo. The significance of the latter became apparent when, on November 1, 1996, the aforementioned Goma was, in fact, attacked and taken by the RPA (the re-named RPF) along with Burundian and Ugandan forces. This assault was heavily backed by the United States and eyewitness accounts tell of large American cargo planes filled with arms landing in Kigali in the last two weeks of October, 1996. The taking of Goma was, it is pertinent to note, the prelude to the ensuing genocidal carnage that has overtaken the Democratic Republic of the Congo ever since. To properly understand this last statement we need to backtrack a bit to April 6, 1994, and look at the events that unfolded immediately following the assassination of Habyarimana.

Once the plane had been shot down, an RPF army, as noted earlier, invaded from the north whilst armed RPF cells began attacks inside Kigali itself. These cells represented some 15,000 or so troops that the RPF had illegally secreted into Kigali under Dallaire’s watch [As the UNAMIR force commander he was charged with the responsibility of allowing, under the Arusha Accords, no more than 600 RPF into the city]. In the sector of Kigali known as Remera the RPF killed everyone on the night of the 6th and 7th, wiped out the gendarme camp there, wiped out the military police camp at Kami and launched major attacks against Camp Kanombe, Camp Kigali, and the main gendarme camp at Kacyriu.

The Rwanda government and army called for a ceasefire that same night and the next day. The RPF rejected the call. The Rwandan government then asked for UN help to control the situation. Instead, the US arranged that the main UN force be pulled out whilst flying in men and supplies to the RPF using C130 Hercules aircraft. The Rwandan Army, short of ammunition and unable to contain the RPF advances offered an unconditional surrender on April 12th. The RPF rejected this offer and began shelling the Nyacyonga refugee camp, where the one million Hutu refugees were located, so provoking their flight into the capital.

The effect of one million people flooding into a small city that itself was under bombardment caused mayhem and panic. To make matters worse, the RPF used this flood of people to infiltrate its men behind FAR lines. This heightened to fever pitch the panic amongst the Hutu population who then began killing anyone they did not recognize. The late Dr. Alison Des Forges (a noted expert on Rwanda), in her testimony before the Military II trial at the ICTR in 2006 stated that the RPF claim that they attacked to stop a ‘genocide’ was a myth; just propaganda to justify their attempt to seize power by force of arms. She also testified that the Rwandan government did not plan and execute genocide. This accords with the (early) testimony of Romeo Dallaire who confirmed that there was no planned genocide by the MRND. In addition, the deputy head of Belgian Army intelligence, Col. Vincent, similarly testified that the idea of an MRND-backed genocide was a complete fantasy.

The fighting in Kigali was intense. UN officers – confirming testimony made by FAR and RPF officers before the ICTR – state that the RPF was launching hundreds of Katyusha rockets every hour around the clock whilst the Rwandan Army ran out of grenades in the first few days and were reduced to fighting with hand-made explosives. Nevertheless, the siege of Kigali lasted three months and only ended when the Rwandan Army literally ran out of all ammunition and thence ordered a general retreat into the forests of the Congo.

RPF officers testifying before the ICTR have stated that the RPF killed up to two million Hutus in those 12 weeks in a deliberate campaign to eliminate the Hutu population. The Akager River, the length of which was under RPF control throughout, ran red with the blood of Hutu victims massacred on its banks. It is here that Robert Gersony’s report, filed as an exhibit before the ICTR, lends support to this testimony and to the fact of a systematic and planned RPF massacre of the Hutu population.

As the Rwandan Army (including its Tutsi officers) retreated into the Congo forest, the Hutu population, in fear for their lives, fled with them in their millions. Meanwhile, in local villages, Hutu neighbours attacked Tutsis either in revenge for the murder of Hutus or fearing death at their hands. Tutsis also attacked Hutus. It was total war, though a war clearly fuelled and instigated by the US-backed RPF invasion.

The RPF later pursued the Hutus through the Congo forest and, between 1996 and 1998, killed hundreds of thousands and possibly millions. All the while the RPF was assisted by the United States. Thus, the US cynically thwarted plans (in November 1996) devised by the French and the European Union to send a 10,000 man UN force to assist and guarantee the safe return of the refugees; a plan which if it had been effected would likely have forestalled the ensuing multi-million death toll in the Congo. Moreover, the UN Rwanda Emergency office in Nairobi was, in fact, manned by US Army officers and acted as the operational headquarters of the RPF. Finally, not only did US Special Forces fight alongside the RPF during this period, but intercepted radio messages from Kagame to his forces in the field suggest that both Belgian and Canadian forces were involved as well.

Operating, then, under the Orwellian pretext of ‘hunting for genocidaires’, Kagame & Co. conducted a decade long invasion/occupation of Zaire/Congo. The overall strategic thrust of this assault was threefold. First, it was an attack on French interests in Africa, interests that were immediately taken over by the United States. Second, the assault was part and parcel of the overthrow of Mobutu (toppled in May of 1997). Ultimately, however, the capture of the Congo was about booty. As such, this single treasure chest contains not only large deposits of diamonds, gold, copper, uranium and tantalum (used in computers and cell phones), but also much of the world’s reserves of chrome, platinum and cobalt.

To the question then, ‘Whose genocides were they?’, the answer yet resounds through the din of propaganda, ‘They were ours’.

Shaking Hands With The Devil

In assessing responsibility for the tragedy of Rwanda – and the ensuing events in Zaire/Congo – we must not stop at those already indicted in this essay. For none of this could have happened without the overt complicity of numerous ‘humanitarian’ NGOs including especially, Human Rights Watch, which, in the early days prior to the RPF’s final solution, headed up a totally bogus, unsubstantiated report (issued March 6, 1993) condemning (and so de-legitimizing in advance) the Rwandan government for a ‘genocide’ that, in fact, had yet to take place – and which would, in the event, be committed by the very agents it conspired to defend, i.e. the RPF. And, naturally, none of this could have happened without the willing complicity of the Western mass media who swallowed hook, line and sinker every piece of propaganda issued by the Clinton Administration[16].

As Canadians we are more than ordinarily complicit as it was the Canadian government (under Jean Chretien) that worked hand-in-glove with the Americans throughout this period. In particular, of course, three Canadians, Louise Arbour, General Maurice Baril and General Romeo Dallaire played leading roles in the ‘affair’. For services rendered they were, all three, handsomely rewarded: Arbour, as already mentioned, with promotion as Supreme Court Justice and thence as UN High Commissioner for Human Rights; Baril with promotion to Chief of Staff of the Canadian Armed Forces (in Sept. 1997), and Dallaire with appointment as Canadian Senator for life.

Of the three, however, Dallaire’s role is particularly noteworthy, for it is he who has, ever since, been portrayed, and portrayed himself, as a hero in the Rwandan tragedy; and who has, as such, been pre-eminently involved in spreading and maintaining the Big Lie with respect to it. Dallaire’s 2003 epic, Shake Hands With the Devil,[17] an ironically named Faustian tract, fails spectacularly to elucidate the author’s otherwise well documented actions during the events.

It is well established, for instance, that Dallaire knew of – and, effectively, facilitated – the build-up of RPF forces inside Kigali prior to Habyarimana’s assassination. It is well established that Dallaire, rather than reporting to and receiving orders from the UN, as was his mandate, was, instead, reporting and receiving instructions from American military commanders. It is also a fact that Dallaire, only two months prior to the assassination of Habyarimana, closed down one of the only two runways[18] into Kigali airport – upon request of the RPF. It is also the case that Dallaire covered up the massacre by the RPF of MRND people elected in by-elections in the north of Rwanda in November, 1993. Evidence presented at the ICTR further implicates Dallaire in supplying intelligence to Kagame and the RPF forces throughout the period leading up to April 6, 1994.

Whenever Dallaire has faced formal questioning regarding his actions in Rwanda his testimony has been strictly managed and censored. Attempts by independent journalists and investigators to interview and question him have met with refusal and/or silence. And those questions are many and serious. Apart from the items already listed, they include:

How did the lady prime minister, Agathe Uwilingiyimana, come to be murdered at the UN development compound (the morning after Habyarimana had been assassinated) just a short time after he, Dallaire, arrived there? Why did he do nothing to save the lives of the Belgian UN soldiers – suspected of being the team that shot down Habyarimana’s plane – who were subsequently killed at Camp Kigali? Why, and under whose command, did Belgian army units in certain strategic positions in Kigali abandon them and all their weapons to the RPF? Why did UN army units attack MRND army units, but never the RPF? Why did he fail to report that US forces, using Hercules C-130 aircraft, were supplying men and weapons to the RPF? Why, when Dallaire had his headquarters at Amahoro stadium in Kigali after April 6 through the rest of the month, did he allow RPF forces to enter and subsequently murder Hutu refugees who had fled there for safety? And, of course, why did he lie about the ‘genocide fax’ of January 11, 1994?

Still, all in all, Dallaire was merely a bit player in a much larger drama, a drama written and produced in Washington, D.C.

Of Credibility and Credulity

In the two decades that have elapsed since the overthrow of the Rwandan government – and the subsequent killing of millions of it’s peoples, and those millions more killed in the Congo – the Big Lie has flourished virtually unabated. Though the likes of Robin Philpot (‘Rwanda and the New Scramble for Africa’), and Ed Herman and David Peters (‘The Politics of Genocide’) have, of late, lent this revised narrative a slightly higher profile, more generally – and notably amongst the Left – the ‘official’ narrative of Rwanda circa 1994 continues to hold sway. So much so that Rwanda has become, in Philpot’s resonant phrasing, “a useful imperial fiction”, i.e. a shining example of the ‘need for intervention’ that is deployed whenever and wherever ‘humanitarian imperialism’ seeks to invade and destroy nations opposed to it.

It need not be so. At the very least amongst the Left, it should never have been so. In the early days of the Rwandan debacle, one anomalous event stands out like the proverbial sore thumb transparently pointing the way to what was really ‘going down’ in the beleaguered nation. That event was the majority withdrawal in May of 1994 of the UN troops stationed in Rwanda, i.e. essentially clearing the way for the unobstructed overthrow of the government. This one item alone, irrespective of the fact that the corporate media habitually lies about virtually all matters of significant political import, should have tipped off observers of the Great Game to the idea that something rotten was taking place in the state of Rwanda. But it didn’t. And that, given what subsequently transpired in Yugoslavia and later Libya – where again, significant sectors of the Left bought into the official narrative – and given what is today transpiring in Syria and Ukraine, is problematic.

If there is one lesson, then, that we can take from the tragic events adumbrated herein – and, though hardly new, is a notion that bears vigorously reinforcing – it is that whatever information is fed us by the state and by the corporate mass media with regard to fundamental global strategic happenings, the only historically consistent and logical stance to take is to assume that the truth lies 180 degrees in the opposite direction. This should be our default position, until proof is rendered otherwise, in every instance.

In the meantime, to bear witness to the truth of what really happened in Rwanda falls to you. As Noam Chomsky once wrote with regard to an earlier suite of imperial crimes, ‘For yours is an historic mission, and one you should not soon forget.’

Notes:

[1] Servicing the capital city of Rwanda, Kigali.
 
[2] The US Army’s elite, commander general staff college devoted to the high-level planning of invasion scenarios.
 
[3] This despite Museveni never having held an election from the time he shot his way into power in the mid 80s up to the present day.
 
[4] Ndadaye had won the country’s first free elections, and in the aftermath of his murder, 250,000 Hutus were massacred by the Tutsi army of Burundi, and hundreds of thousands fled to Rwanda.
 
[5] One of these is Abdul Ruzibiza, former comrade-in-arms of Kagame and lieutenant in the RPF. After defecting he published a book in French (2005) accusing the RPF of having committed systematic massacres. In addition, defections from the present regime include, amongst many former high-level government figures, two former Prime Ministers, Faustin Twagiramungu and Pierre Celestin Rwigema.
 
[6] Assassinations by RPF agents of opponents to the regime have been many. Of note, however, two priests from Quebec, Claude Simard and Guy Pinard, were murdered Oct. 94 and Feb. 97 respectively. In addition, and rather chillingly, it is a matter of public record that a very long ‘hit list’ targeting opponents is, to this very day, sponsored by the Kagame regime.
 
[7] Unlike the famous Nuremberg tribunal, the ICTR omits any reference to wars of aggression or foreign intervention (the ‘supreme international crime’ according to Nuremberg), and so, effectively, condones them. Moreover, the refusal to consider who instigated the war essentially runs cover for the instigators.
 
[8] More fully, “The genocide in Rwanda was 100% the responsibility of the Americans….The United States, with the energetic support of Great Britain, did everything they could to prevent the UN from sending troops to Rwanda to stop the fighting. And they succeeded”.
 
[9] The exact numbers have never been definitively established. Initial reports claiming 800,000 were mostly pulled out of a hat. Still, later research (including testimony before the ICTR from former RPF officers themselves) seem to indicate that in the months following Habyarimana’s assassination, the numbers were, at the least, in the many hundreds of thousands, and possibly as high as two million. Hundreds of thousands of Hutus were also forced back to Rwanda at gunpoint starting in November of 1996, and hundreds of thousands more (possibly more than a million) were subsequently pursued and killed in the forests of the Congo. The Congolese themselves, of course, have suffered many millions (i.e. 5 to 10) killed in the US-backed RPF/Ugandan invasion and plundering of the east of the country since 1996.
 
[10] Evidence of this can be witnessed in the bilateral agreement that Rwanda, under Kagame, signed with the United States in 2003, giving each other immunity from prosecution; the former before the ICTR, and the latter before the International Criminal Court. Rwanda was also the only African country to back the US invasion of Iraq that same year. Moreover, much of the plunder of the Congo has since been funneled to the West through Kigali.
 
[11] For an interview of Rusesabagina (by Keith Harmon Snow) go to: http://www.allthingspass.com/uploads/html-191The%20Grinding%20Machine%20interview%20with%20Paul%20Rusesabagina%20FINAL.htm
 
[12] That is, no government minister or military officer has, of the time of writing, been convicted of conspiracy to commit genocide. Of the 60 or so high-ranking members of the government that have been indicted, roughly a dozen have been acquitted, whilst the rest remain – twenty years after the event – on trial. Ordinary Hutu prisoners have been, through various legally illegitimate means, i.e. duress, threat, deception etc, induced to plead guilty. But again, no convictions bearing on the crime of ‘genocide’ has ever taken place. Moreover, the full extent of the criminality of the court setup and proceedings at the ICTR (even to the extent of assassinations of witnesses under UN custody) is worthy of an essay in and of itself. Indeed, the latter can be had (by contacting the author) vis a vis a paper, currently in manuscript, by ICTR defense lawyer Christopher C. Black  (the ‘Rhodes Address’), and soon to be delivered in Rhodes, Greece.
 
[13] The case of the ‘genocide fax’ occupies a particularly important place in the ‘official’ narrative in as much as this was the only purported document, skimpy as it was, testifying to some measure of MRND conspiracy to a planned genocide. So important to the official storyline, in fact, that the ‘fax’ continues – despite having been exposed as a forgery before the ICTR – to be trotted out and adduced as ‘evidence’ to this very day.
 
[14] Specifically, ‘The ICTR vs General Augustin Ndindiliyimana’. Christopher C. Black was the lead defense counsel for Ndindiliyimana, the latter, having occupied the role of Chief of Staff of the Rwandan Gendamerie during the period in question. Ndindiliyimana was, just recently, acquitted of all charges at the ICTR.
 
[15] It was proved that this fake fax was put in UN files (to replace the original fax) by British Army Colonel, R.M. Connaughton, on November 28, 1995.
 
[16] Though special ‘commendation’ should go to Philip Gourevitch of the New Yorker, who was instrumental in propagandizing on behalf of the Clinton Administration and the RPF. Gourevitch was also the brother-in-law of Jamie Rubin, the right-hand man of, then, US Secretary of State, Madeleine Albright.
 
[17] Dallaire published his book three years after another Canadian author, Carol Off, published her hagiography (‘The Lion, The Fox and The Eagle’) on Dallaire, Arbour and Lewis Mackenzie. Both Dallaire and Off, it turns out, relied on the same ghostwriter / researcher, Sian Cansfield, whence the existence of passages of the first volume lifted straight into the second. Both belong on the fiction list.
 
[18] More accurately, one of the two axes of the one runway was closed.

Polish President Bronislaw Komorowski announced on Friday the official formation of a joint military unit that will include Ukrainian and Lithuanian armed forces. Known as the Lithuania-Poland-Ukraine Brigade (LITPOLUKRBRIG), the new unit of approximately 4,500 soldiers will be based near the Ukrainian border in Lublin, Poland. The unit is scheduled to begin its first exercises sometime in the next year.

The formation of the LITPOLUKRBRIG was initially agreed to in late 2009, but the plans were scuttled after the election of Victor Yanukovych in Ukraine in February 2010. Yanukovych, who was more closely aligned with Russia, was ousted in a right-wing coup in February of this year after he refused to sign an association agreement with the European Union.

The formation of the unit was announced in the wake of Ukrainian President Petro Poroshenko’s bellicose speech before a joint session of the US Congress and the ratification of the Association Agreement by the European and Ukrainian parliaments.

After the deal was officially inked by the three countries’ defense ministers, Komorowski said that the tripartite unit was “part of a wider plan to support Ukraine, among others, in the area of modernization.”

A spokesman for the Polish Defense Ministry also told reporters that while the unit would initially function as a peacekeeping force, it could serve as the nucleus for the development of a NATO battle group at some point in the future.

The right-wing, pro-Western government that has been established in Ukraine, under the leadership of Poroshenko, has been pressing for closer military ties with the United States and other NATO member states in Eastern Europe.

Lithuania became a full member of NATO in 2004. Under Article Five of the NATO treaty, which stipulates that an attack on one member is an attack on all, the United States and all other NATO states are committed to defending the Baltic States, including Lithuania, if they come under attack.

This creates the conditions where, if the newly formed unit comes under attack as part of operations in Ukraine, it could be used to trigger an Article Five response from the US and other NATO countries in Western Europe against Russia.

Last month Lithuanian President Dalia Grybauskaite stated that as a result of its alleged intervention in Ukraine in support of the separatists, Russia was “in a state of war against Europe.”

Fighting in Ukraine between Kiev-backed forces and pro-Russian separatists in the east is being used to justify an increased militarization of NATO countries in Eastern Europe as well as a campaign of economic sanctions against Russia. The official formation of the new unit is just one part of this reckless campaign being carried out by the US, European Union and NATO which threatens the possibility of war with Russia.

At the NATO summit in Wales earlier this month, alliance members agreed on plans to create a new rapid response force of approximately 4,000 soldiers that would be stationed on a rotating basis in member states that border Russia. US President Barack Obama gave an inflammatory speech in Estonia on September 3 in which he pledged America’s “eternal assistance” to the Baltic States.

On Friday, NATO also began military exercises off the coast of Romania in the Black Sea. Canada’s HMCS Toronto and Spain’s ESPS Almirante Juan de Borbón will be participating in the NATO exercise and will be stationed in the port at Varna, Bulgaria until Monday.

The Rapid Trident military exercises led by the Ukrainian armed forces and involving the US and other NATO member states are also ongoing in western Ukraine and are scheduled to conclude on September 26.

While NATO is increasing its military activities in Eastern Europe, the Contact Group on the Crisis in Ukraine—composed of representatives of Ukraine, Russia, pro-Russian separatists and the Organization for Security and Cooperation in Europe (OSCE)—met again in Minsk, Belarus. The parties are working to implement a peace deal and maintain a fragile cease fire that was implemented on September 5.

Former Ukrainian President Leonid Kuchma, representing Kiev, said that he expected “some movement forward from this meeting.” Russia’s Ambassador to Ukraine, Mikhail Zurabov, stated that “some important decisions could be adopted, which could make previous agreements more viable.”

In addition to the Contact Group meeting in Minsk, three-way talks between Ukraine, Russia, and the EU aimed at resolving an ongoing gas pricing dispute are scheduled to begin next Friday. The Russian energy company Gazprom halted deliveries of natural gas to Ukraine in June after talks over Kiev’s debt to the company collapsed and the regime refused to agree to pay immediately for new gas deliveries.

Russian Energy Minister Alexander Novak told reporters that Ukraine would not have to pay its $5.3 billion gas debt all at once. He also made clear that Russia was prepared to lower the price of natural gas from $485 to $385 per 1,000 cubic meters.

While the situation in eastern Ukraine was relatively calmer on Friday, several weeks of intermittent artillery shelling in and around the city of Donetsk have threatened to break the ceasefire. The Donetsk City Council reported one civilian death, and the Ukrainian military reported that two of its soldiers had been killed.

Since the implementation of the ceasefire, dozens of civilians have been killed or wounded by indiscriminate artillery fire. According to the United Nations, at least 2,900 people have lost their lives since Kiev began its crackdown on pro-Russian separatists in April. The UN also estimates that as many as 1 million people have been displaced by fighting in the Donbass region.

Yesterday, Israel’s Supreme Court dismissed a petition by Adalah: The Legal Center for Arab Minority Rights in Israel effectually facilitating the Judaization of more Palestinian owned land inside Israel. According to Adalah, the court’s decision holding up Israel’s Admissions Committees Law, “entrenches racial segregation; 434 small communities in Israel, or 43% of all residential areas, will be allowed to close their doors to Palestinian Arab citizens of the state.” Much of the land in question was originally confiscated from Palestinian refugees, and the court’s decision will result in the continued concentration and containment of the Palestinian population in Israel.

In March 2011, the Knesset passed two racist laws, the “Nakba Law” and the “Admissions Committees Law”, the latter granting legal legitimacy to “admission committees” in small towns, many agricultural, with fewer than 400 families in the Naqab and the Galilee to “have the full discretion to accept or reject individuals who wish to live in these towns.” The committees consisting of town residents include a member of the Jewish Agency, the World Zionist Organization, or other “quasi” government representative are able, in practice, to “filter out Arab Palestinian applicants and others from marginalized groups,“.

On March 30, 2011 Adalah filed a petition to the Supreme court of Israel demanding the cancellation of the racist law arguing:

The petitioners argued that the law allows admission committees to reject any person on the basis of his or her national belonging, sexual preference, and even on health grounds. It would also allow an admission committee to reject an Arab applicant because his or her culture different from that of the majority of persons living in a community town.

The Admission Committees Law violates Israeli domestic law and international law, which prohibit discrimination against any person who does not belong to the dominant group in society, by legitimizing the exclusion of entire groups on the basis that he or she is not suited to the “social/cultural fabric” of a community town. Specifically, the law is contrary to the Israeli Basic Law: Human Dignity and Freedom and violates basic constitutional rights, as well as the rights to privacy and to freedom to choose one’s place of residence without arbitrary restriction.

Following the court’s decision upholding the law, Suhab Bishara, the attorney for the petitioners and director of the Land and Planning Unit at Adalah issued a statement through the Institute for Middle East Understanding (IMEU) saying, “The Court’s recent decisions confirm that Palestinian citizens of Israel have no constitutional guarantees or protections of their housing rights. The Court has approved the policy of Israeli  government institutions to exclude Arabs from Jewish-only communities that are built on state land or to evict them in order to establish new Jewish communities in their place. The state claims that the communities are for the ‘general public,’ but it is clear in both policy and law that Arab citizens of Israel are not included in that definition.”

When the law was first passed in 2011 Human Rights Watch Middle East Director Sarah Leah Whitson stated the Admissions Committees Law “sanctioned discrimination”, essentially authorizing Jewish-majority communities to reject Palestinian citizens of Israel applicants for residency status, and chastised Israeli politicians “Israeli parliamentarians should be working hard to end glaring inequality, not pushing through discriminatory laws to control who can live where”.  Whitson echoed that harsh response in a comment on the court’s dismissal of Adalah’s petition: “Israel’s Supreme Court today missed a chance to overturn a law whose sponsors sought to enable Jewish communities to prevent Palestinian-Israeli citizens from living among them. The majority said it needed to wait for the law to be implemented, but a law aimed at facilitating ethnic discrimination should be treated as unlawful on its face.”

Here’s yesterday’s press release from Adalah:

(Haifa, Israel) Today, 17 September 2014, in a 5 to 4 decision, an expanded panel of the Israeli Supreme Court decided to dismiss a petition brought by Adalah three years ago against the “Admissions Committees Law”. The law allows for hundreds of Israeli Jewish communities in the Naqab (Negev) in the south and in the Galilee in the north to reject applicants for housing based on the criteria of “social suitability” and the “social and cultural fabric” of the town.

The law allows the possibility of rejecting applicants who are Palestinian Arab citizens of Israel, as well as other marginalized groups, solely on the basis of their race, ethnicity, religion, or other identity. The court’s decision effectively legalizes the principle of segregation in housing between Arab and Jewish citizens, and permits the practice of racism against Arab citizens in about 434 communities, or 43% of all towns in Israel. The Association for Civil Rights in Israel (ACRI) also filed a petition against this law.

In response, Adalah stated that the Court’s decision, “gives the green light for 434 communities to exist based on the principle of segregated housing. This law is one of the most racist pieces of legislation enacted in recent years, the primary objective of which is to marginalize Arab citizens and prevent them from accessing housing on ‘state land’ in many communities. The court’s decision upholds one of the most dangerous laws in Israel.”

Adalah Attorney Suhad Bishara, who filed the petition, added that: “The court’s decision seriously undermines its landmark decision in 1999 in the Ka’adan case. That case allowed an Arab family to move to the town of Katzir despite their rejection by the town’s admissions committee. This latest court decision illustrates the continued deterioration of the constitutional rights and legal protection of Palestinian citizens of Israel.” Attorney Bishara further stated that the new decision, “allows the principle of separation in residency based on national identity, and as such, 434 communities will be allowed to close their doors to Arab citizens.”

The Admissions Committees Law, enacted by the Knesset in 2011, gives “admissions committees” – bodies that select applicants for housing units and plots of land – almost full discretion to accept or reject individuals from living in these towns. The committees include a representative from the Jewish Agency or the World Zionist Organization, quasi-governmental entities. The Committees, in practice, filter out Arab Palestinian applicants and others from marginalized groups. While one of the provisions of the law states a duty to respect the right to equality and prevent discrimination, the law allows these committees to reject applicants deemed “unsuitable to the social life of the community…or the social and cultural fabric of the town,” thereby legitimizing the exclusion of entire groups. The law also authorizes admissions committees to adopt criteria determined by individual community towns themselves based on their “special characteristics”, including those community towns that have defined themselves as having a “Zionist vision.”

In the last hearing on the case before the Supreme Court on 4 December 2012, Attorney Bishara argued that, “the law marginalizes certain groups, creating a legal, constitutional, and legitimate basis for discrimination. The law allows for division of state land based on vague cultural and social standards – and not even the state can explain which criteria admissions committees could use to accept or reject candidates. The law will open the door to arbitrary decisions based on prejudices and personal grudges.”

Attorney Bishara added after that hearing that, “The law is functioning the same way it did previously as a policy, deterring many segments of the population, especially Palestinian Arab citizens of the state, from applying for housing in these towns for fear of rejection. The law has serious implications now and has had for many years, so it is not possible to say that it is not ripe for judicial ruling.”

This statement by Yousef Munayyer, Executive Director of the Jerusalem Fund and the Palestine Center in Washington, DC, and Palestinian citizen of Israel, perfectly reflects why Israel, a state that gives legal preference to one ethnicity under the law, does not share U.S. values:

“The upholding of this law means that the Israeli court system, along with the state, supports the practice of segregation within Israel and against Israeli citizens of Palestinian origin. For state-sanctioned and partially controlled committees to be able to deny residence within communities to certain citizens effectively based on their religion, race or ethnic origin is unthinkable in the United States – such a racist law would be shot down by the US Supreme Court because of constitutional guarantees against discrimination. But it has now been approved by the highest court in Israel. The talk of ‘shared values’ grows more farcical and the mask covering the face of an Apartheid system falls further by the day, making the ugly reality easier for the world to see.”

For more history on the Israeli legislation and court decisions precipitating today’s court decision see this Mondoweiss post, The historical context of the Israeli land and planning law regime:

Only 2.5% of land in Israel is under the control of a Palestinian controlled planning authority. [31] Moreover, in spite of a sixteen-fold increase in the built-up areas of Palestinian communities since the British Mandate, the average area of jurisdiction of Palestinian cities and local councils has, in that time, decreased by 45%. [32] Therefore, as Bimkom has stated, most Arab localities are dependent on decisions made by planning commissions which are, for the most part, devoid of Palestinian representation. [33]

Note: This report was originally published in 2010. It is of utmost relevance to the ongoing debate on climate change. .

Link to Complete 321-Page PDF Special Report

More than 1,000 dissenting scientists (updates previous 700 scientist report) from around the globe have now challenged man-made global warming claims made by the United Nations Intergovernmental Panel on Climate Change (IPCC) and former Vice President Al Gore. This new 2010 321-page Climate Depot Special Report — updated from the 2007 groundbreaking U.S. Senate Report of over 400 scientists who voiced skepticism about the so-called global warming “consensus” — features the skeptical voices of over 1,000 international scientists, including many current and former UN IPCC scientists, who have now turned against the UN IPCC. This updated 2010 report includes a dramatic increase of over 300 additional (and growing) scientists and climate researchers since the last update in March 2009. This report’s release coincides with the 2010 UN global warming summit in being held in Cancun.

The more than 300 additional scientists added to this report since March 2009 (21 months ago), represents an average of nearly four skeptical scientists a week speaking out publicly. The well over 1,000 dissenting scientists are almost 20 times the number of UN scientists (52) who authored the media-hyped IPCC 2007 Summary for Policymakers.

The chorus of skeptical scientific voices grew louder in 2010 as the Climategate scandal — which involved the upper echelon of UN IPCC scientists — detonated upon on the international climate movement. “I view Climategate as science fraud, pure and simple,” said noted Princeton Physicist Dr. Robert Austin shortly after the scandal broke. Climategate prompted UN IPCC scientists to turn on each other. UN IPCC scientist Eduardo Zorita publicly declared that his Climategate colleagues Michael Mann and Phil Jones “should be barred from the IPCC process…They are not credible anymore.”

Zorita also noted how insular the IPCC science had become. “By writing these lines I will just probably achieve that a few of my future studies will, again, not see the light of publication,” Zorita wrote. A UN lead author Richard Tol grew disillusioned with the IPCC and lamented that it had been “captured” and demanded that “the Chair of IPCC and the Chairs of the IPCC Working Groups should be removed.” Tol also publicly called for the “suspension” of IPCC Process in 2010 after being invited by the UN to participate as lead author again in the next IPCC Report. [Note: Zorita and Tol are not included in the count of dissenting scientists in this report.]

Other UN scientists were more blunt. A South African UN scientist declared the UN IPCC a “worthless carcass” and noted IPCC chair Pachauri is in “disgrace”. He also explained that the “fraudulent science continues to be exposed.” Alexander, a former member of the UN Scientific and Technical Committee on Natural Disasters harshly critiqued the UN. “‘I was subjected to vilification tactics at the time. I persisted. Now, at long last, my persistence has been rewarded…There is no believable evidence to support [the IPCC] claims. I rest my case!” See: S. African UN Scientist Calls it! ‘Climate change – RIP: Cause of Death: No scientifically believable evidence…Deliberate manipulation to suit political objectives’ [Also see: New Report: UN Scientists Speak Out On Global Warming -- As Skeptics!] Geologist Dr. Don Easterbrook, a professor of geology at Western Washington University, summed up the scandal on December 3, 2010: “The corruption within the IPCC revealed by the Climategate scandal, the doctoring of data and the refusal to admit mistakes have so severely tainted the IPCC that it is no longer a credible agency.”

Selected Highlights of the Updated 2010 Report featuring over 1,000 international scientists dissenting from man-made climate fears:

“We’re not scientifically there yet. Despite what you may have heard in the media, there is nothing like a consensus of scientific opinion that this is a problem. Because there is natural variability in the weather, you cannot statistically know for another 150 years.”

— UN IPCC’s Tom Tripp, a member of the UN IPCC since 2004 and listed as one of the lead authors and serves as the Director of Technical Services & Development for U.S. Magnesium.

“Any reasonable scientific analysis must conclude the basic theory wrong!!” — NASA Scientist Dr. Leonard Weinstein who worked 35 years at the NASA Langley Research Center and finished his career there as a Senior Research Scientist. Weinstein is presently a Senior Research Fellow at the National Institute of Aerospace.

“Please remain calm: The Earth will heal itself — Climate is beyond our power to control…Earth doesn’t care about governments or their legislation. You can’t find much actual global warming in present-day weather observations. Climate change is a matter of geologic time, something that the earth routinely does on its own without asking anyone’s permission or explaining itself.”

— Nobel Prize-Winning Stanford University Physicist Dr. Robert B. Laughlin, who won the Nobel Prize for physics in 1998, and was formerly a research scientist at Lawrence Livermore National Laboratory.

“In essence, the jig is up. The whole thing is a fraud. And even the fraudsters that fudged data are admitting to temperature history that they used to say didn’t happen…Perhaps what has doomed the Climategate fraudsters the most was their brazenness in fudging the data”

— Dr. Christopher J. Kobus, Associate Professor of Mechanical Engineering at Oakland University, specializes in alternative energy, thermal transport phenomena, two-phase flow and fluid and thermal energy systems.

“The energy mankind generates is so small compared to that overall energy budget that it simply cannot affect the climate…The planet’s climate is doing its own thing, but we cannot pinpoint significant trends in changes to it because it dates back millions of years while the study of it began only recently. We are children of the Sun; we simply lack data to draw the proper conclusions.”

— Russian Scientist Dr. Anatoly Levitin, the head of geomagnetic variations laboratory at the Institute of Terrestrial Magnetism, Ionosphere and Radiowave Propagation of the Russian Academy of Sciences.

“Hundreds of billion dollars have been wasted with the attempt of imposing a Anthropogenic Global Warming (AGW) theory that is not supported by physical world evidences…AGW has been forcefully imposed by means of a barrage of scare stories and indoctrination that begins in the elementary school textbooks.”

— Brazilian Geologist Geraldo Luís Lino, who authored the 2009 book “The Global Warming Fraud: How a Natural Phenomenon Was Converted into a False World Emergency.”

“I am an environmentalist,” but “I must disagree with Mr. Gore” — Chemistry Professor Dr. Mary Mumper, the chair of the Chemistry Department at Frostburg State University in Maryland, during her presentation titled “Anthropogenic Carbon Dioxide and Global Warming, the Skeptic’s View.”

“I am ashamed of what climate science has become today.” The science “community is relying on an inadequate model to blame CO2 and innocent citizens for global warming in order to generate funding and to gain attention. If this is what ‘science’ has become today, I, as a scientist, am ashamed.”

— Research Chemist William C. Gilbert published a study in August 2010 in the journal Energy & Environment titled “The thermodynamic relationship between surface temperature and water vapor concentration in the troposphere” and he published a paper in August 2009 titled “Atmospheric Temperature Distribution in a Gravitational Field.” [Update December 9, 2010]

“The dysfunctional nature of the climate sciences is nothing short of a scandal. Science is too important for our society to be misused in the way it has been done within the Climate Science Community.” The global warming establishment “has actively suppressed research results presented by researchers that do not comply with the dogma of the IPCC.”

— Swedish Climatologist Dr. Hans Jelbring, of the Paleogeophysics & Geodynamics Unit at Stockholm University. [Updated December 9, 2010. Corrects Jelbring's quote.]

“Those who call themselves ‘Green planet advocates’ should be arguing for a CO2- fertilized atmosphere, not a CO2-starved atmosphere…Diversity increases when the planet was warm AND had high CO2 atmospheric content…Al Gore’s personal behavior supports a green planet – his enormous energy use with his 4 homes and his bizjet, does indeed help make the planet greener. Kudos, Al for doing your part to save the planet.”

— Renowned engineer and aviation/space pioneer Burt Rutan, who was named “100 most influential people in the world, 2004″ by Time Magazine and Newsweek called him “the man responsible for more innovations in modern aviation than any living engineer.”

“Global warming is the central tenet of this new belief system in much the same way that the Resurrection is the central tenet of Christianity. Al Gore has taken a role corresponding to that of St Paul in proselytizing the new faith…My skepticism about AGW arises from the fact that as a physicist who has worked in closely related areas, I know how poor the underlying science is. In effect the scientific method has been abandoned in this field.”

— Atmospheric Physicist Dr. John Reid, who worked with Australia’s CSIRO’s (Commonwealth Scientific and Industrial Research Organization) Division of Oceanography and worked in surface gravity waves (ocean waves) research.

“We maintain there is no reason whatsoever to worry about man-made climate change, because there is no evidence whatsoever that such a thing is happening.” — Greek Earth scientists Antonis Christofides and Nikos Mamassis of the National Technical University of Athens’ Department of Water Resources and Environmental Engineering.

“There are clear cycles during which both temperature and salinity rise and fall. These cycles are related to solar activity…In my opinion and that of our institute, the problems connected to the current stage of warming are being exaggerated. What we are dealing with is not a global warming of the atmosphere or of the oceans.”

— Biologist Pavel Makarevich of the Biological Institute of the Russian Academy of Sciences.

“Because the greenhouse effect is temporary rather than permanent, predictions of significant global warming in the 21st century by IPCC are not supported by the data.” — Hebrew University Professor Dr. Michael Beenstock an honorary fellow with Institute for Economic Affairs who published a study challenging man-made global warming claims titled “Polynomial Cointegration Tests of the Anthropogenic Theory of Global Warming.”

“The whole idea of anthropogenic global warming is completely unfounded. There appears to have been money gained by Michael Mann, Al Gore and UN IPCC’s Rajendra Pachauri as a consequence of this deception, so it’s fraud.” — South African astrophysicist Hilton Ratcliffe, a member of the Astronomical Society of Southern Africa (ASSA) and the Astronomical Society of the Pacific and a Fellow of the British Institute of Physics.

End of Selected Excerpts

#

The rapidity of the global warming establishment’s collapse would have been unheard of just two years ago. Prominent physicist Hal Lewis resigned from American Physical Society, calling “Global warming the greatest and most successful pseudoscientific fraud I have seen in my long life.” UK astrophysicist Piers Corbyn was blunt about what Climategate revealed: “The case for climate fears is blown to smithereens…the whole theory should be destroyed and discarded and UN conference should be closed.”

Even the usually reliable news media has started questioning the global warming claims. Newsweek Magazine wrote in May 2010 about the “uncertain science” and how “climate researchers have lost the public’s trust” from a “cascade of scandals” from the UN IPCC. Newsweek compared the leaders of the climate science community to “used-car salesmen. “Once celebrated climate researchers are feeling like the used-car salesmen” and the magazine noted that “some of IPCC’s most-quoted data and recommendations were taken straight out of unchecked activist brochures, newspaper articles…Just as damaging, many climate scientists have responded to critiques by questioning the integrity of their critics, rather than by supplying data and reasoned arguments.” For full list of Climategate related scandals See: Climate Scandals: List Of 94 Climate-Gates — 94 climate-gates total — 28 new gates — 145 links to reports with details

As the global warming edifice crumbled in 2010, the movement lost one of its leading lights due to the Climategate revelations. Dr. Judith Curry, the chair of Earth & Atmospheric Sciences at GA Institute of Tech, explained her defection from the global warming activist movement. “There is ‘a lack of willingness in the climate change community to steer away from groupthink…’ They are setting themselves up as second-rate scientists by not engaging,” Curry wrote in 2010. Curry critiqued the UN IPCC for promoting “dogma” and clinging to the “religious importance” of the IPCC’s claims. “They will tolerate no dissent and seek to trample anyone who challenges them,” Curry lamented. “The IPCC assessment process had a substantial element of schoolyard bullies, trying to insulate their shoddy science from outside scrutiny and attacks by skeptics…the IPCC and its conclusions were set on a track to become a self fulfilling prophecy,” Curry wrote. Curry called the Climategate fallout nothing short of a “rather spectacular unraveling of the climate change juggernaut…I immediately realized that [Climategate] could bring down the IPCC…I became concerned about the integrity of our entire field…While my colleagues seemed focused on protecting the reputations of the scientists involved and assuring people that the ‘science hadn’t changed.” [Note: Curry is not included in the count of dissenting scientists in this report.] Also see: ‘High Priestess of Global Warming’ No More! Former Warmist Judith Curry Admits To Being ‘Duped Into Supporting IPCC’ – ‘If the IPCC is dogma, then count me in as a heretic’] [Note: There were many Cilmategate inquiries that sought to downplay Climategate, but they fell short of their goal and were labeled as nothing more than the "global warming establishment exonerating the global warming establishment." See here, here, and here. The InterAcademy Council (IAC) was the most competent of the inquires.]

As new data and science continued to call into question man-made global warming claims, one of the movements leading fear promoters shocked the world by beginning to retreat from his dire predictions. Green guru James Lovelock warned in 2007 that, “Before this century is over, billions of us will die and the few breeding pairs of people that survive will be in the Arctic.” Lovelock illustrates how the climate of the climate change movement has been transformed in the last year. In May 2010, Lovelock shocked the world by announcing: “Everybody might be wrong. Climate change may not happen as fast as we thought, and we may have 1,000 years to sort it out.” Lovelock went even father by noting how the science of global warming is in its infancy and “we haven’t got the physics worked out yet.” “The great climate science centers around the world are more than well aware how weak their science is. If you talk to them privately they’re scared stiff of the fact that they don’t really know what the clouds and the aerosols are doing. They could be absolutely running the show. We haven’t got the physics worked out yet,” Lovelock explained. Lovelock now openly praises skeptics and worries that climate fear promotion is akin to religion. In March of 2010, Lovelock said: “The skeptics have kept us sane…They have kept us from regarding climate science as a religion. It had gone too far that way.” [Note: Lovelock is not included in the count of dissenting scientists in this report.] [Note: Even the UN has grown more uncertain about the science. See: UN Fears (More) Global Cooling Commeth! IPCC Scientist Warns UN: We may be about to enter 'one or even 2 decades during which temps cool' -- Admits 'Jury is still out' on ocean cycle's temp impact!]

More woes for the movement were felt when left-leaning environmental activists began jumping ship. See: Left-wing Env. Scientist Denis Rancourt Bails Out Of Global Warming Movement: Declares it a ‘corrupt social phenomenon…strictly an imaginary problem of the 1st World middleclass’ & Meet the green who doubts ‘The Science’: Environmentalist Peter Taylor ‘explains why he’s skeptical about manmade global warming — and why greens are so intolerant’ & Activists at green festivals expressing doubts over man-made climate fears. “One college professor, confided to me in private conversation that, ‘I’m not sure climate change is real,’” according to a report from the New York Green Festival.

2010 saw the once vaunted UN IPCC now become the object of ridicule and scrutiny. In June 2010, Climate Scientist Mike Hulme took apart a key claim. Hulme noted that claims such as “2,500 of the world’s leading scientists have reached a consensus that human activities are having a significant influence on the climate” are disingenuous. Hulme noted that the key scientific case for Co2 driving global warming was reached by a very small gaggle of people. “That particular consensus judgment, as are many others in the IPCC reports, is reached by only a few dozen experts in the specific field of detection and attribution studies; other IPCC authors are experts in other fields.” [Note: Hulme is not included in the count of dissenting scientists in this report.]

In another blow to the UN IPCC’s carefully crafted image, was Scientist Dr. William Schlesinger admission in that only 20% of UN IPCC scientists deal with climate. Schlesinger said, “Something on the order of 20 percent [of UN scientists] have had some dealing with climate.” By Schlesinger’s own admission, 80% of the UN IPCC membership has no dealing with the climate as part of their academic studies. Also note, that climate requires a wide range of disciplines: See: ‘There are more than 100 expert sub disciplines involved in climate change studies’ & Science magazine confused about who is a ‘prominent climate scientist’ — ‘there is no specific climate discipline’ & Claims of ‘overwhelming majority’ of scientists exposed as laughable! ‘There are just 94 authors responsible for compiling the report in which…the [UN IPCC's] modeling case for alarm rests’

The notion of climate “tipping points”, popularized by former Vice President Al Gore and NASA Scientist James Hansen, became the object of derision as well in 2010. See: 190-year climate ‘tipping point’ issued — Despite fact that UN began 10-Year ‘Climate Tipping Point’ in 1989! Climate Depot Factsheet on Inconvenient History of Global Warming ‘Tipping Points’ — Hours, Days, Months, Years, Millennium — Earth ‘Serially Doomed’

Once respected global warming stalwarts like NASA’s James Hansen descended into political and ideological activism by being arrested multiple times protesting coal use. Hansen also endorsed a book which calls for ‘”ridding the world of Industrial Civilization”. Hansen declared the author “has it right…the system is the problem.” Hansen did this despite the fact that the book proposes ‘”razing cities to the ground, blowing up dams and switching off the greenhouse gas emissions machine.” The Grist eco-magazine writer David Roberts noted in August 2010: “‘I know I’m not supposed to say this, but James Hansen managed his transition from scientist to activist terribly. All influence lost.”

Energy Sec. Chu came under fire for claiming science told him what the world was going to be like 100 years from now. See: Obama’s ‘Climate Astrologer’: Energy Sec. Chu claims he knows ‘what the future will be 100 years from now’

Obama Science Advisor John Holdren found his knowledge of the science of climate change come under scrutiny after he issued a bizarre warning about the possible loss of WINTER sea ice in the arctic. See: Obama science advisor: John Holdren ridiculed for claiming Arctic could be ICE FREE IN WINTER!

The U.S. Congressional cap-and-trade bill collapse and the UN climate treaty failure has left disillusioned within the global warming movement. Gore has admitted to feeling “a little depressed.” And it has left a spectacle of world leaders promising verbal non-binding agreements to limit the earth’s temp have left modern society attempting to ape primitive cultures efforts to control the climate. See: Blaming all recent weather events on man-made global warming is akin to astrology & Climate Astrology — ‘It Has Been Foretold’ of Extreme Weather: ‘UN IPCC science has a status similar to interpretations of Nostradamus and the Mayan calendars’

In addition, the scientific underpinnings and the public support around the globe has dropped so significantly that there is now open talk of moving on to the “next eco-scare” Demoted: UN officially throws global warming under the bus: UN now says case for saving species ‘more powerful than climate change’ – May 21, 2010 & Time for next eco-scare already?! As Global Warming Movement Collapses, Activists Already ‘Test-Marketing’ the Next Eco-Fear! ‘Laughing Gas’ Crisis? Oxygen Crisis? Plastics?

The carefully crafted “consensus” of man-made global warming has unraveled. See:

Prominent Geologist Dr. Easterbrook Slams Geological Society of America’s climate statement ‘as easily refuted by data that clearly shows no correlation between CO2 and global climate change’ & American Meteorological Society Members Reject Man-made Climate Claims: 75% Do Not Agree With UN IPCC Claims — 29% Agree ‘Global Warming is a Scam’ & Meteorologists Reject U.N.’s Global Warming Claims: Only 1 in 4 American Meteorological Society broadcast meteorologists agree with UN

In 2009, the world’s largest science group, the American Chemical Society (ACS) was “startled” by an outpouring of scientists rejecting man-made climate fears, with many calling for the removal of the ACS’s climate activist editor.

A 2010 Open Letter signed by more than 130 German scientists urging German Chancellor to “reconsider” her climate views. See: ‘Consensus’ Takes Another Hit! More than 130 German Scientists Dissent Over Global Warming Claims! Call Climate Fears ‘Pseudo ‘Religion’; Urge Chancellor to ‘reconsider’ views – August 4, 2009 More than 100 international scientists challenged President Obama’s climate claims, calling them “simply incorrect.” In December 8 2009, 166 scientists from around the world wrote an Open Letter to the UN Secretary-General rebuking the UN and declaring that “the science is NOT settled.” On May 1, 2009, the American Physical Society (APS) Council decided to review its current climate statement via a high-level subcommittee of respected senior scientists. The decision was prompted after a group of over 80 prominent physicists petitioned the APS revise its global warming position and more than 250 scientists urged a change in the group’s climate statement in 2010. The physicists wrote to APS governing board: “Measured or reconstructed temperature records indicate that 20th – 21st century changes are neither exceptional nor persistent, and the historical and geological records show many periods warmer than today.” An American Physical Society editor conceded that a “considerable presence” of scientific skeptics exists.

Russian scientists “rejected the very idea that carbon dioxide may be responsible for global warming”. India Issued a report challenging global warming fears. International Scientists demanded the UN IPCC “be called to account and cease its deceptive practices,” and a 2008 canvass of more than 51,000 Canadian scientists revealed 68% disagree that global warming science is “settled.”

Scientific meetings are being dominated by a growing number of skeptical scientists. The prestigious International Geological Congress, dubbed the geologists’ equivalent of the Olympic Games, was held in Norway in August 2008 and prominently featured the voices of scientists skeptical of man-made global warming fears. [See: Skeptical scientists overwhelm conference: '2/3 of presenters and question-askers were hostile to, even dismissive of, the UN IPCC' & see full reports here & here - Also see: UN IPCC's William Schlesinger admits in 2009 that only 20% of IPCC scientists deal with climate ]

Despite these developments, global warming promoters have sought to cite a survey alleging 97% of climatologists agree with the “consensus” view. But the survey does not hold up to scrutiny. See: ‘Consensus’ claims challenged: Only 77 scientists were interviewed to get 97.4% agreement — ‘It would be interesting to learn who these individuals are’ & Climate Con: 97% ‘Consensus’ Claim is only 76 Anonymous Self-Selected Climatologists

#

This Climate Depot Special Report is not a “list” of scientists, but a report that includes full biographies of each scientist and their quotes, papers and links for further reading. The scientists featured in the report express their views in their own words, complete with their intended subtleties and caveats. This report features the names, biographies, academic/institutional affiliation, and quotes of literally hundreds of additional international scientists who publicly dissented from man-made climate fears. This report lists the scientists by name, country of residence, and academic/institutional affiliation. It also features their own words, biographies, and web links to their peer reviewed studies, scientific analyses and original source materials as gathered from directly from the scientists or from public statements, news outlets, and websites in 2007 and 2008.

The distinguished scientists featured in this new report are experts in diverse fields, including: climatology; geology; biology; glaciology; biogeography; meteorology; oceanography; economics; chemistry; mathematics; environmental sciences; astrophysics, engineering; physics and paleoclimatology. Some of those profiled have won Nobel Prizes for their outstanding contribution to their field of expertise and many shared a portion of the UN IPCC Nobel Peace Prize with Vice President Gore. Additionally, these scientists hail from prestigious institutions worldwide, including: Harvard University; NASA; National Oceanic and Atmospheric Administration (NOAA) and the National Center for Atmospheric Research (NCAR); Massachusetts Institute of Technology; the UN IPCC; the Danish National Space Center; U.S. Department of Energy; Princeton University; the Environmental Protection Agency; University of Pennsylvania; Hebrew University of Jerusalem; the International Arctic Research Centre; the Pasteur Institute in Paris; Royal Netherlands Meteorological Institute; the University of Helsinki; the National Academy of Sciences of the U.S., France, and Russia; the University of Pretoria; University of Notre Dame; Abo Akademi University in Finland; University of La Plata in Argentina; Stockholm University; Punjab University in India; University of Melbourne; Columbia University; the World Federation of Scientists; and the University of London.

Background: Only 52 Scientists Participated in UN IPCC Summary

The notion of “hundreds” or “thousands” of UN scientists agreeing to a scientific statement does not hold up to scrutiny. (See report debunking “consensus” LINK) Recent research by Australian climate data analyst John McLean revealed that the IPCC’s peer-review process for the Summary for Policymakers leaves much to be desired. (LINK) (LINK) (LINK) & (LINK) (Note: The 52 scientists who participated in the 2007 IPCC Summary for Policymakers had to adhere to the wishes of the UN political leaders and delegates in a process described as more closely resembling a political party’s convention platform battle, not a scientific process – LINK)

Proponents of man-made global warming like to note how the National Academy of Sciences (NAS) and the American Meteorological Society (AMS) have issued statements endorsing the so-called “consensus” view that man is driving global warming. But both the NAS and AMS never allowed member scientists to directly vote on these climate statements. Essentially, only two dozen or so members on the governing boards of these institutions produced the “consensus” statements. This report gives a voice to the rank-and-file scientists who were shut out of the process. (LINK)

The NAS has come under fire for its lobbying practices. See: NAS Pres. Ralph Cicerone Turns Science Org. into political advocacy group: $6 million NAS study is used to lobby for global warming bill & Cicerone’s Shame: NAS Urges Carbon Tax, Becomes Advocacy Group — ‘political appointees heading politicized scientific institutions that are virtually 100% dependent on gov’t funding’ MIT’s Richard Lindzen harshly rebuked NAS president Cicerone in his Congressional testimony in November 2010. Lindzen testified: “Cicerone [of NAS] is saying that regardless of evidence the answer is predetermined. If government wants carbon control, that is the answer that the Academies will provide.” [ Also See: MIT Climate Scientist Exposes 'Corrupted Science' in Devastating Critique – November 29, 2008 ]

While the scientists contained in this report hold a diverse range of views, they generally rally around several key points. 1) The Earth is currently well within natural climate variability. 2) Almost all climate fear is generated by unproven computer model predictions. 3) An abundance of peer-reviewed studies continue to debunk rising CO2 fears and, 4) “Consensus” has been manufactured for political, not scientific purposes.

Scientists caution that the key to remember is “climate change is governed by hundreds of factors, or variables,” not just CO2. UK Professor Emeritus of Biogeography Philip Stott of the University of London decried the notion that CO2 is the main climate driver. “As I have said, over and over again, the fundamental point has always been this: climate change is governed by hundreds of factors, or variables, and the very idea that we can manage climate change predictably by understanding and manipulating at the margins one politically-selected factor is as misguided as it gets,” Stott wrote in 2008. Even the climate activists at RealClimate.org let this fact slip out in a September 20, 2008 article. “The actual temperature rise is an emergent property resulting from interactions among hundreds of factors,” RealClimate.org admitted in a rare moment of candor.]

# #

Read Full Report: Link to Complete 321-Page PDF Special Report:

Copyright Climate Depot 2014

This is an excellent detailed analysis of the MH17 tragedy by the Russian Union of Engineers which quite frankly illustrates how heavily censored the Dutch “report” is.

We will let you digest this report and come to your own conclusion, which in all likelihood will explain the infamous high velocity projectiles whitewash pumped out by the western “press”.

This review was undertaken by experts who not only know the subject matter but have objectively presented evidence that must be considered with the legitimacy that is inherent to it. Here is the overall description of the “Analytical Group” from the report:

A group of experts from the Russian Union of engineers was convened to analyze the situation, including reserve officers with experience in the use of anti-aircraft missile systems, as well as pilots having experience with aircraft weapons.This problem was also discussed at a meeting of the Academy of Geopolitical Problems, where many variants were tested and discussed again. In the course of their analysis the experts used materials derived from public sources, found in the media. The situation was also analyzed using a computer simulation of the Su-25.

You can download the English version of the report here.

The original Russian version of the report is here.

Official statement by the Russian Union of Engineers:
(please press on the ‘cc’ button to see the English subtitles)

Special mention, thanks and much gratitude goes to Alice, Gideon & Katya for their wonderful effort at such short notice.
 
Disclaimer:

We have translated the text to the best of our abilities and where unsure have included the original Russian. Additionally, the original Russian report is available for download for your reference. Please distribute freely with acknowledgement.

Copyright the Saker 2014

Europe’s nations should be guided towards the super-state without their people understanding what is happening. This can be accomplished by successive steps, each disguised as having an economic purpose, but which will eventually and irreversibly lead to federation. Jean Monnet (One of the Founders of the EU in a letter to a colleague on April 30th, 1952)

It is more evident that Scotland’s referendum on independence has been “rigged.” Observers from Russia say there was evidence of election fraud according to RIA Novosti based in Moscow.

“According to what our observers at the polling offices tell us, there were more Yes votes during the vote count. Scotland found itself under immense pressure… Those on the UK side campaigning for a No vote resorted to every violation imaginable,” Georgy Fyodorov, the head of the Association for the protection of electoral rights “Civil control.”

Washington and London have a vested interest on Scotland. Elections results were going to be tampered with. The Anglo-American military alliance would prevent any possibility of Scottish Independence under their watch. Scotland is a strategic military location. The British government will call it ‘Democracy in action” and that the Scotland wants to remain united with the crown. “Igor Morozov, a member of the Council of the Federation Committee for Foreign Affairs, said that the results were influenced by “Westminster propaganda” according to the report, “We can see that, with the exception of Glasgow, those supporting independence failed to register a majority. I think that Westminster propaganda played a great part in that.” The London-based Telegraph reported in 2013 that British Prime Minister David Cameron had begun a propaganda war against Scottish Independence when he publically made his case on the history both countries share:

Our nations share a proud and emotional history. Over three centuries we have built world-renowned institutions like the NHS and BBC, fought for freedom and democracy in two World Wars, and pioneered and traded around the world. Our ancestors explored the world together and our grandfathers went into battle together as do our kith and kin today – and this leaves deep, unbreakable bonds between the peoples of these islands.

Scotland lost its bid for independence, even though it was a fraudulent election. The mainstream media especially the BBC will bury it. They will produce stories about the growing threat of ISIS in the Middle East or on the personal life of Prince Harry. After the final tally in Scotland’s referendum vote, 55 percent voted ‘No’ to remain in the union with Great Britain and 45 percent who voted for independence. U.S. President Barack H. Obama said “We have no closer ally than the United Kingdom, and we look forward to continuing our strong and special relationship with all the people of Great Britain and Northern Ireland as we address the challenges facing the world today.”

Scotland’s historic vote after 307 years of British rule has inspired people across Europe and the World. Scotland’s unprecedented vote has inspired other succession movements including Catalonia and Basque country in Spain to Veneto, South Tyrol, and the island of Sardinia in Italy to Flanders in Belgium which concerns the bureaucrats at the European Union’s headquarters in Brussels. Before the elections took place, American politicians such as Hillary Clinton did not support the idea of an independent Scotland when she was quoted in a BBC interview as saying “I would hate to have you lose Scotland. I hope it doesn’t happen, but again I don’t have a vote in Scotland, but I would hope it doesn’t happen.”

Her husband and former US president Bill said “Unity with maximum self-determination sends a powerful message to a world torn by identity conflicts that it is possible to respect our differences while living and working together” he said. “This is the great challenge of our time. The Scots can show us how to meet it.”

Queen Elizabeth also urged the Scottish people to” think very carefully about the future” since it would have political repercussions in the British Empire. After all, the British Empire was never dismantled; it is now behind the scenes.

Make no mistake; Great Britain is still an influential empire. Just like its counterpart in Washington with Puerto Rico and Guam as its territories, it too has colonial possessions although they call it ‘British Overseas territories’ in the Caribbean, South and North Atlantic ocean and elsewhere. It is closely associated with Washington’s global Hegemony or what Dr. Henry Kissinger would call the ‘New World Order.’ Major Powers’ have collaborated with each other on global issues since World War I with the United States, Great Britain, France and the mini-empire of Israel leading the way to a unipolar world ruled by an elite oligarchy.

Empires of the past and present have caused great harm to humanity. Wars, economic exploitation, political control and other destructive devices have brought misery, pain and suffering to every region of the world. The entire continent of Africa is a perfect example which has been ruled by a number of Western empires throughout its history. Scotland is another country that has been colonized by the British for centuries. Mel Gibson’s academy award winning film ‘Braveheart’ depicted the wars fought between England and its vast army and the people of Scotland who were slaves to the English Monarchy in the 12th century.

Why an Independent Scotland is Inconvenient for NATO and American Foreign Policy

What an Independent Scotland would mean for the United States and Great Britain? First, Britain’s nuclear arsenal would no longer be deployed at Faslane, in the west coastline of Scotland were British nuclear-armed submarines are stationed which would weaken NATO’s position in the North Sea and Arctic regions as it would also limit the usage of Scotland’s ports for U.S. submarine fleets. Scotland has been a staging ground for NATO’s defenses including “early warning stations” to supposedly counter a Russian attack. The Scottish National Party (SNP) had rejected the idea that Scotland would serve as a nuclear deterrence by banning nuclear weapons. Scotland would not be able to participate in NATO’s defense by contributing just 2 percent of its GDP to join the organization; NATO would refuse its entry on economic grounds. Scotland would establish its own defense at a cost of £2.5 billion. According to an article by the Telegraph titled ‘Scotland will be powerless to defend itself’ which was written by John McAnally, a former Commandant of the Royal College of Defence Studies. He described Scotland’s military plans if independence were to become a reality:

If the SNP wins independence, it plans to establish a new defence force of some 15,000 regulars and 5,000 reserves. The naval base at Faslane would become the joint headquarters. The Scottish army would include restored infantry regiments, army vehicles, artillery and air defence systems. The air force would have fighter jets, maritime patrols, transport aircraft and helicopters. The navy would include frigates, conventional submarines and marines. There would also be some special forces, and provision for intelligence, counter-terrorism and cyber-security. All this is to be achieved within an annual budget of about £2.5 billion – a fraction of the MoD’s current spending of £34 billion.

Mr. McAnally also explained it would cost the British government billions to rebuild the necessary infrastructure needed to house its nuclear arsenal. He says it would be difficult to find an alternative to Faslane naval base which would also become costly just to relocate:

It is also difficult to envisage a workable alternative to the Faslane naval base, currently home to Britain’s nuclear deterrent and the Navy’s hunter-killer submarines. It would cost many billions to relocate the infrastructure built up over decades, such as the Coulport Naval Armament Depot, which stores our torpedoes, missiles and nuclear warheads. If Britain were expelled from Faslane, there is every possibility that it could be forced into unilateral nuclear disarmament.

Why is Britain worried about Scotland’s defense and from whom? Who would attack Scotland? The Western funded ‘ISIS’ terrorist organization? Or from Russia who is threatened by NATO’s expansion close to its borders? I believe Scotland wants peace, not war. They will be diplomatic in every sense when it comes to foreign policy. Great Britain’s history has only shown to be a force for war and occupation.

As we have seen in the past, countries that don’t want to operate under the ‘New World Order’ apparatus would be considered enemies of Democracy.” Russia is an example. So is China, Ecuador, Cuba, Bolivia, Nicaragua, Venezuela, Zimbabwe, Syria and Iran are also enemies of Democracy according to the Anglo-American empire, because the “enemies of Democracy” want their nations to remain a “Sovereign entity”. Not under an “international Order controlled by the West. Over the years, political and financial elites from the U.S. and Europe had planned a single global power to control every nation on earth. In the last century, the establishment has called for a single power of authority that can dominate the financial, political and social landscapes of every nation. In 1992, President Clinton’s Deputy Secretary of State, Strobe Talbot was quoted in Time magazine and said “in the next century, nations as we know it will be obsolete; all states will recognize a single, global authority. National sovereignty wasn’t such a great idea after all.” Well not according to the Scottish people. Although they lost the ‘Yes’ vote, freedom and independence from British rule can still become a reality in the future.

The reason Western powers oppose Independence for Scotland or any other nation that seeks sovereignty is that they would lose the power of control, a power that seeks to undermine sovereignty. The only time the west supports Independence of any nation if they benefit from natural resources as in the case of the South Sudan’s independence in 2011. Professor Carroll Quigley of Georgetown University wrote in his book ‘Tragedy and Hope’ what was the purpose of establishing the Council of Foreign Relations (CFR) in New York City, an influential institution for Washington’s and its allies concerning foreign policy. He wrote “The Council on Foreign Relations (CFR) is the American Branch of a society which originated in England … (and) … believes national boundaries should be obliterated and one-world rule established.” It’s not over for Scottish Independence. It is just the beginning and the Scots proved it by voting in an unprecedented fashion. What will happen next, a recount? How about a call for a new referendum that will be monitored by the international community? That might work.

As the US and Europe prepare another round of sanctions against Russia over the ongoing Ukrainian conflict, the third round of such sanctions since the conflict began shortly after the Euromaidan unrest resulted in the installation of a NATO-backed regime in Kiev, a curious and inexplicable oversight appears to have been made.

While wild accusations have been leveled against Russia over its involvement over the violence in Ukraine, claims ranging from covert support up to and including unsubstantiated claims of a “full scale invasion,” prominent media organizations across the Western World have for years reported a flow of cash, weapons, equipment and fighters from America’s allies in the Persian Gulf as well as from nations like NATO member Turkey, and into the conflict raging within Syria’s borders.

While baseless claims leveled against Russia have served as ample justification for the West to continue leveling sanctions against Moscow, no sanctions have as of yet been leveled against the overt sponsors of militancy and, in fact, terrorism in Syria. So widespread has state-sponsored terrorism become in the Middle East that what began as a limited proxy war against Syria has transformed into an immense regional army with tens of thousands of paid soldiers requiring millions of dollars a day to operate across multiple borders and confounding the forces of Iraq, Syria, and Lebanon combined.

ISIS is State-Sponsored, So Why Aren’t These States Being Sanctioned? 

Clearly, the Islamic State in Iraq and Syria also known as ISIS or ISIL, are the benefactors of vast state-sponsorship and yet the West has not identified nor condemned these sponsors, let alone move toward leveling sanctions similar to what it is seeking to impose upon Moscow.

News articles by prominent British and American news outlets like the Daily Beast’s “America’s Allies Are Funding ISIS,” the London Telegraph’s “How Isil is funded, trained and operating in Iraq and Syria,” and the Daily Mail’s “Cameron tells European leaders to ‘be good to their word’ and stop funding ISIS with ransom payments,” give explanations ranging from outright admissions that Saudi Arabia, Qatar, Jordan, and Turkey are directly arming, funding, aiding and abetting ISIS, to descriptions that read like an immense money laundering operation, to ridiculous claims including “ransom payments” and “robbed banks” have been behind ISIS’ regional rise to menace.

At one point in the Daily Beast’s article it claims, “the U.S. has made the case as strongly as they can to regional countries, including Kuwait. But ultimately when you take a hands off, leading from behind approach to things, people don’t take you seriously and they take matters into their own hands.” If ever there was a case to use sanctions to be “taken seriously,” it would appear to be in this case, yet sure enough, no sanctions appear to be on the table.

Systematic Hypocrisy Undermines Legitimacy 

American and European hypocrisy so stark undermines the legitimacy of both their governments and institutions as well as their agenda domestically and abroad. Condemning and leveling sanctions against Russia for allegedly doing in Ukraine what the West is openly doing in Syria and Iraq with its own immense proxy army leaves the global audience to decide between Russia managing a crisis on its borders and a West meddling thousands of miles from its borders.

Beyond sanctions, the West’s presence across the Middle East has had a negative impact on public perception both across the region and back home. This is owed to a larger pattern of hypocrisy, deceit, and meddling that has been done under various pretenses but for obvious self-serving interests.

What West’s Missing Sanctions Tell Us About Its “War” on ISIS 

Versus Russia, the United States and Europe have used every means at their disposal to support their regime of choice in Ukraine as well as undermine both eastern Ukrainians and Russia who has emerged as their champion upon the international stage. From multiple rounds of sanctions, to threats of direct military force, and an overall strategy of geopolitical and military encirclement of Russian territory has been pursued to exact from Moscow concessions regarding Western designs in Ukraine.

Why hasn’t a similar full-spectrum commitment been used to render from Persian Gulf monarchies the same desired capitulation to Western desires in the Middle East and more specifically, in regards to ISIS? The answer is simple, the West does not desire an end to the massive state-sponsorship of ISIS via its own allies, namely Saudi Arabia, Qatar, Turkey, Jordan, and others.

It appears instead that the West and its partners are pursuing a dual-track strategy of inflaming the region with barbarism and violence so appalling, global public opinion will desperately beg for military intervention by the United States and its allies it has been so far utterly unsuccessful selling to the public under any other pretense.

The lack of biting sanctions against state-sponsors of terrorism aiding and abetting ISIS in both Iraq and Syria is an indictment of the West’s lack of sincerity in its “war” on ISIS. Short of a signed confession, no other indicator could be more telling of yet another war being sold within a pack of lies than a West eager to sanction every nation on Earth to the point of isolating itself to exact global obedience, but absent of sanctions amid overt support for terrorists it believes are so dangerous it must militarily intervene in Iraq and Syria.

Ulson Gunnar, a New York-based geopolitical analyst and writer especially for the online magazine “New Eastern Outlook”.

House Bans War Powers Resolution Actions

September 20th, 2014 by David Swanson

The U.S. House of Representatives has not just left town, but prior to leaving passed a rule preventing any member from using the War Powers Resolution to force Congress to return and vote on war.

Here’s a video of Congressman Jim McGovern denouncing the rule (or read the transcript here):

If you watch the video, following Rep. McGovern’s remarks two of his colleagues run their mouths. The first is Congressman Pete Sessions nonsensically replying to McGovern. The second is Congresswoman Virginia Foxx on an unrelated topic. If you jump ahead to 10:25 McGovern replies to Sessions. It’s well worth watching.

In addition, Congressman McGovern and five other Democrats and six Republicans have asked Speaker John Boehner and Minority Leader Nancy Pelosi to hold a vote on war. Here’s their letter: PDF.

US Lays New Chemical Weapon Allegations Against Syria

September 20th, 2014 by Peter Symonds

US Secretary of State John Kerry yesterday laid fresh allegations of chemical weapons use against Syrian President Bashar al-Assad, thereby establishing another pretext for turning the imminent US air war in Syria against the regime in Damascus.

A year ago, the Obama administration exploited the now discredited claims that the Syrian military had carried out a gas attack on the Damascus suburb of Ghouta, in order to prepare a devastating aerial assault on the country’s armed forces, infrastructure and industry. While the attacks were called off at the last minute, the US has never relinquished its aim of regime-change and has seized on Islamic State of Iraq and Syria (ISIS) atrocities to justify a new, illegal war of aggression.

Speaking in the House Foreign Affairs Committee, Kerry renewed the claim that the Syrian military was using chemical weapons in the country’s civil war. “We believe there is evidence of Assad’s use of chlorine, which when you use it—despite it not being on the list—it is prohibited under the Chemical Weapons Convention,” he said.

Last September, the Syrian government agreed to the destruction of its stockpiles of chemical weapons and the facilities used to manufacture and store them. The Organisation for the Prohibition of Chemical Weapons (OPCW) announced last month that it had completed the task of supervising the destruction of the materials and facilities. Yet, at the time, Kerry continued to press the issue, claiming that “much more work must be done” to deal with “discrepancies and omissions” in Syria’s chemical weapons’ declaration last year.

Now, as the US is about to launch air strikes on ISIS militias in Syria, Kerry has publicly revived the issue. Chlorine was never part of last year’s agreement because it is a basic chemical with many industrial applications. As such it also provides a convenient device for making further lurid allegations against the Assad regime.

Claims that the Syrian military used chlorine against opposition-held villages can be traced to an “independent investigation” carried out by the right-wing British newspaper, the Telegraph, in April. The Telegraph, which has links to the British military and intelligence establishment, passed on soil samples from the villages to the OPCW, which issued a report last week confirming strong traces of chlorine and ammonia. The UN body could not and did not, however, determine who used the gas.

Just as the US exploited the Ghouta gas attack last year as a casus belli for war on Syria, so Kerry used the latest chemical weapons claims to make clear that the US is still gunning for Assad. He declared that there was no “long-term future” for Assad in power, adding: “The Syrian opposition is not going to stop fighting Assad. We recognise that reality.”

Kerry’s comments underline the real purpose of Washington’s plans to train and arm at least 5,000 “moderate” Syrian opposition fighters. While nominally aimed against ISIS, these militias would form the core of armed forces to oust Assad and establish a pro-Western regime in Damascus. Yesterday the US Senate, following a vote in the House of Representatives on Wednesday, overwhelmingly approved—78 to 22—the Obama administration’s plan to build up anti-Assad forces in Syria.

US Defence Secretary Chuck Hagel told the House Armed Services Committee that he and Joint Chiefs of Staff chairman Martin Dempsey had signed off on detailed plans for air strikes on ISIS targets inside Syria. Referring to the US Central Command, Hagel said: “CENTCOM’s plan includes targeted actions against ISIL [ISIS] safe havens in Syria, including its command and control, logistics capabilities and infrastructure.” He added: “Our actions will not be restrained by a border that exists in name only.” All that is now required is Obama’s approval.

According to a SyriaDeeply report this week, civilians in the Syrian city of Raqqa, currently held by ISIS, are already fleeing. Abu Ahmad, who left with his family, said: “We will not stay in our homes waiting for death to find us because of some targeting error.” A shop keeper inside Raqqa told the Guardian: “I believe most of the casualties will be civilian. The majority will be from Raqqa and very few from ISIS.”

The timing of the stepped-up war inside Iraq and air strikes in Syria is likely to be determined during next week’s UN General Assembly meeting. The Australian Financial Review reported today: “The final plans to wage war against Islamic State will be co-ordinated in private meetings between world leaders in New York… clearing the way for action to start.” Obama is due to address the General Assembly and chair a meeting of the UN Security Council.

The Obama administration is still trying to consolidate its “coalition of the willing” to wage war in the Middle East. President Francois Hollande announced yesterday that France was prepared to carry out air strikes in Iraq, but not in Syria, citing concerns that extending the air war would strengthen the Assad regime. The British government has held off making detailed commitments until the results of the Scottish referendum are finalised.

Kerry declared on Wednesday that some Arab countries were committed to military action, saying: “We have significant levels of support to conduct military operations.” He did not name specific nations, however. Turkey has refused to allow US war planes to operate from its military bases but this week revived plans to establish a buffer zone along its border with Syria as a possible staging area for pro-Western, anti-Assad militias.

Obama has repeatedly declared that the US will not commit ground troops to combat in Iraq and Syria. Australian Prime Minister Tony Abbott, who has sent war planes and 600 military personnel to Iraq, including 150 SAS special forces, repeats the same mantra.

The worthlessness of such statements was underscored by an Australian “retired senior defence insider” who commented in yesterday’s Sydney Morning Herald: “You don’t send in the SAS to run seminars and give white-board presentations back at headquarters. These guys are our most highly trained killers, and that’s what they will be doing.”

The determination of the US and its allies to play down their involvement in a war in the Middle East stems from real fears of the emergence of anti-war opposition on a scale beyond that which erupted against the criminal US-led invasion on Iraq in 2003.

The Ebola Crisis: Profiting from the Pandemic Outbreak

September 20th, 2014 by Michael Welch

The 2014 Ebola outbreak in West Africa is being declared the deadliest on record, and certainly the first of its kind in the region.

A recent report from the World Health Organization, a UN agency, found that there had been 2630 confirmed deaths directly attributable to the latest strain with 5,357 cases having been diagnosed. The disease is widespread and transmitting intensely throughout Guinea, Liberia and Sierra Leone, with additional cases emerging in Nigeria and Senegal.

The Global Research News Hour takes a closer look at the background of this developing situation with two observers with dissident takes on this new Clear and Present danger.

LISTEN TO THE SHOW 

Play

Length (58:07)
Click to download the audio (MP3 format)

Aggressive measures are being taken.

US President Barrack Obama stated on Tuesday September 16 that his administration would be committing 3000 military personnel to help contain the spread of the epidemic in the region.

The World Bank is committing $200 million in assistance to the three hardest hit African countries.

And the micro-biologist who first identified the Ebola virus in 1976 is urging UK Prime Minister Cameron to take “quasi-military” measures to address the threat.

Authorities are preparing to fast-track the use 10,000 doses of an experimental, as yet untested Ebola vaccine for use in West Africa.

As of this writing, the President of the besieged State of Sierra Leone has ordered the residents of Freetown, its capital city, off the streets and into their homes, arguing  ”extraordinary times require extraordinary measures.”

The Global Research News Hour takes a closer look at the background of this developing situation with two observers with dissident takes on this new Clear and Present danger.

Jon Rappoport is the author of the blog NoMoreFakeNews.com. He has 30 years of experience as an investigative reporter and has authored three books including  The Matrix Revealed and  Exit from the Matrix. He believes the World Health Organization, the Centres for Disease Control and other bodies are exaggerating the role of the Ebola virus in the death counts.  and speculates on how this new plague may be helping to advance a more cynical agenda.

Dr. Leonard Horowitz is a Harvard-trained investigator and public health educator. He has authored more than ten books including the 1996 best-seller Emerging Viruses: Aids & Ebola, Nature, Accident or Intentional. Dr. Horowitz has argued for years that both Ebola and AIDS were bio-engineered in a laboratory. In this GR News Hour interview, he shares evidence of how the new outbreak constitutes commercial and scientific fraud, he talks about how his information is being suppressed by YouTube, Wikipedia and, of course, the corporate press, and he outlines what he believes is the real agenda behind this new War On Germs.

 

LISTEN TO THE SHOW 

Play

Length (58:07)
Click to download the audio (MP3 format)

 

The Global Research News Hour airs every Friday at 1pm CT on CKUW 95.9FM in Winnipeg. The programme is also podcast at globalresearch.ca .

The show can be heard on the Progressive Radio Network at prn.fm. Listen in every Monday at 3pm ET.

Community Radio Stations carrying the Global Research News Hour:

CHLY 101.7fm in Nanaimo, B.C – Thursdays at 1pm PT

Boston College Radio WZBC 90.3FM NEWTONS  during the Truth and Justice Radio Programming slot -Sundays at 7am ET.

Port Perry Radio in Port Perry, Ontario – Thursdays at 1pm ET

Burnaby Radio Station CJSF out of Simon Fraser University. 90.1FM to most of Greater Vancouver, from Langley to Point Grey and from the North Shore to the US Border. It is also available on 93.9 FM cable in the communities of SFU, Burnaby, New Westminister, Coquitlam, Port Coquitlam, Port Moody, Surrey and Delta, in British Columbia Canada. – Tune in every Saturday at 6am.

CFRU 93.3FM in Guelph, Ontario. Tune in Wednesdays from 12am to 1am.

 

Was voter fraud committed during the Scottish Independence referendum?

It has been confirmed that the names of 10 people were already crossed off a voter list prior them voting inside a polling station.

According to reports, the Glasgow City Council confirmed that there were ten cases of suspected electoral fraud occurring at polling stations following the Scottish referendum vote on the 18th. As authorities have been investigating thousands have gathered outside in George Square, Glasgow, which has been dubbed “Independence Square,” in the time leading up to the vote.

Scotland on Sunday published a piece in early September suggesting the integrity of the electoral register was called into question a month prior to the historic vote:

“With less than two weeks to go before the independence vote on 18 September, Scotland on Sunday has learned that a formal complaint is to be made by Labour to the returning officer at East Ayrshire Council after activists discovered that at least four children in the area aged between three and 11 have received polling cards.”

Continuing, the recent polling concerns were put into context:

“The revelation has echoes of the problems which beset the 1979 devolution referendum, in which some dead people were given the vote, undermining public confidence in the result which did not meet the threshold set by the Callaghan government for creating a Scottish Parliament.”

What would be the motive for keeping Scotland in the UK?

The Washington post reports:

“The impact of North Sea oil is an important factor in Scotland’s independence and will certainly continue to be if it goes it alone.”

“An independent Scotland would probably get rights to the majority of the oil and gas off the coast of the United Kingdom: Despite the British government’s investment in the area, natural resources like this are generally divided up by geography alone. One study found that as much as 90 percent of oil revenue may go to an independent Scotland.”

Gaining 90 percent of oil revenues would seem to be a pretty weighty motive to derail the much sought after referendum.

There were other anomalies, as pointed out by independent investigator Aangirfan, illustrates the hypocrisy of the recent referendum vote:

“The turnout in the strong YES area of Glasgow was 75%, which is lower than the 85% turnout in Scotland as a whole.

The county known as Clackmannanshire was expected to vote YES.

But it was announced that NO had got 54% of the vote in Clackmannanshire.Scottish independence: Yes County votes NoIn Scotland as a whole, NO got more votes than the polls had predicted.”

Its important to note that Clackmannanshire had an 88.6 percent turnout. 

IMAGE: ‘Rigging the plot’ – police on the scene in Glasgow following allegations of voter fraud (Photo dailymail.co.uk)


IMAGE: ‘Calling it quits’ – Scotland’s first minister Alec Salmound resigns following results of the Scottish referendum (Photo rt.com)

Here’s a clip of spokesman Colin Edgar regarding the serious allegations of voter fraud occurring in Glasgow…

Watch this independent YouTube analysis of alleged fraudulent activities during the Scottish referendum as captured by Sky News cameras…

RT’s news release below…

1-Scottish-Independence

Salmond resigns after losing Scottish independence referendum

RT


Scotland’s First Minister and leader of the Scottish National Party (SNP) is resigning from office after losing Thursday’s independence referendum.

Scots voted to stay in the UK following an intense campaign. The‘No’ campaign rallied 55 percent of votes against 45 percent ‘Yes’ votes.

“We lost the referendum vote but Scotland can still carry the political initiative,” he told journalists and supporters.

“For me as leader my time is nearly over but for Scotland the campaign continues and the dream shall never die.”


IMAGE: ‘The fire inside’ – independence supporters in Glasgow’s George Square (Photo dailymail.co.uk)

In terms of who will replace him, Salmond says there are a “number of eminently qualified and very suitable candidates for leader.”

When asked what his reasons were for resigning, Salmond said “I had to make a judgement as to whether I’m best placed to take that opportunity forward – and I think others are.”

Deputy First Minister and Deputy SNP leader, Nicola Sturgeon, is the overwhelming favourite to replace Salmond as party leader.

Salmond expressed his pride in the historic 85 percent turnout in Thursday’s referendum and the manner in which Scots conducted themselves.

“We now have the opportunity to hold Westminster’s feet to the fire on the “vow” that they have made to devolve further meaningful power to Scotland. This places Scotland in a very strong position,” he said.

The First Minister spoke to Prime Minister David Cameron on Friday. He said the PM would not commit to a second reading vote by March 27 on a devolved powers ‘Scotland Bill’, which had been promised by former-PM and ‘No’ campaigner Gordon Brown during the campaign.

“I suspect he cannot guarantee the support of his party,” Salmond said, referring to the backbench Tory rebellion against new powers to Scotland.

“But today the point is this. The real guardians of progress are not the politicians at Westminster, or even at Holyrood, but the energised activism of tens of thousands of people who I predict will refuse meekly to go back into the political shadows.”

Leadership nominations will open at the SNP’s Annual Conference in Perth, November 13-15, said Salmond.

“After the membership ballot I will stand down as First Minister to allow the new leader to be elected by due Parliamentary process.

“Until then I will continue to serve as First Minister. After that I will continue to offer to serve as Member of the Scottish Parliament for Aberdeenshire East.”

Salmond said it had been “the privilege of my life” to serve as First Minister.

Imperial Conquest: America’s Long War Against Humanity

September 20th, 2014 by Prof Michel Chossudovsky

Worldwide militarization is also part of a global economic agenda, namely the application of the neoliberal economic policy model which has led to the impoverishment of large sectors of the World population.

The world is at the crossroads of the most serious crisis in modern history. The US has embarked on a military adventure, “a long war”, which threatens the future of humanity.

This “war without borders” is being carried out at the crossroads of the most serious economic crisis in World history, which has been conducive to the impoverishment of large sectors of the World population.

The Pentagon’s global military design is one of world conquest. The military deployment of US-NATO forces is occurring in several regions of the world simultaneously.

The concept of the “Long War” has characterized US military doctrine since the end of World War II. Worldwide militarization is part of a global economic agenda.

Video of Michel Chossudovsky’s presentation to The Rosa Luxemburg conference.

The event was organized by the German daily “junge Welt”. This year, the Rosa Luxemburg Conference marked the commemoration of the 100th anniversary of the First World War.

for the full text including detailed analysis: Imperial Conquest: America’s “Long War” against Humanity, Global Research, January 2014

I’ve never been to a protest march that advertised in the New York City subway. That spent $220,000 on posters inviting Wall Street bankers to join a march to save the planet, according to one source. That claims you can change world history in an afternoon after walking the dog and eating brunch.

Welcome to the “People’s Climate March” set for Sunday, Sept. 21 in New York City. It’s timed to take place before world leaders hold a Climate Summit at the United Nations two days later. Organizers are billing it as the “biggest climate change demonstration ever” with similar marches around the world. The Nation describes the pre-organizing as following “a participatory, open-source model that recalls the Occupy Wall Street protests.” A leader of 350.org, one of the main organizing groups, explained, “Anyone can contribute, and many of our online organizing ‘hubs’ are led by volunteers who are often coordinating hundreds of other volunteers.”

I will join the march, as well as the Climate Convergence starting Friday, and most important the “Flood Wall Street” direct action on Monday, Sept. 22. I’ve had conversations with more than a dozen organizers including senior staff at the organizing groups. Many people are genuinely excited about the Sunday demonstration. The movement is radicalizing thousands of youth. Endorsers include some labor unions and many people-of-color community organizations that normally sit out environmental activism because the mainstream green movement has often done a poor job of talking about the impact on or solutions for workers and the Global South.

Nonetheless, to quote Han Solo, “I’ve got a bad feeling about this.”

Environmental activist Anne Petermann and writer Quincy Saul describe how the People’s Climate March has no demands, no targets,and no enemy. Organizers admitted encouraging bankers to march was like saying Blackwater mercenaries should join an antiwar protest. There is no unity other than money. One veteran activist who was involved in Occupy Wall Street said it was made known there was plenty of money to hire her and others. There is no sense of history: decades of climate-justice activism are being erased by the incessant invocation of the “biggest climate change demonstration ever.” Investigative reporter Cory Morningstar has connected the dots between the organizing groups, 350.org and Avaaz, the global online activist outfit modeled on MoveOn, and institutions like the World Bank and Clinton Global Initiative. Morningstar claims the secret of Avaaz’s success is its “expertise in behavioral change.”

That is what I find most troubling. Having worked on Madison Avenue for nearly a decade, I can smell a P.R. and marketing campaign a mile away. That’s what the People’s Climate March looks to be. According to inside sources a push early on for a Seattle-style event—organizing thousands of people to nonviolently shut down the area around the United Nations—was thwarted by paid staff with the organizing groups.

One participant in the organizing meetings said, “In the beginning people were saying, ‘This is our Seattle,’” referring to the 1999 World Trade Organization ministerial that was derailed by direct action. But the paid staff got the politics-free Climate March. Another source said, “You wouldn’t see Avaaz promoting an occupy-style action. The strategic decision was made to have a big march and get as many mainstream groups on board as possible.”

Nothing wrong with that. Not every tactic should be based on Occupy. But in an email about climate change that Avaaz sent out last December, which apparently raked in millions of dollars, it wrote, “It’s time for powerful, direct, non-violent action, to capture imagination, convey moral urgency, and inspire people to act. Think Occupy.”

Here’s what seems to be going on. Avaaz found a lucrative revenue stream by warning about climate catastrophe that can be solved with the click of a donate button. To convince people to donate it says we need Occupy-style actions. When the moment comes for such a protest, Avaaz and 350.orgblocked it and then when it did get organized, they pushed it out of sight. If you go to People’s Climate March, you won’t find any mention of the Flood Wall Street action, which I fully support, but fear is being organized with too little time and resources. Nor have I seen it in an Avaaz email, nor has anyone else I’ve talked to. Bill McKibben of 350.org began promoting it this week, but that may be because there is discontent in the activist ranks about the march, which includes lots of Occupy Wall Street activists. One inside source said, “It’s a branding decision not to promote the Flood Wall Street action. These are not radical organizations.”

Branding. That’s how the climate crisis is going to be solved. We are in an era or postmodern social movements.

The image (not ideology) comes first and shapes the reality. The P.R. and marketing determines the tactics, the messaging, the organizing, and the strategy. Whether this can have a positive effect is a different question, and it’s why I encourage everyone to participate. The future is unknowable. But left to their own devices the organizers will lead the movement into the graveyard of the Democratic Party, just as happened with the movement against the Iraq War a decade ago. You remember that historic worldwide movement, right? It was so profound the New York Times dubbed global public opinion, “the second superpower.” Now Obama has launched an eighth war and there is no antiwar movement to speak of.

Sources say Avaaz and 350.org is footing most of the bill for the People’s Climate March with millions of dollars spent. Avaaz is said to have committed a dozen full-time staff, and hired dozens of other canvassers to collect petition signatures and hand out flyers. Nearly all of 350.org’s staff is working on climate marches around the country and there is an office in New York with thirty full-time workers organizing the march. That takes a lot of cheddar. While the grassroots are being mobilized, this is not a grassroots movement. That’s why it’s a mistake to condemn it. People are joining out of genuine concern and passion and hope for an equitable, sustainable world, but the control is top down and behind closed doors. Everyone I talked to described an undemocratic process. Even staffers were not sure who was making the decisions other than to tell me to follow the money. It’s also facile to say all groups are alike. Avaaz is more cautious than 350.org, and apparently the New York chapter of 350.org, which is more radical, is at odds with the national.

But when the overriding demand is for numbers, which is about visuals, which is about P.R. and marketing, everything becomes lowest common denominator. The lack of politics is a political decision. One insider admitted despite all the overheated rhetoric about the future is on the line, “I don’t expect much out of this U.N. process.” The source added this is “a media moment, a mobilizing moment.” The goal is to have visuals of a diverse crowd, hence the old saw about a “family-friendly” march. Family friendly comes at a high cost, however. Everything is decided by the need for visuals, which means organizers will capitulate to anything the NYPD demands for fear of violence. The march is on a Sunday morning when the city is in hangover mode. The world leaders will not even be at the United Nations, and they are just the hired guns of the real climate criminals on Wall Street. The closest the march comes to the United Nations is almost a mile away. The march winds up on Eleventh Avenue, a no-man’s land far from subways. There is no closing rally or speakers.

An insider says the real goal was to create space for politicians: “If you can frame it as grandma and kids and immigrants and labor you could make it safer for politicians to come out and support. It’s all very liberal. I don’t have much faith in it.”

When I asked what the metrics for success for, the insider told me media coverage and long-term polling about public opinion. I was dumbfounded. That’s the exact same tools we would use in huge marketing campaigns. First we would estimate and tally media “impressions” across all digital, print, outdoor, and so on. Then a few months down the road we would conduct surveys to see if we changed the consumer’s opinion of the brand, their favorability, the qualities they associated with it, the likelihood they would try. That’s the same tools Avaaz is allegedly using.

Avaaz has pioneered clickbait activism. It gets people to sign petitions about dramatic but ultimately minor issues like, “Prevent the flogging of 15 year old rape victim in Maldives.” The operating method of Avaaz, which was established in 2007, is to create “actions” like these that generate emails for its fundraising operation. In other words, it’s a corporation with a business model to create products (the actions), that help it increase market share (emails), and ultimately revenue. The actions that get the most attention are ones that get the most petition signers, the most media coverage, and which help generate revenue.

Avaaz has turned social justice into a product to enhance the liberal do-gooding lifestyle, and it’s set its sights on the climate justice movement.

The more dramatic the emails the better the response. It’s like the supermarket. The bags and boxes don’t say, “Not bad,” or “kinda tasty.” They say “the cheesiest,” “the most delicious,” “an avalanche of flavor,” “utterly irresistible.” That’s why climate change polls so well for Avaaz. It’s really fucking dramatic. But it’s still not dramatic enough for marketing purposes.

One source said the December 2013 email from Avaaz Executive Director Ricken Patel about climate change was a goldmine. It was headlined, “24 Months to Save the World.” It begins, “This may be the most important email I’ve ever written to you,” and then says the climate crisis is “beyond our worst expectations” with storms and temperatures “off the charts.” Then comes the hook from Patel,

“We CAN stop this, if we act very fast, and all together. And out of this extinction nightmare, we can pull one of the most inspiring futures for our children and grandchildren. A clean, green future in balance with the earth that gave birth to us.”

Telling people there is 24 months to save the world is odious, as is implying an online donation to Avaaz can save the planet.

The same overblown rhetoric is being used for the People’s Climate March: It’s the biggest ever. There is “unprecedented collaboration” with more than 1,400 “partner” groups in New York City. Everything comes down to this one day with the “future on the line and the whole world watching, we’ll take a stand to bend the course of history.”

Presumably the orderly marchers behind NYPD barricades will convince the governments of the world that will meet for the Climate Summit that won’t even meet for another two days that they need to pass UN Secretary­ General Ban Ki-­moon’s “ambitious global agreement to dramatically reduce global warming pollution.”

Moon is now joining the march. But it’s hard to find details, including on the Climate Summit website, as to what will actually be discussed there. The best account I could find is by Canadian journalist Nick Fillmore. He claims the main point will be a carbon pricing scheme. This is one of those corporate-designed scams that in the past has rewarded the worst polluters with the most credits to sell and creates perverse incentives to pollute, because then they can earn money to cut those emissions.

So we have a corporate-designed protest march to support a corporate-dominated world body to implement a corporate policy to counter climate change caused by the corporations of the world, which are located just a few miles away but which will never feel the wrath of the People’s Climate March.

Rather than moaning on the sidelines and venting on Facebook, radicals need to be in the streets. Join the marches and more important the direct actions. Radicals need to ask the difficult questions as to why for the second time in fifteen years has a militant uprising, first Seattle and then Occupy, given way to liberal cooptation. What good is your radical analysis if the NGO sector and Democratic Party fronts kept out-organizing you?

Naomi Klein says we need to end business as usual because climate change is going to change everything. She’s right. Unfortunately the organizers of the People’s Climate March didn’t get the memo. Because they are continuing on with business as usual that won’t change anything.

One prominent environmental organizer says that after the march ends, “The U.N. leaders are going to be in there Monday and Tuesday and do whatever the fuck they want. And everyone will go back to their lives, walking the dog and eating brunch.”

The future is unwritten. It’s not about what happens on Sunday. It’s what happens after that.

Arun Gupta contributes to outlets including Al Jazeera America, Vice, The Progressive, The Guardian, and In These Times.

At the beginning of August 2014 Bloomberg published an article about the “promising hopes” tobacco plants offer “for developing an effective treatment for the deadly Ebola virus”:

Tobacco plant-derived medicines, which are also being developed by a company whose investors include Philip Morris International Inc., are part of a handful of cutting edge plant-based treatments that are in the works for everything from pandemic flu to rabies using plants such as lettuce, carrots and even duckweed…

Another tobacco giant-backed company working on biotech drugs grown in tobacco plants is Medicago Inc. in Quebec City, which is owned by Mitsubishi Tanabe Pharma Corp. and Philip Morris.

Medicago is working on testing a vaccine for pandemic influenza and has a production greenhouse facility in North Carolina, said Jean-Luc Martre, senior director for government affairs at Medicago. Medicago is planning a final stage trial of the pandemic flu vaccine for next year, he said in a telephone interview…

Medicago ‘‘is currently closely working with partners for the production of an Ebola antibody as well as other antibodies that are of interest for bio-defense,” he said in an e-mail. He would not disclose who the partners were. (Ebola Tobacco Drug Joins Duckweed in Plant War on Disease, Bloomberg, August 6, 2014)

Could one of these partners be the Pentagon?

In 2009, the Defense Advanced Research Projects Agency (DARPA), part of the U.S. Department of Defense, launched a program called Blue Angel, which some have described as “DARPA’s vaccine manufacturing challenge”.

DARPA issued a press release in late July 2012 announcing they had “produced 10 million doses of an influenza vaccine in only one month’s time.”

In a press release out of the agency’s office this week, scientists with DARPA say they’ve reach an important step in being able to combat a flu pandemic that might someday decimate the Earth’s population. By working with the Medicago Inc. vaccine company, the Pentagon’s cutting edge research lab says that they’ve used a massive harvest of tobacco plants to help produce a plethora of flu-fighting vaccines.

Testing confirmed that a single dose of the H1N1 VLP influenza vaccine candidate induced protective levels of hemagglutinin antibodies in an animal model when combined with a standard aluminum adjuvant,” the agency writes, while still noting, though, that “The equivalent dose required to protect humans from natural disease can only be determined by future, prospective clinical trials.”

Vaccinating susceptible populations during the initial stage of a pandemic is critical to containment,”Dr. Alan Magill, DARPA program manager, says in an official statement. “We’re looking at plant-based solutions to vaccine production as a more rapid and efficient alternative to the standard egg-based technologies, and the research is very promising.” (DARPA’s Blue Angel – Pentagon Prepares Millions of Vaccines Against Future Global Flu, RT, July 28, 2012)

This link between the U.S. military and pharmaceutical companies in the production of flu vaccines raises serious questions, especially since the H1N1 pandemic has been exposed as a multibillion dollar fraud instigated by BigPharma and the World Health Organization (WHO).

A stunning new report reveals that top scientists who convinced the World Health Organization (WHO) to declare H1N1 a global pandemic held close financial ties to the drug companies that profited from the sale of those vaccines. This report, published in the British Medical Journal, exposes the hidden ties that drove WHO to declare a pandemic, resulting in billions of dollars in profits for vaccine manufacturers. (Mike Adams: WHO Scandal Exposed: Advisors Received Kickbacks From H1N1 Vaccine Manufacturers, Natural News, June 7, 2010)

In 2012, it was reported that Medicago “was funded through a $21 million Technology Investment Agreement with DARPA.” (RT, op. cit.)

After investing in medical research to manufacture vaccines, the U.S Department of Defense is now sending troops to deal with a pandemic in Africa. Is the military slowly replacing health authorities? If so, we can ask ourselves why. What is the real goal of this “humanitarian intervention”? Maybe the answer lies in the goal of DARPA’s Blue Angel program?

In an interview last February, Blue Angel’s programme manager Dr. John Julias said:

The Blue Angel programme was launched by the US Defense Advanced Research Projects Agency (DARPA) in 2009 as a direct response to the swine flu pandemic. The project’s goal is to improve the US’s response to pandemic influenza through accelerated vaccine production

The Blue Angel programme was built around the concept that the Department of Defense requires a capability to rapidly respond to any pandemic or biological threat that jeopardises warfighter readiness. (Chris Lo, Blue Angel: DARPA’s vaccine manufacturing challenge, pharmaceutical-technology.com, February 10, 2014)

So the goal is “to improve the US’s response to pandemic influenza” but it is built on a concept which aims to protect “warfighters” from “any pandemic or biological threat”, not the population in general.

Is this concept in any way related to the fact that “warfighters” instead of “health workers” are now being sent into areas affected by the Ebola pandemic? To test a vaccine against a “biological threat that jeopardises warfighter readiness”? Are these 3000 troops Obama is sending to Liberia being used as guinea pigs? There are precedent in this regard. This  would not be the first time.

Last February RT reported:

A federal judge has ruled the United States Army must quickly inform veterans of any potentially harmful health effects stemming from the secret medical and drug experiments conducted on them during the Cold War.

According to a report by Courthouse News wire service, the ruling comes in favor of 7,800 soldiers claiming to have been involved in the experiments. After recruiting Nazi scientists to help through a program called “Project Paperclip,” the Army and CIA administered between 250 and 400 kinds of drugs to the soldiers in an attempt to advance US ability to wage war. (Judge sides with US servicemen used as guinea pigs in terrifying Cold War experiment, RT, Frebruary 7, 2014)

During the Persian Gulf War (1990-1991) experimental vaccines were also given to soldiers and several studies have concluded that the Gulf-War Syndrome was linked to vaccinations:

Gulf-War Syndrome (GWS) refers to a collection of symptoms in soldiers who served in the Persian Gulf War (1990-1991), or Gulf War 1. These symptoms include rash, severe fatigue, muscle and joint pain, headache, irritability, depression, unrefreshing sleep, gastrointestinal and respiratory disorders and neurological cognitive defects.

Apart from being exposed to a wide range of environmental hazards and toxic chemicals, US and UK Gulf War I veterans (GW1Vs) were also given large numbers of vaccines. In total, the US GW1Vs received, at least, 17 different vaccines [1] including live vaccines (polio and yellow fever as well as experimental vaccines that had not been approved (anthrax, botulinum toxoid) and were of doubtful efficacy [2]. In the UK, the Ministry of Defence (MoD) has declared only 10 vaccines given, but records exist to show that some troops received a greater number [3]. Among them were two experimental vaccines, anthrax with pertussis as an adjuvant (shown in 1990 to cause serious deconditioning in mice) [4], and plague, given to UK but not USA troops [1]. The manufacturers of pertussis were not advised of the unlicensed use on GW1Vs [1,4].

Vaccine overload was identified as a significant factor in GWS…

These findings are consistent with those from other studies. A link between vaccinations and illness has been found among GW1Vs from UK and Canada [6]. (Dr. Mae-Wan Ho and Prof. Malcolm Hooper Vaccines, Gulf-War Syndrome & Bio-defence)

The stated goal enunciated by Obama of the U.S. soldiers’ mission in Liberia is to build medical centers and train health workers to operate them.

The National Institutes of Health, an agency of the U.S. Department of Health and Human Services, has already developed an Ebola vaccine. In early September GlaxoSmithKline said it planned to begin manufacturing up to 10,000 doses of it, even though scientists had not yet decided if “the initial vaccine was promising enough” and ”safety studies cannot guarantee that experimental vaccines really work in an outbreak.” (Associated Press, Ebola vaccine research moving fast, CBSNews, September 8, 2014)

It is worth noting in this regard that several health hazards were in fact caused by the H1N1 vaccine. GlaxoSmithKline also recently pleaded guilty and paid “$3 billion to resolve fraud allegations and failure to report safety data”. (GlaxoSmithKline to Plead Guilty and Pay $3 Billion to Resolve Fraud Allegations and Failure to Report Safety Data, Department of Justice, July 2, 2014)

The leader of the Ukrainian separatists says that their efforts to get Russia’s President Vladimir Putin to accept their territory as being a part of Russia have been firmly rejected by Putin’s Government; and, so, “We will build our own country.” (This important statement from the rebel leader Andrei Purgin on Wednesday, September 17th, was inconspicuously buried halfway through an AP news story that focused instead on “East Ukraine Casualties.” It’s common for propagandistic news reports, such as characterize the U.S. media, to bury what’s important in the news story, and not even to headline that crucial information, when that information violates the regime’s propaganda. So: this information was buried, and was not headlined.)

Russia’s Government has thus made clear that it is not seeking to add to its territory. While Russia has accepted the approximately million refugees who have fled to Russia from Ukraine’s civil war, Russia does not want any part of Ukraine’s territory. Crimea was traditionally part of Russia, throughout the period 1783-1954, until the leader of the Soviet Union gifted Crimea to Ukraine (the nation that was called the Ukrainian Soviet Socialist Republic) in 1954, but the residents of Crimea never accepted that, and they overwhelmingly considered themselves still to be Russians. Furthermore, the Russian Navy’s lease on the Crimean port of Sebastopol for its Black Sea Fleet extended till 2042, and the February 2014 coup-installed Ukrainian Government wanted to cancel it, which threatened crucial Russian national defense. Furthermore, many of those new Ukrainian leaders wanted a nuclear war against Russia. So, Putin accepted Crimea back into Russia, but he will not admit more than that as being added to Russian territory.

Crimea is viewed as not being an addition to Russia, but instead as voluntarily rejoining Russia, irrespective of the new Ukrainian Government’s campaign to eliminate ethnic Russians from Ukraine’s southeast. No other part of post-1954 Ukraine had previously been part of Russia, and this includes the southeastern portion of Ukraine, whose residents ethnically descended from Russian immigrants who had settled there.

Consequently, the ethnic-cleansing campaign that has been going on by the new, Obama-installed, Ukrainian Government, against the residents in Ukraine’s southeast, will continue, at least until the surviving residents there become a small enough proportion of the Ukrainian national electorate so that a nationwide Ukrainian election — which hasn’t been held in Ukraine since the February 2014 coup — will choose leaders who are acceptable to the U.S. Government, which planned and financed that February coup. Only by killing and driving out enough of those people — the ones in the areas that overwhelmingly voted for the man whom Obama overthrew — will become possible a democratic Ukraine that allies itself with the U.S.

President Putin and President Obama have regularly been in direct contact with one-another ever since Obama’s coup occurred in February. Perhaps Putin’s declining to accept Ukrainian territory into Russia is part of an agreement between the two leaders in which Obama is, for his part, declining the urgings from congressional Republicans and conservative Democrats for the U.S. to provide weapons to the Ukrainian military to expedite their ethnic cleansing campaign. 

Investigative historian Eric Zuesse is the author, most recently, of  They’re Not Even Close: The Democratic vs. Republican Economic Records, 1910-2010,  and of  CHRIST’S VENTRILOQUISTS: The Event that Created Christianity.

Did that just happen?

The world was still up at 3am British time on Friday morning to catch the first returns from Scotland’s historic Independence Vote. Everyone wanted to know.

The Indy bug is a global one for sure, and there is no bigger trend right now than the trend toward autonomy. It will break down hundreds of redundant imperial borders and will be the source of endless strife as the world tries to let go of 19th and 20th century constructs. The world was definitely watching Scotland.

From a global perspective, it seemed like 100% of the world was pulling for a Scottish ‘YES’ even if just less than half of Scots were.

In the end the ‘NO’ campaign took the ‘YES’ by a 10 point margin (we are told), 55% to 45%.

For the ‘NO’ crowd it was a real kitchen sink moment. They were backed by the political establishment in Westminster, the City of London and the mainstream media (led by the BBC). Expectedly, PM Cameron came out swinging, as did Tony Blair’s former sidekick and banker puppet, Gordon Brown, became the tip of the spear of the ‘NO’ campaign. Captains of industry, celebrities and every conceivable pundit you can image was wheeled out two weeks before the vote on every TV and radio program.

It was also hard not to notice the multi-million pound PR campaign behind it. They managed to rebrand the word ‘NO’, to “Better Together”. They laid out a full range of slogans from the polite “No Thanks”, to the quintessentially cautious, “Vote NO, it’s not worth the risk”.

The Queen tried to weigh-in, but didn’t really. All she could manage was her hope that, “an enduring love of Scotland” will unite Britons’. US President Barack Obama couldn’t resist either, welcoming the Scots’ decision to stay in the UK (and NATO).

The desperation on the part of London’s establishment was pretty visible, as fear-based scenarios were deployed in ways not seen before. Deterrents ranged from the reserved, “It’s probably not a good idea”, to a more abrasive, “Pensioners will lose their pots, and the country will be plunged into debt”, or “Banks, profits and jobs will flee south!”, and rounded off by outright scare mongering by British PM David Cameron who ranted that a ‘YES’ vote would attract a wave of violent Islamic terror north of Hadrian’s Wall.

Not surprisingly, there were numerous reports of election and voter fraud, which is par for the course in western democracies these days. Sadly, not much will come of these reports other than further denting public confidence in our famous ‘democratic values’ in the west.

The story is far from over. Aside from a potential British Constitutional meltdown, ‘Devo Max’, full fiscal autonomy for Scotland – is still very much alive and well, and might further fuel a Constitutional crisis for Great Britain. The experts are saying that it will create uncertainty for business, and the ripple effects could be very significant.

SNP leader Alex Salmond and future leader Nicola Sturgeon.

Meanwhile, the head of the Scottish National Party who drove the campaign for Independence, Alex Salmond, resigned from his leadership position of 20 years today. This was a dramatic move for sure, and one that will leave experts scratching their heads about what backroom deal has been done. Favoured to replace him is SNP Deputy First Minister Nicola Sturgeon.

Before the vote there, everyone was speculating about everything. The Telegraph’s Peter Oborne summarised a few of the empire’s lingering concerns:

“National partitions – think of Ireland in 1922, India in 1947, Southern Sudan more recently or the birth-pangs of a Kurdish state today – are always bitter affairs. This is because two sides are arguing over the spoils. Who owns what? To whom do the armed forces give allegiance? Who inherits the debt? Who keeps the currency? There is already evidence of sectarian hatred, both north and south (where there are signs of a malevolent new English identity) of the border.

All of these issues will have to be dealt with by a set of politicians reeling with shock at the collapse of many of the landmarks that have given meaning to their lives…”

Shares on the London stock market rose on today and The Pound is up. Happy days, right?

Now let’s look at a few of the winners and losers from Thursday’s vote…

Winners:

The Scottish People – The cat is already out of the bag. As far as national identities go, Scotland’s stock is up. As a concept of a nation state, it’s already pre-qualified, better in fact than any other aspiring nation state, and can field as strong a case as France even. Voter turnouts of 80-90% are unheard of in modern European times so something was awakened over this issue. This renewed sense of identity cannot be a negative thing for your average Scot. The Aye’s may have lost this round, but the idea will continue to endure.

David Cameron – Imagine going down in history as the Prime Minister who presided over the break-up of the UK. David Cameron avoided such a fate, and power has remained consolidated in London. There were strong hints that if Scotland went off the reservation then Wales would next to secede, but that didn’t happen this time around. Bankers are happy. Sorted Dave. On to the next crisis.

NATO – Keeping the UK together means there will be no interruption in Britain’s NATO status and aspirations of ruling the world through the UN security council. An Independent Scotland would have meant that Trident nuclear submarines might have been moved or a contingency plan implemented. Without nukes, Britain cannot rightly serve on the UN Security Council thus losing its seat at the round table of world power, and severely clipping its NATO wings, bringing it down to the level of Spain.


Catalonia – Among the teams of international election observers in Scotland this week were a team of Catalans. They watch and learned, and will no doubt be applying their knowledge back in Spain during the run-up to their own independence vote this November. Despite the NO result in Scotland, the whole exercise will only embolden the Catalans, as they prepare to lock horns with their masters in Madrid. Many of the same issues facing Scottish Independence – EU membership, currency, and commercial migration – are also front and centre for an independent Catalonia too. Do not underestimate the momentum behind the Catalonia independence movement – it’s massive, but so is the indifference in Madrid.

UKIP – Regardless of the final result, the UK Independence Party (UKIP) has been basking in the festivities, and observing with great interest the many cracks forming as a result of the Indy drive. Even if you think that the Scotland Indy campaign was an EU trojan horse, the overall public sentiment was about independence and all its trappings. Scotland’s desire to devolve has elevated UKIP’s agenda south of the border.

The Royals – To be sure, the biggest worry for the Windsors was the prospect of having the vacate their beloved Balmoral Castle in Scotland. Besides having to clear out all those party favours from the basement, it would have been a scheduling nightmare for the royal household and would have ended up costing the British taxpayer even more than they are already shelling out for their German royal family. The status quo has been preserved.

Losers:

Scotland’s Labour Party – The split within the Labour Party over the Indy vote was pronounced. Gordon Brown’s cheer leading section saw his performance as proof that he should be back in frontline politics, but numbers were an internal massacre for Labour – nearly half of Labour voted for Scottish Independence.

BBC – No demon reared its ugly head as much as the BBC in this drama. They may have succeeded in swinging the NO vote, but the BBC has managed to alienate and further disconnect itself from half of the Scottish population who are accusing it of extreme bias. The even came out to protest outside BBC headquarters. From the onset, the public was treated to yet another reason to withhold their license fee, as the BBC took a clear side in the debate – defending the City of London and Westminster’s desires for Scotland to stay in the United Kingdom by blatantly shilling for the ‘NO’ campaign. It was embarrassing to watch, but it showed that even during the most pivotal moments facing society - the BBC plays the role of propaganda arm for the establishment, effectively working against the people.

EU – Brussels has a big problem now: monkey see, monkey do. As we mentioned before, even if you think the Scotland ‘YES’ drive was an EU/Eurozone trojan horse, Scotland’s exercise in people power has sent shock waves through the European Union’s bureaucratic gravy train. The whole concept of the referendum is something that Brussels technocrats would prefer be left in the theoretical realm, and not something that people can actually do. If the EU actually allowed its members to engage in real democratic activities (like holding referendums), it would lead to a shrinking of the Union and Eurozone.

Scotland is settled for now, but what Britain is left with is its biggest Constitutional crisis in 300 years. There is a lot happening in, and out of Westminster and unfortunately most of it is happening completely outside of the democratic process. Even though it came down as a NO vote, David Cameron is still talking about a”settlement for Scotland” and other “settlements”, but what he’s really talking about is restructuring government as we know.

Pundits have listed a number of possible scenarios we could have expect from either a ‘YES’ or a ‘NO’ result in Scotland, and either way you cut it, almost every turn will eventually result in a full-blown constitutional crisis. The future of the EU has no room for nation states or national Constitutions. Nation states will be replaced by regions and feudal city states and these will require a hardened fascist framework to hold it together. Is this the “settlement that David Cameron is referring to? It’s all in the EU’s own forward planning documents.

The ground is shifting beneath our feet and a surprisingly few are taking any notice.

But you won’t read about that in The Times or hear it on the BBC…

Westminster in Panic: In the Wake of The Scottish Referendum

September 20th, 2014 by Binoy Kampmark

They won’t be going anywhere.  The Scottish “No” vote may well have had their day on Friday, but the genie of Britannic rejection is definitely out of its confined bottle. The United Kingdom is feeling the strain and stretch of secession sentiment, and those in London are scurrying about in a panic.
 
The figures are not entirely comforting for the unionists.  Of 3,619,915 votes cast, 2,001,926 went for negative; with 1,617,989 for secession.  The Yes vote may well have come second in the count, but there is a feeling that those attempting to quash the matter had to start that rather unimaginative trick called fear.  The question most popularly thrown at the electorate was: “What if?”  Leaving can be such a terrible business, and at a certain point, there was a sense that the Prime Minister was evoking the calamity of Nora walking out of Ibsen’s A Doll’s House.  Do you really want to go on a voyage of self-discovery and leave husband and children behind?

Much of the campaign for the union ranged between disingenuousness to plain old sentimentality at a comfortably tired marriage that needed to persist in the usual, none too exciting conjugal rituals.  There was nothing in the No campaign to suggest that they had found the spice – only the terror that rejection might well follow.

That fear was also saddled with the idea of terrible inconvenience. European Commission President José Manuel Barroso decided to abandon all pretence of being neutral, making it clear that an impetuous Scotland would have to go to the end of the European Union admission queue if it was to attain independence.  Barroso saw the result as “good for a united, open, and stronger Europe, for which the Commission stands”, making the almost daft suggestion that an independent Scotland was inconsistent with a unified Europe to begin with.

Caught with its pants down, the campaign for the union fought for the most part with an enthusiasm that comes with status quo indifference.  But then, the emotive side got worked up with speculations about the UK’s physical being.  Scotland leaving would be like one’s leg sauntering off into the distance, or an arm going on permanent holiday.

This image tended to play out in a structural sense on such forums as NATO and the United Nations Security Council.  Exeunt Scotland, exeunt British presence and pro-US compliance.  Even the US President, Barack Obama, was hoping via unholy social media that five million Scots would not be forming their own country, if only because he might have to do the work of subordinating another state.  (Aircraft Carrier Britain sounds better than frigate Scotland.)  NATO Secretary General Anders Fogh Rasmussen would second that: “I respect the choice of the Scottish people, I welcome the statement by Prime Minister Cameron that the UK will go ahead as a united country.”

Prime Minister David Cameron could only fall back on grand statements about how the question had been settled.  “The debate has been settled for a generation … and there can be no disputes, no re-runs, we have heard the settled will of the Scottish people.”

Then came the oil and gas industry front men cooing at the result, the sort of thing that should make people break down parliament’s doors.  Scottish oil services tycoon Sir Ian Wood and Shell CEO Ben van Beurden, hardly the doyens of democracy, were content that the issue had been postponed.  Wood was “pleased the Scottish people had chosen the best of both worlds” which for such a figure tends to mean neither.[1] Wood could not wait to emphasise the recommendations made by his own “Maximising Economic Recovery Review”, which relegated Scotland to a natural resource salvager for cash-strapped Britain.  The oil and gas industry, he warned, had been depleted “in the medium term and certainly areas like the North East of Scotland must begin to take this seriously”.

The effects of the vote have spilled off in numerous directions.  There is the effect in the UK itself.
Devolution has been asymmetrical in effect – what the Scottish vote has also illuminated are issues of governance for the rest of the Union.  There is already talk about England being for England, which goes to show that a vote about Scotland invariably becomes a debate about what the English themselves are going to do.

Even Cameron had to admit that, “Just as Scotland will vote separately in the Scottish parliament on their issues of tax, spending and welfare, so too England, as well as Wales and Northern Ireland should be able to vote on these issues.”

Any sort of nationalism, even the good natured fluffy sort, is bound to get ugly, the sort of playground cowardice that passes for genuine debate, but there is only one issue on the cards here: self-governance.  Cameron will have to cough up more, giving Scotland autonomy over everything short – and only just short – of foreign affairs and defence.  And nothing he does will convince the voters in general that London is more distant than ever.

Then came the European spill off, frothing its way into other countries with that old secession bug. The Catalonian regional parliament did not waste time, passing a vote (106-28) that would authorise the region to hold non-binding consultations regarding independence in November.  Catalonia’s regional president, Artur Mas, was cheery.  “What happened in Scotland and the United Kingdom is not a setback for us – because what we really want in Catalonia is to have the chance to vote, the same possibility.”[2]  The Spanish Prime Minister, Mariano Rajoy, has preferred to get the legal briefs together and challenge the move in Spain’s Constitutional Court.

European separatists have certainly warmed to the result, despite it going against the Scottish nationalists.  The recipe here is spiced by a confident assertion of greater autonomy.  The central power is bound to be running scared – regional authorities are getting tetchy.

The New Flemish Alliance (N-VA) led by Bart De Wever and South Tyrolean separatists comprised of the South Tyrolean Freedom (STF) party, for instance, have taken heart, suggesting that Europe may have to head to more regionalist forms of government, something like continental devolution.  The tremors of succession, in other words, are very much on the wall – and that wall is hardly going to be washed anytime too soon.
 
Dr. Binoy Kampmark was a Commonwealth Scholar at Selwyn College, Cambridge.  He lectures at RMIT University, Melbourne.  Email: [email protected]

Notes:

First published in 2008

The sugar coated bullets of the “free market” are killing our children. The act to kill is unpremeditated. It is instrumented in a detached fashion through computer program trading on the New York and Chicago mercantile exchanges, where the global prices of rice, wheat and corn are decided upon. 

Poverty is not solely the result of policy failures at a national level. People in different countries are being impoverished simultaneously as a result of a global market mechanism. A small number of  financial institutions and global corporations have the ability to determine, through market manipulation, the standard of living of millions of people around the World.

We are at the crossroads of the most serious economic and social crisis in modern history. The process of global impoverishment unleashed at the outset of the 1980s debt crisis has reached a major turning point, leading to the simultaneous outbreak of famines in all major regions of the developing World.

There are many complex features underlying the global economic crisis pertaining to financial markets, the decline in production, the collapse of State institutions and the rapid development of a profit-driven war economy. What is rarely mentioned in this analysis, is how this global economic restructuring forcibly impinges on three fundamental necessities of life: food, water and fuel.

The provision of food, water and fuel is a precondition of civilized society: they are necessary factors for the survival of the human species. In recent years, the prices of these three variables has increased dramatically at the global level, with devastating economic and social consequences.

These three essential goods or commodities, which in a real sense determine the reproduction of economic and social life on planet earth, are under the control of a small number of global corporations and financial institutions.

Both the State as well as the gamut of international organizations –often referred to as the “international community”– serve the unfettered interests of global capitalism. The main intergovernmental bodies including the United Nations, the Bretton Woods institutions and the World Trade Organizations (WTO) have endorsed the New World Order on behalf of their corporate sponsors.  Governments in both developed and developing countries have abandoned their historical  role of regulating key economic variables as well as ensuring a minimum livelihood for their people.

Protest movements directed against the hikes in the prices of food and gasoline have erupted simultaneously in different regions of the World. The conditions are particularly critical in Haiti, Nicaragua, Guatemala, India, Bangladesh. Spiraling food and fuel prices in Somalia have precipitated the entire country into a situation of mass starvation, coupled with severe water shortages. A similar and equally serious situation prevails in Ethiopia.

Other countries affected by spiraling food prices include Indonesia, the Philippines, Liberia, Egypt, Sudan, Mozambique, Zimbabwe, Kenya, Eritrea, a long list of impoverished countries…, not to mention those under foreign military occupation including Iraq, Afghanistan and Palestine.

Famine in Ethiopia, June 2008

Most of these labourers in Kurigram go hungry in these three months because of sheer unemployment and a rise in the price of essentials

Deregulation 

The provision of food, water and fuel are no longer the object of governmental or intergovernmental regulation or intervention, with a view to alleviating poverty or averting the outbreak of famines.

The fate of millions of human beings is managed behind closed doors in the corporate boardrooms as part of a profit driven agenda.

And because these powerful economic actors operate through a seemingly neutral and “invisible” market mechanism, the devastating social impacts of engineered hikes in the prices of food, fuel and water are casually dismissed as the result of supply and demand considerations.

Nature of the Global Economic and Social Crisis

Largely obfuscated by official and media reports, both the ” food crisis” and the ” oil crisis” are the result of the speculative manipulation of market values by powerful economic actors.

We are not dealing with distinct and separate food,  fuel  and water “crises” but with a global process of economic and social restructuring.

The dramatic price hikes of these three essential commodities is not haphazard. All three variables, including the prices of basic food staples, water for production and consumption and fuel are the object of a process of deliberate and simultaneous market manipulation.

At the heart of the food crisis is the rising price of food staples coupled with a dramatic increase in the price of fuel.

Concurrently, the price of water which is an essential input into agricultural and industrial production, social infrastructure, public sanitation and household consumption has increased abruptly as a result of a Worldwide movement to privatize water resources.

We are dealing with a major economic and social upheaval, an unprecedented  global crisis, characterized by the triangular relationship between water, food and fuel: three fundamental variables, which together affect the very means of human survival.

In very concrete terms, these price hikes impoverish and destroy peoples lives. Moreover, the Worldwide collapse in living standards is occurring at a time of war. It is intimately related to the military agenda. The war in the Middle East bears a direct relationship to the control over oil and water reserves.

While water is not at present an internationally trade commodity in the same way as oil and food staples, it is also the object of market manipulation through the privatization of water.

The economic and financial actors operating behind closed doors, are:

- the major Wall Street banks and financial houses, including the institutional speculators which play a direct role in commodity markets including the oil and food markets

-The Anglo-American oil giants, including British Petroleum (BP), ExxonMobil, Chevron-Texaco, Royal Dutch Shell

-The biotech-agribusiness conglomerates, which own the intellectual property rights on seeds and farm inputs. The biotech companies are also major actors on the NY and Chicago mercantile exchanges.

-The water giants including Suez, Veolia and Bechtel-United Utilities, involved in the extensive privatization of the World’s water resources.

-The Anglo-American military-industrial complex which includes the big five US defense contractors (Lockheed Martin, Raytheon, Northrop Grunman, Boeing and General Dynamics) in alliance with British Aerospace Systems Corporation (BAES) constitutes a powerful overlapping force, closely aligned with Wall Street, the oil giants and the agribusiness-biotech conglomerates.

The Oil Price Bubble 

The movement in global prices on the New York and Chicago mercantile exchanges bears no relationship to the costs of producing oil. The spiraling price of crude oil is not the result of a shortage of oil. It is estimated that the cost of a barrel of oil in the Middle East does not exceed 15 dollars. The costs of a barrel of oil extracted from the tar sands of Alberta, Canada, is of the order of $30 (Antoine Ayoub, Radio Canada, May 2008)

The price of crude oil is currently in excess of $120 a barrel. This market price is largely the result of the speculative onslaught.


Source: NYMEX

Fuel enters into the production of virtually all areas of manufacturing, agriculture and the services economy.  The hikes in fuel prices have contributed, in all major regions of the World, to precipitating tens of thousands of small and medium sized businesses into bankruptcy as well as undermining and potentially paralyzing the channels of domestic and international trade.

The increased cost of gasoline at the retail level is leading to the demise of local level economies, increased industrial concentration and a massive centralization of economic power in the hands of a small number of global corporations. In turn, the hikes in fuel backlash on the urban transit system, schools and hospitals, the trucking industry, intercontinental shipping, airline transportation, tourism, recreation and most public services.

Inflation

The rise in fuel prices unleashes a broader inflationary process which results in a compression of real purchasing power and a consequent Worldwide decline in consumer demand. All major sectors of society, including the middle classes in the developed countries are affected.

These price movements are dictated by the commodity markets. They are the result of speculative trade in index funds, futures and options on major commodity markets including the London ICE, the New York and Chicago mercantile exchanges.

The dramatic price hikes are not the result of a shortage of fuel, food or water.

This upheaval in the global economy is deliberate. The State’s economic and financial policies are controlled by private corporate interests. Speculative trade is not the object of regulatory policies. The economic depression contributes to wealth formation, to enhancing the power of a handful of global corporations

According to William Engdahl;

 ”… At least 60% of the 128 per barrel price of crude oil comes from unregulated futures speculation by hedge funds, banks and financial groups using the London ICE Futures and New York NYMEX futures exchanges and uncontrolled inter-bank or Over-The-Counter trading to avoid scrutiny. US margin rules of the government’s Commodity Futures Trading Commission allow speculators to buy a crude oil futures contract on the Nymex, by having to pay only 6% of the value of the contract. At today’s price of $128 per barrel, that means a futures trader only has to put up about $8 for every barrel. He borrows the other $120. This extreme ‘leverage’ of 16 to 1 helps drive prices to wildly unrealistic levels and offset bank losses in sub-prime and other disasters at the expense of the overall population. (See More on the real reason behind high oil prices, Global Research, May 2008)

Among the main players in the speculative market for crude oil are Goldman Sachs, Morgan Stanley, British Petroleum (BP), the French banking conglomerate Société Générale, Bank of America, the largest Bank in the US, and Switzerland’s Mercuria. (See Miguel Angel Blanco, La Clave, Madrid, June 2008)

British Petroleum controls the London based International Petroleum Exchange (IPE), which is one of the world’s largest energy futures and options exchanges. Among IPE’s major shareholders are Goldman Sachs and Morgan Stanley.

According to Der Spiegel, Morgan Stanley is one of the main institutional actors in the London based speculative oil market (IPE). According to Le Monde, France’s Société Générale together with Bank of America and Deutsche Bank have been involved in spreading rumors with a view to pushing up the price of crude oil. (See Miguel Angel Blanco, La Clave, Madrid, June 2008)

Spiraling Food Prices

The global food crisis, characterized by major hikes in the prices of basic food staples, has spearheaded millions of people around the World into starvation and chronic deprivation.

According to the FAO, the price of grain staples has increased by 88% since March 2007. The price of wheat has increased by 181% over a three year period. The price of rice has increased by 50% over the last three months (See Ian Angus, Food Crisis: “The greatest demonstration of the historical failure of the capitalist model”, Global Research, April 2008):

The price of rice has tripled over a five year period, from approximately 600$ a ton in 2003 to more than 1800$ a ton in May 2008. (see chart below)

“The most popular grade of Thailand rice sold for $198 a ton, five years ago and $323 a ton a year ago. In April 2008, the price hit $1,000. Increases are even greater on local markets — in Haiti, the market price of a 50 kilo bag of rice doubled in one week at the end of March 2008. These increases are catastrophic for the 2.6 billion people around the world who live on less than US$2 a day and spend 60% to 80% of their incomes on food. Hundreds of millions cannot afford to eat” (Ibid)

The main actors in the grain market are Cargill and Archer Daniels Midland (ADM). These two corporate giants control a large share of the global grain market. They are also involved in speculative transactions in futures and options on the NYMEX and the Chicago Board of Trade (CBOT).  In the US, “the world’s largest grower of GM crops, Cargill, ADM and competitor Zen Noh between them control 81 per cent of all maize exports and 65 per cent of all soyabean exports.” ( Greg Muttitt, Control Freaks, Cargill and ADM, The Ecologist, March, 2001)

RICE

WHEAT

CORN

Source: Chicago Board of Trade

Background of Agricultural Reform

Since the early 1980s coinciding with the onslaught of the debt crisis, the gamut of neoliberal macroeconomic policy reforms have largely contributed to undermining local agriculture. Over the last 25 years, food farming in developing countries has been destabilized and destroyed by the imposition of IMF-World Bank reforms.

Commodity dumping of grain surpluses from the US, Canada and the European Union has led to the demise of food self-sufficiency and the destruction of the local peasant economy. In turn, this process has resulted in multibillion dollar profits for Western agribusiness, resulting from import contracts by developing countries, which are no longer able to produce their own food.

These preexisting historical conditions of mass poverty have been exacerbated and aggravated by the recent surge in grain prices, which have led in some cases to the doubling of the retail price of food staples.

The price hikes has also been exacerbated by the use of corn to produce ethanol. In 2007, global production of corn was of the order of 12.32 billion bushels of which 3.2 billion were used for ethanol production. Almost 40 percent of corn production in the US will be channeled towards ethanol

Genetically Modified Seeds

Coinciding with the establishment the World Trade Organization (WTO) in 1995, another important historical change has occurred in the structure of global agriculture.

Under the articles of agreement of the World Trade Organization (WTO)), the food giants have been granted unrestricted freedom to enter the seeds’ markets of developing countries.

The acquisition of exclusive “intellectual property rights” over plant varieties by international agro-industrial interests, also favors the destruction of bio-diversity.

Acting on behalf of a handful of biotech conglomerates  GMO seeds have been imposed on farmers, often in the context of “food aid programs”.  In Ethiopia, for instance, kits of GMO seeds were handed out to impoverished farmers with a view to rehabilitating agricultural production in the wake of a major drought.

The GMO seeds were planted, yielding a harvest. But then the farmer came to realize that the GMO seeds could not be replanted without paying royalties to Monsanto, Arch Daniel Midland et al.

Then, the farmers discovered that the seeds would harvest only if they used the farm inputs including the fertilizer, insecticide and herbicide, produced and distributed by the biotech agribusiness companies. Entire peasant economies were locked into the grip of the agribusiness conglomerates.

The main biotech giants in GMO include Monsanto, Syngenta, Aventis, DuPont, Dow Chemical, Cargill and Arch Daniel Midland.

Breaking The Agricultural Cycle

With the widespread adoption of GMO seeds, a major transition has occurred in the structure and history of settled agriculture since its inception 10,000 years ago.

The reproduction of seeds at the village level in local nurseries has been disrupted by the use of genetically modified seeds.  The agricultural cycle, which enables farmers to store their organic seeds and plant them to reap the next harvest has been broken. This destructive pattern – invariably resulting in famine – is replicated in country after country leading to the Worldwide demise of the peasant economy.

The FAO- World Bank Consensus

At the June 2008 FAO Rome Summit on the food crisis, politicians and economic analysts alike embraced the free market consensus: the outbreak of famines was presented as a result of the usual supply, demand and climatic considerations, beyond the control of policy-makers. “The solution”: channel emergency relief to affected areas under the auspices of the World Food Program (WFP). Do not intervene with the interplay of market forces.

Ironically, these ” expert opinions” are refuted by the data on global grain production: the FAO forecasts for world cereal production point to a record output in 2008.

Contradicting their own textbook explanations, World prices are, according to the World Bank, expected to remain high, despite the forcasted increased supply of food staples.

State regulation of the prices of food staples and gasoline is not considered an option in the corridors of the FAO and the World Bank. And of course that is what is taught in the economics departments of America’s most prestigious universities.

Meanwhile, local level farmgate prices barely cover production costs, spearheading the peasant economy into bankruptcy.

The Privatization of Water 

According to UN sources, which vastly underestimate the seriousness of the water crisis, one billion people worldwide (15% of the World population) have no access to clean water “and 6,000 children die every day because of infections linked to unclean water” (BBC News, 24 March 2004)

A handful of global corporations including Suez, Veolia, Bechtel-United Utilities, Thames Water and Germany’s RWE-AG are acquiring control and ownership over public water utilities and waste management.  Suez and Veolia hold about 70 percent of the privatized water systems Worldwide.

The privatization of water under World Bank auspices feeds on the collapse of the system of public distribution of safe tap drinking water: “The World Bank serves the interests of water companies both through its regular loan programs to governments, which often come with conditions that explicitly require the privatization of water provision…” (Maude Barlow and Tony Clarke, Water Privatization: The World Bank’s Latest Market Fantasy, Polaris Institute, Ottawa, 2004))

 ”The modus operandi [in India] is clear — neglect development of water resources [under World Bank budget austerity measures], claim a “resource crunch” and allow existing systems to deteriorate.” (Ann Ninan, Private Water, Public Misery, India Resource Center April 16, 2003)

Meanwhile, the markets for bottled water have been appropriated by a handful of corporations including Coca-Cola, Danone, Nestlé and PepsiCo. These companies not only work hand in glove with the water utility companies, they are linked up to the agribusiness-biotech companies involved in the food industry. Tap water is purchased by Coca-Cola from a municipal water facility and then resold on a retail basis. It is estimated that in the US, 40 percent of bottled water is tap water. (See, Jared Blumenfeld, Susan Leal The real cost of bottled water, San Francisco Chronicle, February 18, 2007)

In India, Coca-Cola has contributed to the depletion of ground water to the detriment of local communities:

“Communities across India living around Coca-Cola’s bottling plants are experiencing severe water shortages, directly as a result of Coca-Cola’s massive extraction of water from the common groundwater resource. The wells have run dry and the hand water pumps do not work any more. Studies, including one by the Central Ground Water Board in India, have confirmed the significant depletion of the water table.

When the water is extracted from the common groundwater resource by digging deeper, the water smells and tastes strange. Coca-Cola has been indiscriminately discharging its waste water into the fields around its plant and sometimes into rivers, including the Ganges, in the area. The result has been that the groundwater has been polluted as well as the soil. Public health authorities have posted signs around wells and hand pumps advising the community that the water is unfit for human consumption….

Tests conducted by a variety of agencies, including the government of India, confirmed that Coca-Cola products contained high levels of pesticides, and as a result, the Parliament of India has banned the sale of Coca-Cola in its cafeteria. However, Coca-Cola not only continues to sell drinks laced with poisons in India (that could never be sold in the US and EU), it is also introducing new products in the Indian market. And as if selling drinks with DDT and other pesticides to Indians was not enough, one of Coca-Cola’s latest bottling facilities to open in India, in Ballia, is located in an area with a severe contamination of arsenic in its groundwater.(India Resource Center, Coca-Cola Crisis in India, undated)

In developing countries, the hikes in fuel prices have increased the costs of boiling tap water by households, which in turn favors the privatization of water resources.

In the more advanced phase of water privatization, the actual ownership of lakes and rivers by private corporations is contemplated. Mesopotamia was not only invaded for its extensive oil resources, the Valley of the two rivers (Tigris and Euphrates)  has extensive water reserves.

Concluding Remarks 

We are dealing with a complex and centralized constellation of economic power in which the instruments of market manipulation have a direct bearing on the lives of millions of people.

The prices of food, water, fuel are determined at the global level, beyond the reach of national government policy. The price hikes of these three essential commodities constitute an instrument of “economic warfare”, carried out through the “free market” on the futures and options exchanges.

These hikes in the prices of food, water and fuel are contributing in a very real sense to “eliminating the poor” through “starvation deaths”. The sugar coated bullets of the “free market” kill our children. The act to kill is instrumented in a detached fashion through computer program trading on the commodity exchanges, where the global prices of rice, wheat and corn are decided upon.

‘The Commission on Population Growth and the American Future’

But we are not dealing solely with market concepts. The outbreak of famines in different parts of the World, resulting from spiraling food and fuel prices have broad strategic and geopolitical implications.

President Richard Nixon at the outset of his term in office in 1969 asserted “his belief that overpopulation gravely threatens world peace and stability.”  Henry Kissinger, who at the time was Nixon’s National Security adviser, directed various agencies of government to jointly undertake “a study of the impact of world population growth on U.S. security and overseas interests.”

In March 1970, the U.S. Congress set up a Commission on Population Growth and the American Future. (See Center for Research on Population and Security). The Commission was no ordinary Task Force. It integrated representatives from USAID, the State Department and the Department of Agriculture with CIA and Pentagon officials. Its objective was not to assist developing countries but rather to curb World population with a view to serving US strategic and national security interests. The Commission also viewed population control as a means to ensuring a stable and secure environment for US investors as well as gaining control over developing countries’ mineral and petroleum resources.

This Commission completed its work in December 1974 and circulated  a classified document entitled  National Security Study Memorandum 200: Implications of Worldwide Population Growth for U.S. Security and Overseas Interests”  to “designated Secretaries and Agency heads for their review and comments.” In November 1975, the report and its recommendations were endorsed by President Gerald Ford.

Kissinger had indeed intimated in the context of the National Security Study Memorandum 200 (NSSSM 200)  that the recurrence of famines, disease and war could constitute a de facto instrument of population control.

Although the NSSM 200 report did not assign, for obvious reasons, an explicit  policy role to famine formation, it nonetheless intimated that the occurrence of famines could, under certain circumstances, provide a de facto solution to overpopulation:

“Accordingly, those countries where large-scale hunger and malnutrition are already present face the bleak prospect of little, if any, improvement in the food intake in the years ahead barring a major foreign financial food aid program, more rapid expansion of domestic food production, reduced population growth or some combination of all three. Worse yet, a series of crop disasters could transform some of them into classic Malthusian cases with famines involving millions of people.

While foreign assistance probably will continue to be forthcoming to meet short-term emergency situations like the threat of mass starvation, it is more questionable whether aid donor countries will be prepared to provide the sort of massive food aid called for by the import projections on a long-term continuing basis.

Reduced population growth rates clearly could bring significant relief over the longer term.….

In the extreme cases where population pressures lead to endemic famine, food riots, and breakdown of social order, those conditions are scarcely conducive to systematic exploration for mineral deposits or the long-term investments required for their exploitation. Short of famine, unless some minimum of popular aspirations for material improvement can be satisfied, and unless the terms of access and exploitation persuade governments and peoples that this aspect of the international economic order has “something in it for them,” concessions to foreign companies are likely to be expropriated or subjected to arbitrary intervention. Whether through government action, labor conflicts, sabotage, or civil disturbance, the smooth flow of needed materials will be jeopardized. Although population pressure is obviously not the only factor involved, these types of frustrations are much less likely under conditions of slow or zero population growth.”

(1974 National Security Study Memorandum 200: Implications of Worldwide Population Growth for U.S. Security and Overseas Interests”. (emphasis added)

The report concludes with a couple of key questions pertaining to the role of food as “an instrument of national power”, which could be used in the pursuit of US strategic interests.

  • On what basis should such food resources then be provided? Would food be considered an instrument of national power? Will we be forced to make choices as to whom we can reasonably assist, and if so, should population efforts be a criterion for such assistance?
  • Is the U.S. prepared to accept food rationing to help people who can’t/won’t control their population growth?” (Ibid, emphasis added)

In the words of Henry Kissinger: “Control oil and you control nations; control food and you control the people.”


ANNEX

Corporate Actors highlighted in this article (among many other important corporate actors)

Speculative Trade in Crude Oil:

Goldman Sachs, Morgan Stanley, British Petroleum (BP), Deutsche Bank, Société Générale, Bank of America, Switzerland’s Mercuria.

Water Privatization

Water Infrastructure: Suez, Veolia, Bechtel-United Utilities, Thames Water and Germany’s RWE-AG

Retail Distribution of Drinking Water: Coca-Cola, Danone, Nestlé and PepsiCo

Food Prices and Genetically Modified Seeds

Monsanto, Syngenta, Aventis, DuPont, Dow Chemical, Cargill,  Arch Daniel Midland.

Military Industrial Complex

Lockheed Martin, Raytheon, Northrop Grunman, Boeing, General Dynamics, British Aerospace Systems Corporation (BAES)

The Globalization of Poverty and the New World Order 

by Michel Chossudovsky

originalIn this new and expanded edition of Chossudovsky’s international best-seller, the author outlines the contours of a New World Order which feeds on human poverty and the destruction of the environment, generates social apartheid, encourages racism and ethnic strife and undermines the rights of women. The result as his detailed examples from all parts of the world show so convincingly, is a globalization of poverty.

This book is a skilful combination of lucid explanation and cogently argued critique of the fundamental directions in which our world is moving financially and economically.

In this new enlarged edition –which includes ten new chapters and a new introduction– the author reviews the causes and consequences of famine in Sub-Saharan Africa, the dramatic meltdown of financial markets, the demise of State social programs and the devastation resulting from corporate downsizing and trade liberalisation.

Michel Chossudovsky is Professor of Economics at the University of Ottawa and Director of the Centre for Research on Globalization (CRG), which hosts the critically acclaimed website www.globalresearch.ca . He is a contributor to the Encyclopedia Britannica. His writings have been translated into more than 20 languages.

Published in 11 languages. More than 100,000 copies sold Worldwide.

 TO ORDER ONLINE OR MAIL ORDER CLICK HERE

“The present invention is based upon the isolation and identification of a new human Ebola virus species, EboBun and the sequencing of the only other known West African Ebola species EboIC. EboBun was isolated from the patients suffering from hemorrhagic fever in a recent outbreak in Uganda.

The isolated virus is a member of the Filoviridae family, a family of negative sense RNA viruses. Accordingly, the invention relates to the isolated EboBun or EBOIC virus that morphologically and phylogenetically relates to known members filoviridae.”

Publication number US20120251502 A1
Publication type Application
Application number US 13/125,890
PCT number PCT/US2009/062079
Publication date Oct 4, 2012
Filing date Oct 26, 2009
Priority date Oct 24, 2008
Also published as CA2741523A1, 4 More »
Inventors Jonathan S. Towner, 4 More »
Original Assignee The Government of the US as Represented by the Secretary of the Dept. of health
Export Citation BiBTeX, EndNote, RefMan
Patent Citations (2), Non-Patent Citations (8), Classifications (39), Legal Events (1)
External Links: USPTO, USPTO Assignment, Espacenet

Human Ebola Virus Species and Compositions and Methods Thereof

US 20120251502 A1

Abstract

Compositions and methods including and related to the Ebola Bundibugyo virus (EboBun) are provided. Compositions are provided that are operable as immunogens to elicit and immune response or protection from EboBun challenge in a subject such as a primate. Inventive methods are directed to detection and treatment of EboBun infection.
Images(27)
click to open
Patent Drawing
Patent Drawing
Patent Drawing
Patent Drawing
Patent Drawing
Patent Drawing
Patent Drawing
Patent Drawing
Patent Drawing
Patent Drawing
Patent Drawing
Patent Drawing
Patent Drawing
Patent Drawing
Patent Drawing
Patent Drawing
Patent Drawing
Patent Drawing
Patent Drawing
Patent Drawing
Patent Drawing
Patent Drawing
Patent Drawing
Patent Drawing
Patent Drawing
Patent Drawing
Patent Drawing
Claims(30)
1. An isolated hEbola virus comprising a nucleic acid molecule comprising a nucleotide sequence of:
a) a nucleotide sequence set forth in SEQ ID NOS: 1 or 10;
b) a nucleotide sequence hybridizing under stringent conditions to SEQ ID NOS: 1 or 10; or
c) a nucleotide sequence of at least 70%-99% identity to the SEQ ID NOS: 1 or 10, with the proviso that said nucleotide sequence is not SEQ ID NO: 20.
2. An isolated hEbola virus having Centers for Disease Control Deposit Accession No. 200706291.
3. The hEbola virus of claim 1 which is killed.
4. The hEbola virus of claim 1 which is an attenuated hEbola virus.
5. The virus of claim 4 wherein at least one property of the attenuated hEbola virus is reduced from among infectivity, replication ability, protein synthesis ability, assembling ability or cytopathic effect.
6. An isolated nucleic acid molecule comprising the nucleotide sequence of SEQ ID NOS: 1 or 10 or a complement thereof, or a fragment thereof wherein said fragment comprises a nucleotide sequence of between 4 and 4900 contiguous nucleotides of the nucleotide sequence of SEQ ID NOS: 1 or 10, or a complement thereof; with the proviso that said nucleotide sequence is not comprised by the nucleotide sequence set forth in SEQ ID NO: 20; or between 5500 and 6600 contiguous nucleotides of the nucleotide sequence of SEQ ID NOS: 1 or 10, or a complement thereof.
7. The isolated nucleic acid molecule of claim 6 comprising a nucleotide sequence of between 4 and 4900 contiguous nucleotides of the nucleotide sequence of SEQ ID NOS: 1 or 10, or a complement thereof; with the proviso that said nucleotide sequence is not comprised by the nucleotide sequence set forth in SEQ ID NO: 20; or between 5500 and 6600 contiguous nucleotides of the nucleotide sequence of SEQ ID NOS: 1 or 10, or a complement thereof.
8. The isolated nucleic acid molecule of claim 7 comprising a nucleotide sequence that encodes the amino acid sequence of SEQ ID NO: 2-9, 59, or SEQ ID NO: 11-19 or a complement thereof.
9. An isolated RNA or DNA nucleic acid molecule which hybridizes under stringent conditions to a nucleic acid molecule having the nucleotide sequence of SEQ ID NOS: 1 or 10 or a complement thereof.
10. An isolated polypeptide encoded by the nucleic acid molecule of claim 7.

11. The polypeptide of claim 10 comprising the amino acid of:

a) an amino acid sequence set forth in any of SEQ ID NOS: 2-19, or 59; or
b) an amino acid sequence that has 70%-99% homology to the amino acid sequence of (a).

12. The polypeptide of claim 10 wherein the amino acid sequence has

5 to 250 contiguous amino acid residues of the amino acid sequence of SEQ ID NOS: 5 or 18 (VP24);
5 to 280 contiguous residues of the amino acid sequence of SEQ ID NOS: 6 or 17 (VP30);
5 to 320 contiguous residues of the amino acid sequence of SEQ ID NOS: 8 or 13 (VP40);
5 to 340 contiguous residues of the amino acid sequence of SEQ ID NOS: 7 or 12 (VP35);
5 to 370 contiguous residues of the amino acid sequence of SEQ ID NOS: 4 or 15 (SGP);
5 to 370 contiguous residues of the amino acid sequence of SEQ ID NOS: 59 or 16 (SSGP);
5 to 670 contiguous residues of the amino acid sequence of SEQ ID NOS: 9 or 14 (GP);
5 to 730 contiguous residues of the amino acid sequence of SEQ ID NOS: 3 or 11 (NP); or
5 to 2200 contiguous residues of the amino acid sequence of SEQ ID NOS: 2 or 19 (L).
13. (canceled)
14. (canceled)
15. (canceled)
16. (canceled)
17. (canceled)
18. (canceled)
19. (canceled)
20. The hEbola virus of claims 3 or 4, or a protein extract therefrom, and a pharmaceutically acceptable carrier.
21. (canceled)
22. The nucleic acid molecule of claims 6 or 9, and a pharmaceutically acceptable carrier.
23. (canceled)
24. (canceled)
25. (canceled)
26. (canceled)
27. (canceled)
28. (canceled)
29. (canceled)
30. (canceled)

Description

RELATED APPLICATIONS

This application claims priority benefit of U.S. Provisional Application 61/108,175 filed 24 Oct. 2008; the contents of which are hereby incorporated by reference.

DEPOSIT STATEMENT

The invention provides the isolated human Ebola (hEbola) viruses denoted as Bundibugyo (EboBun) deposited with the Centers for Disease Control and Prevention (“CDC”; Atlanta, Ga., United States of America) on Nov. 26, 2007 and accorded an accession number 200706291. This deposit was not made to an International Depository Authority (IDA) as established under the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure, and is a non-Budapest treaty deposit. The deposited organism is not acceptable by American Type Culture Collection (ATCC), Manassas, Va., an International Depository Authority (IDA) as established under the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure. Samples of the stated Deposit Accession No. 200706291 will be made available to approved facilities for thirty years from the date of deposit, and for the lifetime of the patent issuing from, or claiming priority to this application.

FIELD OF THE INVENTION

The invention is related to compositions and methods directed to a novel species of human Ebola (hEbola) virus.

BACKGROUND OF THE INVENTION

The family Filoviridae consists of two genera, Marburgvirus and Ebolavirus, which have likely evolved from a common ancestor1. The genus Ebolavirus includes four species: Zaire, Sudan, Reston and Côte d’Ivoire (Ivory Coast) ebolaviruses, which have, with the exception of Reston and Côte d’Ivoire ebolaviruses, been associated with large hemorrhagic fever (HF) outbreaks in Africa with high case fatality (53-90%)2.

Viruses of each species have genomes that are at least 30-40% divergent from one another, a level of diversity that presumably reflects differences in the ecological niche they occupy and in their evolutionary history. Identification of the natural reservoir of ebolaviruses remains somewhat elusive, although recent PCR and antibody data suggest that three species of arboreal fruit bats may be carriers of Zaire ebolavirus3. No data has yet been published to suggest reservoirs for the Sudan, Reston and Côte d’Ivoire ebolavirus species. However, a cave-dwelling fruit bat has been recently implicated as a natural host for marburgvirus4, 5, supporting the hypothesis that different bat species may be the reservoir hosts for the various filoviruses.

Filovirus outbreaks are sporadic, sometimes interspersed by years or even decades of no apparent disease activity. The last new species of ebolavirus was discovered 14 years ago (1994), in Cote d’Ivoire (Ivory Coast), and involved a single non-fatal case, a veterinarian who performed an autopsy on an infected chimpanzee found in the Tai Forest6. No further disease reports have been associated with Côte d’Ivoire ebolavirus, in contrast to Zaire and Sudan ebolaviruses which have each caused multiple large outbreaks over the same time period.

In late November 2007, HF cases were reported in the townships of Bundibugyo and Kikyo in Bundibugyo District, Western Uganda. The outbreak continued through January 2008, and resulted in approximately 149 cases and 37 deaths2. Laboratory investigation of the initial 29 suspect-case blood specimens by classic methods (antigen capture, IgM and IgG ELISA) and a recently developed random-primed pyrosequencing approach identified this to be an Ebola HF outbreak associated with a new discovered ebolavirus species. These specimens were negative when initially tested with highly sensitive real-time RT-PCR assays specific for all known Zaire and Sudan ebolaviruses and Marburg viruses. This new species is referred to herein as “the Bundibugyo species”, abbreviated “EboBun”.

Accordingly, compositions and methods directed to the new Ebola virus species are described herein and the most closely related Ebola Ivory Coast species, which compositions and methods are useful for diagnosis and prevention of human Ebola virus infection; including related vaccine development, and prevention of hemorrhagic fever in a human population.

SUMMARY OF THE INVENTION

The present invention is based upon the isolation and identification of a new human Ebola virus species, EboBun. EboBun was isolated from the patients suffering from hemorrhagic fever in a recent outbreak in Uganda. The isolated virus is a member of the Filoviridae family, a family of negative sense RNA viruses. Accordingly, the invention relates to the isolated EboBun virus that morphologically and phylogenetically relates to known members filoviridae.

In one aspect, the invention provides the isolated EboBun virus deposited with the Centers for Disease Control and Prevention (“CDC”; Atlanta, Ga., United States of America) on Nov. 26, 2007 and accorded an accession number 200706291, as stated in the paragraph entitled “DEPOSIT STATEMENT” supra.

In another aspect, the invention provides an isolated hEbola EboBun virus comprising a nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of: a) a nucleotide sequence set forth in SEQ ID NO: 1; b) a nucleotide sequence that hybridizes to the sequence set forth in SEQ ID NO: 1 under stringent conditions; and c) a nucleotide sequence that has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to the SEQ ID NO: 1. In another aspect, the invention provides the complete genomic sequence of the hEbola virus EboBun.

In a related aspect, the invention provides nucleic acid molecules isolated from EboBun, or fragments thereof.

In another aspect, the invention provides proteins or polypeptides that are isolated from the EboBun, including viral proteins isolated from cells infected with the virus but not present in comparable uninfected cells; or fragments thereof. In one embodiment of the present invention, the amino acid sequences of the proteins or polypeptides are set forth in SEQ ID NOS: 2-9 and 59, or fragments thereof.

In a related aspect, the invention provides an isolated polypeptide encoded by the nucleic acid molecule of the inventive hEbola EboIC (Sequence ID No. 10) virus described above.

In another aspect, the invention provides an isolated hEbola EboIC virus comprising a nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of: a) a nucleotide sequence set forth in SEQ ID NO: 10; b) a nucleotide sequence that hybridizes to the sequence set forth in SEQ ID NO: 10 under stringent conditions; and c) a nucleotide sequence that has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to the SEQ ID NO: 10. In another aspect, the invention provides the complete genomic sequence of the hEbola virus EboIC.

In a related aspect, the invention provides nucleic acid molecules isolated from EboIC, or fragments thereof.

In another aspect, the invention provides proteins or polypeptides that are isolated from the EboIC, including viral proteins isolated from cells infected with the virus but not present in comparable uninfected cells; or fragments thereof. In one embodiment of the present invention, the amino acid sequences of the proteins or polypeptides are set forth in SEQ ID NOs: 11-19, or fragments thereof.

In a related aspect, the invention provides an isolated polypeptide encoded by the nucleic acid molecule of the inventive hEbola EboIC virus described above.

In other aspects, the invention relates to the use of the isolated hEbola virus for diagnostic and therapeutic methods based on EbBun, EboIC, or a combination thereof. In one embodiment, the invention provides a method of detecting in a biological sample an antibody immunospecific for the genus of West Afrin Ebola Species constituting hEbola EbBun and EboIC virus using at least one the inventive isolated hEbola virus described herein, or any of the inventive proteins or polypeptides as described herein. In another specific embodiment, the invention provides a method of screening for an antibody which immunospecifically binds and neutralizes hEbola EboBun. Such an antibody is useful for a passive immunization or immunotherapy of a subject infected with hEbola.

In another aspect, the invention provides an isolated antibody or an antigen-binding fragment thereof which immunospecifically binds to the hEbola virus of the invention described above.

In other aspects, the invention provides methods for detecting the presence, activity or expression of the Glade of Bundibungyo-Ivory Coast hEbola virus in a biological material, such as cells, blood, saliva, urine, feces and so forth; and specifically at least one of EbBun or EboIC.

In a related aspect, the invention provides a method for detecting the presence of the inventive hEbola virus described above in a biological sample, the method includes (a) contacting the sample with an agent that selectively binds to a West African hEbola virus; and (b) detecting whether the compound binds to the West African hEbola virus in the sample.

In another aspect, the invention provides a method for detecting the presence of the inventive polypeptide described above, in a biological sample, said method includes (a) contacting the biological sample with an agent that selectively binds to the polypeptide; and (b) detecting whether the agent binds to the polypeptide in the sample. In another aspect, the invention provides a method for detecting the presence of a first nucleic acid molecule derived from the inventive hEbola virus described above in a biological sample, the method comprising: (a) contacting the biological sample with an agent that selectively binds to the polypeptide; and (b) detecting whether the agent binds to the polypeptide in the sample.

In another aspect, the invention provides a method for propagating the hEbola virus in host cells comprising infecting the host cells with the inventive isolated hEbola virus described above, culturing the host cells to allow the virus to multiply, and harvesting the resulting virions. Also provided by the present invention are host cells infected with the inventive hEbola virus described above.

In another aspect, the invention provides a method of detecting in a biological sample the presence of an antibody that immunospecifically binds hEbola virus, the method comprising: (a) contacting the biological sample with the inventive host cell host described above; and (b) detecting the antibody bound to the cell.

In another aspect, the invention provides vaccine preparations, comprising the inventive hEbola virus, including recombinant and chimeric forms of the virus, nucleic acid molecules comprised by the virus, or protein subunits of the virus. The invention also provides a vaccine formulation comprising a therapeutically or prophylactically effective amount of the inventive hEbola virus described above, and a pharmaceutically acceptable carrier. In one embodiment, the invention provides a vaccine formulation comprising a therapeutically or prophylactically effective amount of a protein extract of the inventive hEbola virus described above, or a subunit thereof; and a pharmaceutically acceptable carrier. In another, the invention provides a vaccine formulation comprising a therapeutically or prophylactically effective amount of a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 1 or a complement thereof, and a pharmaceutically acceptable carrier. In another, the invention provides a vaccine formulation comprising a therapeutically or prophylactically effective amount of a nucleic acid molecule comprising any of inventive the nucleotide sequences as described above, or a complement thereof, and a pharmaceutically acceptable carrier.

In a related aspect, the invention provides an immunogenic formulation comprising an immunogenically effective amount of the inventive hEbola virus described above, and a pharmaceutically acceptable carrier. In another related aspect, the invention provides an immunogenic formulation comprising an immunogenically effective amount of a protein extract of the inventive hEbola virus described above or a subunit thereof, and a pharmaceutically acceptable carrier. In another related aspect, the invention provides an immunogenic formulation comprising an immunogenically effective amount of a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 1 or a complement thereof, and a pharmaceutically acceptable carrier. In another related aspect, the invention provides an immunogenic formulation comprising an immunogenically effective amount of a nucleic acid molecule comprising the inventive nucleotide sequence as described above or a complement thereof, and a pharmaceutically acceptable carrier. In another related aspect, the invention provides an immunogenic formulation comprising an immunogenically effective amount of any of the inventive polypeptides described above.

In another aspect, the present invention provides pharmaceutical compositions comprising antiviral agents of the present invention and a pharmaceutically acceptable carrier. In a specific embodiment, the antiviral agent of the invention is an antibody that immunospecifically binds hEbola virus or any hEbola epitope. In another specific embodiment, the antiviral agent is a polypeptide or protein of the present invention or nucleic acid molecule of the invention.

In a related aspect, the invention provides a pharmaceutical composition comprising a prophylactically or therapeutically effective amount of an anti-hEbola EboBun agent and a pharmaceutically acceptable carrier.

The invention also provides kits containing compositions and formulations of the present invention. Thus, in another aspect, the invention provides a kit comprising a container containing the inventive immunogenic formulation described above. In another aspect, the invention provides a kit comprising a container containing the inventive vaccine formulation described above. In another, the invention provides a kit comprising a container containing the inventive pharmaceutical composition described above. In another, the invention provides a kit comprising a container containing the inventive vaccine formulation described above. In another, the invention provides a method for identifying a subject infected with the inventive hEbola virus described above, comprising: (a) obtaining total RNA from a biological sample obtained from the subject; (b) reverse transcribing the total RNA to obtain cDNA; and (c) amplifying the cDNA using a set of primers derived from a nucleotide sequence of the inventive hEbola virus described above.

The invention further relates to the use of the sequence information of the isolated virus for diagnostic and therapeutic methods.

In another aspect, the present invention provides methods for screening antiviral agents that inhibit the infectivity or replication of hEbola virus or variants thereof.

The invention further provides methods of preparing recombinant or chimeric forms of hEbola.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 represents a Phylogenetic tree comparing full-length genomes of Ebolavirus and Marburg virus by Bayesian analysis;

FIG. 2 represents an alignment of genomes of novel hEbola EboBun (SEQ ID NO: 1) referred to below as “Ebola Bundibugyo” or “EboBun”, and hEbola Zaire (SEQ ID NO: 20); referred to below as “Ebola Zaire ’76” or “EboZ” and hEbola Ivory Coast (SEQ ID NO: 10) also referred to below as “EboIC”.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

It is to be understood that the present invention is not limited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.

Due to the sequence divergence of EboBun relative to all previously recognized ebolaviruses, the present invention has utility in design of diagnostic assays to monitor Ebola HF disease in humans and animals, and develop effective antivirals and vaccines.

The EboBun virus of the present invention is genetically distinct, differing by more than 30% at the genome level from all other known ebolavirus species. The unique nature of this virus created challenges for traditional filovirus molecular based diagnostic assays and genome sequencing approaches. Instead, over 70% of the virus genome was sequenced using a recently developed random-primed pyrosequencing approach which allowed the rapid development of molecular detection assay which were deployed in the disease outbreak response. This random-primed pyrosequencing draft sequence allowed faster completion of the whole genome sequence using traditional primer walking approach and confirmation that the EboBun virus represented a new ebolavirus species.

Definitions

The definitions herein provided are operative throughout the entire description of the invention set forth herein, including the Summary of the Invention.

The term “an antibody or an antibody fragment that immunospecifically binds a polypeptide of the invention” as used herein refers to an antibody or a fragment thereof that immunospecifically binds to the polypeptide encoded by the nucleotide sequence of SEQ ID NO: 1 (EboBun), or a fragment thereof, and does not non-specifically bind to other polypeptides. An antibody or a fragment thereof that immunospecifically binds to the polypeptide of the invention may cross-react with other antigens. Preferably, an antibody or a fragment thereof that immunospecifically binds to a polypeptide of the invention does not cross-react with other antigens. An antibody or a fragment thereof that immunospecifically binds to the polypeptide of the invention can be identified by, for example, immunoassays or other techniques known to those skilled in the art, or otherwise as described herein.

An “isolated” or “purified” peptide or protein is substantially free of cellular material or other contaminating proteins from the cell or tissue source from which the protein is derived, or substantially free of chemical precursors or other chemicals when chemically synthesized. The language “substantially free of cellular material” includes preparations of a polypeptide/protein in which the polypeptide/protein is separated from cellular components of the cells from which it is isolated or recombinantly produced. Thus, a polypeptide/protein that is substantially free of cellular material includes preparations of the polypeptide/protein having less than about 30%, 20%, 10%, 5%, 2.5%, or 1% (by dry weight) of contaminating protein. When the polypeptide/protein is recombinantly produced, it is also preferably substantially free of culture medium, i.e., culture medium represents less than about 20%, 10%, or 5% of the volume of the protein preparation.

When polypeptide/protein is produced by chemical synthesis, it is preferably substantially free of chemical precursors or other chemicals, i.e., it is separated from chemical precursors or other chemicals which are involved in the synthesis of the protein. Accordingly, such preparations of the polypeptide/protein have less than about 30%, 20%, 10%, 5% (by dry weight) of chemical precursors or compounds other than polypeptide/protein fragment of interest. In a preferred embodiment of the present invention, polypeptides/proteins are isolated or purified.

An “isolated” nucleic acid molecule is one which is separated from other nucleic acid molecules which are present in the natural source of the nucleic acid molecule. Moreover, an “isolated” nucleic acid molecule, such as a cDNA molecule, can be substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized. In a preferred embodiment of the invention, nucleic acid molecules encoding polypeptides/proteins of the invention are isolated or purified. The term “isolated” nucleic acid molecule does not include a nucleic acid that is a member of a library that has not been purified away from other library clones containing other nucleic acid molecules.

The term “portion” or “fragment” as used herein includes the specified fragment lengths, and all integers in between, inclusive of the specified end points in a specified range, and inclusive of any length up to the full length of a protein, polypeptide, or nucleic acid.

The term “having a biological activity of the protein” or “having biological activities of the polypeptides of the invention” refers to the characteristics of the polypeptides or proteins having a common biological activity, similar or identical structural domain, and/or having sufficient amino acid identity to the polypeptide encoded by the nucleotide sequence of SEQ ID NO: 1 (EboBun). Such common biological activities of the polypeptides of the invention include antigenicity and immunogenicity.

The term “under stringent condition” refers to hybridization and washing conditions under which nucleotide sequences having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to each other remain hybridized to each other. Such hybridization conditions are described in, for example but not limited to, Current Protocols in Molecular Biology, John Wiley & Sons, NY (1989), 6.3.1-6.3.6; Basic Methods in Molecular Biology, Elsevier Science Publishing Co., Inc., NY (1986), pp. 75-78, and 84-87; and Molecular Cloning, Cold Spring Harbor Laboratory, NY (1982), pp. 387-389, and are well known to those skilled in the art. A preferred, non-limiting example of stringent hybridization conditions is hybridization in 6× sodium chloride/sodium citrate (SSC), 0.5% SDS at about 68° C. followed by one or more washes in 2×SSC, 0.5% SDS at room temperature. Another preferred, non-limiting example of stringent hybridization conditions is hybridization in 6×SSC at about 45° C., followed by one or more washes in 0.2×SSC, 0.1% SDS at about 50-65° C.

The term “variant” as used herein refers either to a naturally occurring genetic mutant of hEbola EboBun, or hEbola EboIC, or a recombinantly prepared variation of these hEbola species, each of which contain one or more mutations in its genome compared to the hEbola of SEQ ID NO: 1 or 10. The term “variant” may also refer either to a naturally occurring variation of a given peptide or a recombinantly prepared variation of a given peptide or protein in which one or more amino acid residues have been modified by amino acid substitution, addition, or deletion.

“Homology” refers to sequence similarity or, alternatively, sequence identity, between two or more polynucleotide sequences or two or more polypeptide sequences.

The terms “percent identity” and “% identity,” as applied to polynucleotide sequences, refer to the percentage of identical nucleotide matches between at least two polynucleotide sequences aligned using a standardized algorithm. Such an algorithm may insert, in a standardized and reproducible way, gaps in the sequences being compared in order to optimize alignment between two sequences, and therefore achieve a more meaningful comparison of the two sequences.

Percent identity between polynucleotide sequences may be determined using one or more computer algorithms or programs known in the art or described herein. For example, percent identity can be determined using the default parameters of the CLUSTAL V algorithm as incorporated into the MEGALIGN version 3.12e sequence alignment program. This program is part of the LASERGENE software package, a suite of molecular biological analysis programs (DNASTAR, Madison, Wis.). CLUSTAL V is described in Higgins, D. G. and P. M. Sharp (1989; CABIOS 5:151-153) and in Higgins, D. G. et al. (1992; CABIOS 8:189-191). For pairwise alignments of polynucleotide sequences, the default parameters are set as follows: Ktuple=2, gap penalty=5, window=4, and “diagonals saved”=4. The “weighted” residue weight table is selected as the default.

Alternatively, a suite of commonly used and freely available sequence comparison algorithms which can be used is provided by the National Center for Biotechnology Information (NCBI) Basic Local Alignment Search Tool (BLAST) (Altschul, S. F. et al. (1990) J. Mol. Biol. 215:403-410), which is available from several sources, including the NCBI, Bethesda, Md., and on the NCBI World Wide Web site available on the Internet. The BLAST software suite includes various sequence analysis programs including “blastn,” that is used to align a known polynucleotide sequence with other polynucleotide sequences from a variety of databases. Also available is a tool called “BLAST 2 Sequences” that is used for direct pairwise comparison of two nucleotide sequences. “BLAST 2 Sequences” can be accessed and used interactively on the Internet via the NCBI World Wide Web site as well. The “BLAST 2 Sequences” tool can be used for both blastn and blastp (discussed below). BLAST programs are commonly used with gap and other parameters set to default settings. For example, to compare two nucleotide sequences, one may use blastn with the “BLAST 2 Sequences” tool Version 2.0.12 (Apr. 21, 2000) set at default parameters. Such default parameters may be, for example: Matrix:BLOSUM62; Reward for match: 1; Penalty for mismatch: −2; Open Gap: 5 and Extension Gap: 2 penalties; Gap×drop-off: 50; Expect: 10; Word Size: 11; Filter: on.

Percent identity may be measured over the length of an entire defined sequence, for example, as defined by a particular SEQ ID number, or may be measured over a shorter length, for example, over the length of a fragment taken from a larger, defined sequence, for instance, a fragment of at least 20, at least 30, at least 40, at least 50, at least 70, at least 100, or at least 200 contiguous nucleotides. Such lengths are exemplary only, and it is understood that any fragment length supported by the sequences shown herein, in the tables, figures, or sequence listing, may be used to describe a length over which percentage identity may be measured.

The phrases “percent identity” and “% identity”, as applied to polypeptide sequences, refer to the percentage of identical residue matches between at least two polypeptide sequences aligned using a standardized algorithm. Methods of polypeptide sequence alignment are well known. Some alignment methods take into account conservative amino acid substitutions. Such conservative substitutions, explained in more detail above, generally preserve the charge and hydrophobicity at the site of substitution, thus preserving the structure (and therefore function) of the polypeptide. The phrases “percent similarity” and “% similarity”, as applied to polypeptide sequences, refer to the percentage of residue matches, including identical residue matches and conservative substitutions, between at least two polypeptide sequences aligned using a standardized algorithm. In contrast, conservative substitutions are not included in the calculation of percent identity between polypeptide sequences.

Percent identity between polypeptide sequences may be determined using the default parameters of the CLUSTAL V algorithm as incorporated into the MEGALIGN version 3.12e sequence alignment program (described and referenced above). For pairwise alignments of polypeptide sequences using CLUSTAL V, the default parameters are set as follows: Ktuple=1, gap penalty=3, window=5, and “diagonals saved”=5. The PAM250 matrix is selected as the default residue weight table.

Alternatively the NCBI BLAST software suite may be used. For example, for a pairwise comparison of two polypeptide sequences, one may use the “BLAST 2 Sequences” tool Version 2.0.12 (Apr. 21, 2000) with blastp set at default parameters. Such default parameters may be, for example: Matrix: BLOSUM62; Open Gap: 11 and Extension Gap: 1 penalties; Gap×drop-off: 50; Expect: 10; Word Size: 3; Filter: on.

Percent identity may be measured over the length of an entire defined polypeptide sequence, for example, as defined by a particular SEQ ID number, or may be measured over a shorter length, for example, over the length of a fragment taken from a larger, defined polypeptide sequence, for instance, a fragment of at least 15, at least 20, at least 30, at least 40, at least 50, at least 70 or at least 150 contiguous residues. Such lengths are exemplary only, and it is understood that any fragment length supported by the sequences shown herein, in the tables, figures or sequence listing, may be used to describe a length over which percentage identity may be measured.

The term “agent” encompasses any chemical, biochemical, or biological molecule; such as small molecules, proteins, polypeptides, antibodies, nucleic acid molecules including DNA or RNA, and the like.

Methods and Compositions Related to the Inventive hEbola

The present invention is based upon the isolation and identification of a new human Ebola virus species, EboBun and the sequencing of the only other known West African Ebola species EboIC. EboBun was isolated from the patients suffering from hemorrhagic fever in a recent outbreak in Uganda. The isolated virus is a member of the Filoviridae family, a family of negative sense RNA viruses. Accordingly, the invention relates to the isolated EboBun or EBOIC virus that morphologically and phylogenetically relates to known members filoviridae.

In another aspect, the invention provides an isolated hEbola virus including a nucleic acid molecule with a nucleotide sequence that is preferably: a) a nucleotide sequence set forth in SEQ ID NO: 1; b) a nucleotide sequence that hybridizes to the sequence set forth in SEQ ID NO: 1 under stringent conditions; or c) a nucleotide sequence that has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to the SEQ ID NO: 1. In one embodiment of the present invention, the hEbola virus is killed. In another, the virus is attenuated. In another, the infectivity of the attenuated hEbola virus is reduced. In another, the infectivity is reduced by at least 5-fold, 10-fold, 25-fold, 50-fold, 100-fold, 250-fold, 500-fold, or 10,000-fold. In another, the replication ability of the attenuated hEbola virus is reduced. In another, the replication ability of the attenuated virus is educed by at least 5-fold, 10-fold, 25-fold, 50-fold, 100-fold, 250-fold, 500-fold, 1,000-fold, or 10,000-fold. In another, the protein synthesis ability of the attenuated virus is reduced. In another, the protein synthesis ability is reduced by at least 5-fold, 10-fold, 25-fold, 50-fold, 100-fold, 250-fold, 500-fold, 1,000-fold, or 10,000-fold. In another, the assembling ability of the attenuated hEbola virus is reduced. In another, the assembling ability of the attenuated virus is reduced by at least 5-fold, 10-fold, 25-fold, 50-fold, 100-fold, 250-fold, 500-fold, 1,000-fold, or 10,000-fold. In another, the cytopathic effect of the attenuated hEbola virus is reduced. In another, the cytopathic effect is reduced by at least 5-fold, 10-fold, 25-fold, 50-fold, 100-fold, 250-fold, 500-fold, 1,000-fold, or 10,000-fold.

In another aspect, the invention provides the complete genomic sequence of the hEbola virus EboBun or EboIC. In a specific embodiment, the virus includes a nucleotide sequence of SEQ ID NOs: 1 or 10, respectively.

In a related aspect, the invention provides nucleic acid molecules isolated from EboBun, EboIC, or fragments thereof. In one embodiment of the present invention, the isolated nucleic acid molecule includes the nucleotide sequence of SEQ ID NOs: 1 or 10, or a complement thereof. In another, the nucleic acid molecule includes a nucleotide sequence having at least 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 4600, 4700, 4800, or 4900 contiguous nucleotides of the nucleotide sequence of SEQ ID NO: 1, or a complement thereof; with the proviso that the nucleotide sequence is not comprised by the nucleotide sequence set forth in SEQ ID NO: 20 (Ebola Zaire nucleotide sequence); or at least 5000, 5500, 5600, 5700, 5800, 5900, 6000, 6100, 6200, 6300, 6400, 6500, or 6600 contiguous nucleotides of the nucleotide sequence of SEQ ID NOs: 1 or 10, or a complement thereof. In another embodiment, the isolated nucleic acid molecule includes a nucleotide sequence that encodes the EboBun amino acid sequence of SEQ ID NOs: 2-9 or 59, the EboIC amino acid sequence of SEQ ID NOs: 11-19, or a complement of the nucleotide sequence that encodes the EboBun amino acid sequences of SEQ ID NOs: 2-9 or 59 or the EboIC amino acid sequences of SEQ ID NOs: 11-19. In another, the isolated nucleic acid molecule hybridizes under stringent conditions to a nucleic acid molecule having the nucleotide sequence of SEQ ID NOs: 1 or 10 or a complement thereof, wherein the nucleic acid molecule encodes an amino acid sequence which has a biological activity exhibited by a polypeptide encoded by the nucleotide sequence of SEQ ID NOs: 1 or 10. In another, nucleic acid molecule is RNA. In another, nucleic acid molecule is DNA.

In another aspect, the invention provides proteins or polypeptides that are isolated from the EboBun, including viral proteins isolated from cells infected with the virus but not present in comparable uninfected cells. In one embodiment of the present invention, the amino acid sequences of the proteins or polypeptides are set forth in SEQ ID NOs: 2-9, 59, or 11-19, or fragments thereof. In one embodiment, polypeptides or proteins of the present invention have a biological activity of the protein (including antigenicity and/or immunogenicity) encoded by the sequence of SEQ ID NOs: 1 or 10. In another, the polypeptides or the proteins of the present invention have a biological activity of at least one protein having the amino acid sequence (including antigenicity and/or immunogenicity) set forth in SEQ ID NOS: 2-9, 59, or 11-19, or a fragment thereof.

In a related aspect, the invention provides an isolated polypeptide encoded by the nucleic acid molecule of the invention described above. In one embodiment of the present invention, the isolated polypeptide includes the amino acid sequence selected from the group consisting of: a) an amino acid sequence set forth in SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, or 9; 11, 12, 13, 14, 15, 16, 17, 18 or 19; and b) an amino acid sequence that has 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology to the amino acid sequence according to a). In another, the isolated polypeptide comprises the amino acid sequence having at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 210, 220, 230, 240 or 250 contiguous amino acid residues of the amino acid sequence of SEQ ID NOs: 5 or 18 (VP24); 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 210, 220, 230, 240, 250, 260, 270, 280 contiguous amino acid residues of the amino acid sequence of SEQ ID NOs: 6 or 17 (VP30); 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 310, or 320 contiguous amino acid residues of the amino acid sequence of SEQ ID NOs: 8 or 13 (VP40); 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 310, 320, 330, or 340 contiguous amino acid residues of the amino acid sequence of SEQ ID NOs: 7 or 12 (VP35); 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 310, 320, 330, 340, 350, 360, or 370 contiguous amino acid residues of the amino acid sequence of SEQ ID NOs: 4 or 15 (SGP); 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 310, 320, 330, 340, 350, 360, or 370 contiguous amino acid residues of the amino acid sequence of SEQ ID NOs: 59 or 16 (SSGP); 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 450, 500, 550, 600, 610, 620, 630, 640, 650, 660, or 670 contiguous amino acid residues of the amino acid sequence of SEQ ID NOs: 9 or 14 (GP); 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 450, 500, 550, 600, 650, 700, 710, 720, or 730 contiguous amino acid residues of the amino acid sequence of SEQ ID NOs: 3 or 11 (NP); or 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1450, 1500, 1550, 1600, 1650, 1700, 1750, 1800, 1850, 1900, 1950, 2000, 2050, 2100, 2150, 2160, 2170, 2180, 2190, or 2200 contiguous amino acid residues of the amino acid sequence of SEQ ID NOs: 2 or 19 (L).

In other aspects, the invention relates to the use of an isolated West African hEbola virus for diagnostic and therapeutic methods. In one embodiment, the invention provides a method of detecting in a biological sample an antibody immunospecific for the hEbola virus using the inventive isolated hEbola virus described herein, or any of the inventive proteins or polypeptides as described herein. In another specific embodiment, the invention provides a method of screening for an antibody which immunospecifically binds and neutralizes hEbola EboBun or EboIC or a combination thereof. Such an antibody is useful for a passive immunization or immunotherapy of a subject infected with hEbola.

In another aspect, the invention provides an isolated antibody or an antigen-binding fragment thereof which immunospecifically binds to a West African genus hEbola virus of the invention described above, and illustratively including EboBun or EboIC. In one embodiment of the present invention, the isolated antibody or an antigen-binding fragment thereof neutralizes a West African genus hEbola virus. In another, the isolated antibody or an antigen-binding fragment thereof immunospecifically binds to the inventive polypeptide described above. The invention further provides antibodies that specifically bind a polypeptide of the invention encoded by the nucleotide sequence of SEQ ID NOs: 1 (EboBun) or 10 (EboIC), a fragment thereof, or encoded by a nucleic acid comprising a nucleotide sequence that hybridizes under stringent conditions to the nucleotide sequence of SEQ ID NOs: 1 (EboBun) or 10 (EboIC) and/or any hEbola EboBun epitope, having one or more biological activities of a polypeptide of the invention. These polypeptides include those shown in SEQ ID NOs: 2-9, 59, and 11-19. Such antibodies include, but are not limited to, polyclonal, monoclonal, bi-specific, multi-specific, human, humanized, chimeric antibodies, single chain antibodies, Fab fragments, F(ab′)2 fragments, disulfide-linked Fvs, intrabodies and fragments containing either a VL or VH domain or even a complementary determining region (CDR) that specifically binds to a polypeptide of the invention.

In other aspects, the invention provides methods for detecting the presence, activity or expression of the hEbola virus of the invention in a biological material, such as cells, blood, saliva, urine, and so forth. The increased or decreased activity or expression of the hEbola virus in a sample relative to a control sample can be determined by contacting the biological material with an agent which can detect directly or indirectly the presence, activity or expression of the hEbola virus. In one embodiment of the present invention, the detecting agents are the antibodies or nucleic acid molecules of the present invention. Antibodies of the invention can also be used to treat hemorrhagic fever.

In a related aspect, the invention provides a method for detecting the presence of the inventive hEbola virus described above in a biological sample, the method comprising: (a) contacting the sample with an agent that selectively binds to the hEbola virus; and (b) detecting whether the compound binds to the hEbola virus in the sample. In one embodiment of the present invention, the biological sample is selected from the group consisting of cells; blood; serum; plasma; feces; rectal, vaginal and conjunctival swabs. In another, the agent that binds to the virus is an antibody. In another, the agent that binds to the virus is a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 1 or a complement thereof. In another, the agent that binds to the virus is a nucleic acid molecule comprising a nucleotide sequence having at least 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 4600, 4700, 4800, 4900, 5000, 5500, 5600, 5700, 5800, 5900, 6000, 6100, 6200, 6300, 6400, 6500, or 6600 contiguous nucleotides of the nucleotide sequence of SEQ ID NOs: 1 or 10, or a complement thereof.

In another aspect, the invention provides a method for detecting the presence of the inventive polypeptide described above, in a biological sample, the method comprising: (a) contacting the biological sample with an agent that selectively binds to the polypeptide; and (b) detecting whether the agent binds to the polypeptide in the sample. In one embodiment of the present invention, the biological sample is selected from the group consisting of cells; blood; serum; plasma; feces; rectal, vaginal and conjunctival swabs. In another, the agent that binds to the polypeptide is an antibody or an antigen-binding fragment thereof.

In another aspect, the invention provides a method for detecting the presence of a first nucleic acid molecule derived from the inventive hEbola virus described above in a biological sample, the method includes (a) contacting the biological sample with an agent that selectively binds to the nucleic acid; and (b) detecting whether the agent binds to the nucleotide in the sample. In one embodiment of the present invention, the agent that binds to the first nucleic acid molecule is a second nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 1 or a complement thereof. In another, the second nucleic acid molecule comprises at least 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 4600, 4700, 4800, 4900, 5000, 5500, 5600, 5700, 5800, 5900, 6000, 6100, 6200, 6300, 6400, 6500, or 6600 contiguous nucleotides of the nucleotide sequence of SEQ ID NOs: 1 or 10, or a complement thereof.

In another aspect, the invention provides a method for propagating the hEbola virus in host cells comprising infecting the host cells with an inventive isolated West African hEbola virus described above, culturing the host cells to allow the virus to multiply, and harvesting the resulting virions. Also provided by the present invention are host cells infected with the inventive hEbola virus described above. In one embodiment of the present invention, the host cell is a primate cell.

In another aspect, the invention provides a method of detecting in a biological sample the presence of an antibody that immunospecifically binds hEbola virus, the method includes: (a) contacting the biological sample with the inventive host cell described above; and (b) detecting the antibody bound to the cell.

In another aspect, the invention provides vaccine preparations, including the inventive hEbola virus, including recombinant and chimeric forms of the virus, nucleic acid molecules comprised by the virus, or protein subunits of the virus. In one embodiment, the vaccine preparations of the present invention includes live but attenuated hEbola virus with or without pharmaceutically acceptable carriers, including adjuvants. In another, the vaccine preparations of the invention comprise an inactivated or killed hEbola EboBun virus, EboIC virus, or a combination thereof, with or without pharmaceutically acceptable carriers, including adjuvants. Such attenuated or inactivated viruses may be prepared by a series of passages of the virus through the host cells or by preparing recombinant or chimeric forms of virus. Accordingly, the present invention further provides methods of preparing recombinant or chimeric forms of the inventive hEbola viruses described herein.

In another specific embodiment, the invention provides a vaccine formulation comprising a therapeutically or prophylactically effective amount of the inventive hEbola virus described above, and a pharmaceutically acceptable carrier. In another, the invention provides a vaccine formulation comprising a therapeutically or prophylactically effective amount of a protein extract of the inventive hEbola virus described above, or a subunit thereof; and a pharmaceutically acceptable carrier. In another aspect, the invention provides a vaccine formulation comprising a therapeutically or prophylactically effective amount of a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NOs: 1 or 10, or a complement thereof, and a pharmaceutically acceptable carrier. In another, the invention provides a vaccine formulation comprising a therapeutically or prophylactically effective amount of a nucleic acid molecule comprising any of inventive the nucleotide sequences as described above, or a complement thereof, and a pharmaceutically acceptable carrier. In another aspect, the invention provides a vaccine formulation comprising a therapeutically or prophylactically effective amount of a protein extract of the inventive hEbola virus described above, or a subunit thereof; and a pharmaceutically acceptable carrier. In another aspect, the invention provides a vaccine formulation comprising a therapeutically or prophylactically effective amount of a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NOs: 1 or 10, or a complement thereof, and a pharmaceutically acceptable carrier. In another, the invention provides a vaccine formulation comprising a therapeutically or prophylactically effective amount of a nucleic acid molecule comprising any of inventive the nucleotide sequences as described above, or a complement thereof, and a pharmaceutically acceptable carrier.

In yet another specific embodiment, the vaccine preparations of the present invention comprise a nucleic acid or fragment of the hEbola virus, e.g., the virus having Accession No. 200706291, or nucleic acid molecules having the sequence of SEQ ID NOs: 1 or 10, or a fragment thereof. In another, the vaccine preparations comprise a polypeptide of the invention encoded by the nucleotide sequence of SEQ ID NOs: 1 or 10 or a fragment thereof. In a specific embodiment, the vaccine preparations comprise polypeptides of the invention as shown in SEQ ID NOs: 2-9, 59, or 11-19, or encoded by the nucleotide sequence of SEQ ID NOs: 1 or 10, or a fragment thereof.

Furthermore, the present invention provides methods for treating, ameliorating, managing or preventing hemorrhagic fever by administering the vaccine preparations or antibodies of the present invention alone or in combination with adjuvants, or other pharmaceutically acceptable excipients. Furthermore, the present invention provides methods for treating, ameliorating, managing, or preventing hemorrhagic fever by administering the inventive compositions and formulations including the vaccine preparations or antibodies of the present invention alone or in combination with antivirals [e.g., amantadine, rimantadine, gancyclovir, acyclovir, ribavirin, penciclovir, oseltamivir, foscamet zidovudine (AZT), didanosine (ddI), lamivudine (3TC), zalcitabine (ddC), stavudine (d4T), nevirapine, delavirdine, indinavir, ritonavir, vidarabine, nelfinavir, saquinavir, relenza, tamiflu, pleconaril, interferons, etc.], steroids and corticosteroids such as prednisone, cortisone, fluticasone and glucocorticoid, antibiotics, analgesics, bronchodilators, or other treatments for respiratory and/or viral infections.

In a related aspect, the invention provides an immunogenic formulation comprising an immunogenically effective amount of the inventive hEbola virus described above, and a pharmaceutically acceptable carrier.

In another related aspect, the invention provides an immunogenic formulation comprising an immunogenically effective amount of a protein extract of the inventive hEbola virus described above or a subunit thereof, and a pharmaceutically acceptable carrier.

In another related aspect, the invention provides an immunogenic formulation comprising an immunogenically effective amount of a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NOs: 1, 10, a combination thereof, or a complement thereof, and a pharmaceutically acceptable carrier.

In another related aspect, the invention provides an immunogenic formulation comprising an immunogenically effective amount of a nucleic acid molecule comprising the inventive nucleotide sequence as described above or a complement thereof, and a pharmaceutically acceptable carrier.

In another related aspect, the invention provides an immunogenic formulation comprising an immunogenically effective amount of any of the inventive polypeptides described above.

In another aspect, the present invention provides pharmaceutical compositions comprising antiviral agents of the present invention and a pharmaceutically acceptable carrier. In a specific embodiment, the antiviral agent of the invention is an antibody that immunospecifically binds hEbola virus or any hEbola epitope. In another specific embodiment, the antiviral agent is a polypeptide or protein of the present invention or nucleic acid molecule of the invention.

In a related aspect, the invention provides a pharmaceutical composition comprising a prophylactically or therapeutically effective amount of an anti-hEbola EboBun agent and a pharmaceutically acceptable carrier. In one embodiment of the present invention, the anti-hEbola EboBun agent is an antibody or an antigen-binding fragment thereof which immunospecifically binds to the hEbola virus of Deposit Accession No. 200706291, or polypeptides or protein derived therefrom. In another, the anti-hEbola agent is a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NOs: 1, 10, a combination thereof, or a fragment thereof. In another, the anti-hEbola agent is a polypeptide encoded by a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NOs: 1, 10, a combination thereof, or a fragment thereof having a biological activity of the polypeptide.

The invention also provides kits containing compositions and formulations of the present invention. Thus, in another aspect, the invention provides a kit comprising a container containing the inventive immunogenic formulation described above.

In another aspect, the invention provides a kit includes a container containing the inventive vaccine formulation described above.

In another aspect, the invention provides a kit including a container containing the inventive pharmaceutical composition described above.

In another aspect, the invention provides a kit including a container containing the inventive vaccine formulation described above.

In another aspect, the invention provides a method for identifying a subject infected with the inventive hEbola virus described above, including: (a) obtaining total RNA from a biological sample obtained from the subject; (b) reverse transcribing the total RNA to obtain cDNA; and (c) amplifying the cDNA using a set of primers derived from a nucleotide sequence of the inventive hEbola virus described above.

In one embodiment of the present invention, the set of primers are derived from the nucleotide sequence of the genome of the hEbola virus of Deposit Accession No. 200706291. In another, the set of primers are derived from the nucleotide sequence of SEQ ID NOs: 1 or 10 or any of the inventive nucleotide sequences as described above, or a complement thereof.

The invention further relates to the use of the sequence information of the isolated virus for diagnostic and therapeutic methods. In a specific embodiment, the invention provides nucleic acid molecules which are suitable for use as primers consisting of or including the nucleotide sequence of SEQ ID NOs: 1 or 10, or a complement thereof, or at least a portion of the nucleotide sequence thereof. In another specific embodiment, the invention provides nucleic acid molecules which are suitable for hybridization to the inventive hEbola nucleic acid; including, but not limited to PCR primers, Reverse Transcriptase primers, probes for Southern analysis or other nucleic acid hybridization analysis for the detection of hEbola nucleic acids, e.g., consisting of or including the nucleotide sequence of SEQ ID NOs: 1, 10 a combination thereof, a complement thereof, or a portion thereof. The invention further encompasses chimeric or recombinant viruses encoded in whole or in part by the nucleotide sequences.

In another aspect, the present invention provides methods for screening antiviral agents that inhibit the infectivity or replication of hEbola virus or variants thereof.

The invention further provides methods of preparing recombinant or chimeric forms of hEbola.

In another aspect, the invention provides vaccine preparations including the hEbola virus, including recombinant and chimeric forms of the virus, or subunits of the virus. The present invention encompasses recombinant or chimeric viruses encoded by viral vectors derived from the genome of the inventive hEbola virus described herein or natural variants thereof. In a specific embodiment, a recombinant virus is one derived from the hEbola virus of Deposit Accession No. 200706291. It is recognized that natural variants of the inventive hEbola viruses described herein comprise one or more mutations, including, but not limited to, point mutations, rearrangements, insertions, deletions etc., to the genomic sequence. It is recognized that the mutations may or may not result in a phenotypic change.

In another specific embodiment, a chimeric virus of the invention is a recombinant hEbola EboBun or EboIC virus which further comprises a heterologous nucleotide sequence. In accordance with the invention, a chimeric virus may be encoded by a nucleotide sequence in which heterologous nucleotide sequences have been added to the genome or in which endogenous or native nucleotide sequences have been replaced with heterologous nucleotide sequences.

According to the present invention, the chimeric viruses are encoded by the viral vectors of the invention which further comprise a heterologous nucleotide sequence. In accordance with the present invention a chimeric virus is encoded by a viral vector that may or may not include nucleic acids that are non-native to the viral genome. In accordance with the invention a chimeric virus is encoded by a viral vector to which heterologous nucleotide sequences have been added, inserted or substituted for native or non-native sequences. In accordance with the present invention, the chimeric virus may be encoded by nucleotide sequences derived from different species or variants of hEbola virus. In particular, the chimeric virus is encoded by nucleotide sequences that encode antigenic polypeptides derived from different species or variants of hEbola virus.

A chimeric virus may be of particular use for the generation of recombinant vaccines protecting against two or more viruses (Tao et al., J. Virol. 72, 2955-2961; Durbin et al., 2000, J. Virol. 74, 6821-6831; Skiadopoulos et al., 1998, J. Virol. 72, 1762-1768 (1998); Teng et al., 2000, J. Virol. 74, 9317-9321). For example, it can be envisaged that a virus vector derived from the hEbola virus expressing one or more proteins of variants of hEbola virus including hEbola EboBun, or vice versa, will protect a subject vaccinated with such vector against infections by both the native hEbola and the variant. Attenuated and replication-defective viruses may be of use for vaccination purposes with live vaccines as has been suggested for other viruses. (See, for example, PCT WO 02/057302, at pp. 6 and 23; and United States Patent Application Publication 2008/0069838 incorporated by reference herein).

In accordance with the present invention the heterologous sequence to be incorporated into the viral vectors encoding the recombinant or chimeric viruses of the invention include sequences obtained or derived from different species or variants of hEbola.

In certain embodiments, the chimeric or recombinant viruses of the invention are encoded by viral vectors derived from viral genomes wherein one or more sequences, intergenic regions, termini sequences, or portions or entire ORF have been substituted with a heterologous or non-native sequence. In certain embodiments of the invention, the chimeric viruses of the invention are encoded by viral vectors derived from viral genomes wherein one or more heterologous sequences have been inserted or added to the vector.

The selection of the viral vector may depend on the species of the subject that is to be treated or protected from a viral infection. If the subject is human, then an attenuated hEbola virus can be used to provide the antigenic sequences.

In accordance with the present invention, the viral vectors can be engineered to provide antigenic sequences which confer protection against infection by the inventive hEbola and natural variants thereof. The viral vectors may be engineered to provide one, two, three or more antigenic sequences. In accordance with the present invention the antigenic sequences may be derived from the same virus, from different species or variants of the same type of virus, or from different viruses.

The expression products and/or recombinant or chimeric virions obtained in accordance with the invention may advantageously be utilized in vaccine formulations. The expression products and chimeric virions of the present invention may be engineered to create vaccines against a broad range of pathogens, including viral and bacterial antigens, tumor antigens, allergen antigens, and auto antigens involved in autoimmune disorders. One way to achieve this goal involves modifying existing hEbola genes to contain foreign sequences in their respective external domains. Where the heterologous sequences are epitopes or antigens of pathogens, these chimeric viruses may be used to induce a protective immune response against the disease agent from which these determinants are derived. In particular, the chimeric virions of the present invention may be engineered to create vaccines for the protection of a subject from infections with hEbola virus and variants thereof.

Thus, the present invention further relates to the use of viral vectors and recombinant or chimeric viruses to formulate vaccines against a broad range of viruses and/or antigens. The present invention also encompasses recombinant viruses including a viral vector derived from the hEbola or variants thereof which contains sequences which result in a virus having a phenotype more suitable for use in vaccine formulations, e.g., attenuated phenotype or enhanced antigenicity. The mutations and modifications can be in coding regions, in intergenic regions and in the leader and trailer sequences of the virus.

The invention provides a host cell including a nucleic acid or a vector according to the invention. Plasmid or viral vectors containing the polymerase components of hEbola virus are generated in prokaryotic cells for the expression of the components in relevant cell types (bacteria, insect cells, eukaryotic cells). Plasmid or viral vectors containing full-length or partial copies of the hEbola genome will be generated in prokaryotic cells for the expression of viral nucleic acids in vitro or in vivo. The latter vectors optionally contain other viral sequences for the generation of chimeric viruses or chimeric virus proteins, optionally lack parts of the viral genome for the generation of replication defective virus, and optionally contain mutations, deletions or insertions for the generation of attenuated viruses. In addition, the present invention provides a host cell infected with hEbola virus of Deposit Accession No. 200706291,

Infectious copies of West African hEbola (being wild type, attenuated, replication-defective or chimeric) are optionally produced upon co-expression of the polymerase components according to the state-of-the-art technologies described above.

In addition, eukaryotic cells, transiently or stably expressing one or more full-length or partial hEbola proteins are optionally used. Such cells are preferably made by transfection (proteins or nucleic acid vectors), infection (viral vectors) or transduction (viral vectors) and are useful for complementation of mentioned wild type, attenuated, replication-defective or chimeric viruses.

The viral vectors and chimeric viruses of the present invention optionally modulate a subject’s immune system by stimulating a humoral immune response, a cellular immune response or by stimulating tolerance to an antigen. As used herein, a subject means: humans, primates, horses, cows, sheep, pigs, goats, dogs, cats, avian species and rodents.

Formulation of Vaccines and Antivirals

In a preferred embodiment, the invention provides a proteinaceous molecule or hEbola virus specific viral protein or functional fragment thereof encoded by a nucleic acid according to the invention. Useful proteinaceous molecules are for example derived from any of the genes or genomic fragments derivable from the virus according to the invention, preferably the GP, L, NP, sGP, VP24, VP30, VP35, and VP 40 proteins described herein. Such molecules, or antigenic fragments thereof, as provided herein, are for example useful in diagnostic methods or kits and in pharmaceutical compositions such as subunit vaccines. Particularly useful are polypeptides encoded by the nucleotide sequence of SEQ ID NOs: 1 or 10; or antigenic fragments thereof for inclusion as antigen or subunit immunogen, but inactivated whole virus can also be used. Particularly useful are also those proteinaceous substances that are encoded by recombinant nucleic acid fragments of the hEbola genome, of course preferred are those that are within the preferred bounds and metes of ORFs, in particular, for eliciting hEbola specific antibody or T cell responses, whether in vivo (e.g. for protective or therapeutic purposes or for providing diagnostic antibodies) or in vitro (e.g. by phage display technology or another technique useful for generating synthetic antibodies).

It is recognized that numerous variants, analogues, or homologues of EboBun polypeptides are within the scope of the present invention including amino acid substitutions, alterations, modifications, or other amino acid changes that increase, decrease, or do not alter the function or immunogenic propensity of the inventive immunogen or vaccine. Several post-translational modifications are similarly envisioned as within the scope of the present invention illustratively including incorporation of a non-naturally occurring amino acid(s), phosphorylation, glycosylation, sulfation, and addition of pendent groups such as biotynlation, fluorophores, lumiphores, radioactive groups, antigens, or other molecules.

Methods of expressing and purifying natural or recombinant peptides and proteins are well known in the art. Illustratively, peptides and proteins are recombinantly expressed in eukaryotic cells. Exemplary eukaryotic cells include yeast, HeLa cells, 293 cells, COS cells, Chinese hamster ovary cells (CHO), and many other cell types known in the art. Both eukaryotic and prokaryotic expression systems and cells are available illustratively from Invitrogen Corp., Carlsbad, Calif. It is appreciated that cell-free expression systems are similarly operable.

In a preferred embodiment an immunogenic polypeptide is a full length EboBun protein. Preferably, an immunogen is a full length EboBun protein of SEQ ID NOs: 2-9 or 59, or EboIC SEQ ID NOs: 11-19, or a fragment thereof as described herein. Preferably, an immunogen is has a minimum of 5 amino acids. As used herein an immunogen is preferably a polypeptide. In the context of an immunogenic polypeptide the terms immunogen, polypeptide, and antigen are used interchangeably.

Modifications and changes can be made in the structure of the inventive immunogens that are the subject of the application and still obtain a molecule having similar or improved characteristics as the wild-type sequence (e.g., a conservative amino acid substitution). For example, certain amino acids are optionally substituted for other amino acids in a sequence without appreciable loss of immunogenic activity. Because it is the interactive capacity and nature of a polypeptide that defines that polypeptide’s biological functional activity, certain amino acid sequence substitutions can be made in a polypeptide sequence and nevertheless obtain a polypeptide with like or improved properties. Optionally, a polypeptide is used that has less or more immunogenic activity compared to the wild-type sequence.

In making such changes, the hydropathic index of amino acids is preferably considered. The importance of the hydropathic amino acid index in conferring interactive biologic function on a polypeptide is generally understood in the art. It is known that certain amino acids can be substituted for other amino acids having a similar hydropathic index or score and still result in a polypeptide with similar biological activity. Each amino acid has been assigned a hydropathic index on the basis of its hydrophobicity and charge characteristics. Those indices are: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine/cysteine (+2.5); methionine (+1.9); alanine (+1.8); glycine (−0.4); threonine (−0.7); serine (−0.8); tryptophan (−0.9); tyrosine (−1.3); proline (−1.6); histidine (−3.2); glutamate (−3.5); glutamine (−3.5); aspartate (−3.5); asparagine (−3.5); lysine (−3.9); and arginine (−4.5).

It is believed that the relative hydropathic character of the amino acid determines the secondary structure of the resultant polypeptide, which in turn defines the interaction of the polypeptide with other molecules, such as enzymes, substrates, receptors, antibodies, antigens, and the like. It is known in the art that an amino acid can be substituted by another amino acid having a similar hydropathic index and still obtain a functionally equivalent immunogen. In such changes, the substitution of amino acids whose hydropathic indices are within ±2 is preferred, those within ±1 are particularly preferred, and those within ±0.5 are even more particularly preferred.

As outlined above, amino acid substitutions are generally based on the relative similarity of the amino acid side-chain substituents, for example, their hydrophobicity, hydrophilicity, charge, size, and the like. Exemplary substitutions that take various of the foregoing characteristics into consideration are well known to those of skill in the art and include (original residue: exemplary substitution): (Ala: Gly, Ser), (Arg: Lys), (Asn: Gln, His), (Asp: Glu, Cys, Ser), (Gln: Asn), (Glu: Asp), (Gly: Ala), (His: Asn, Gln), (Ile: Leu, Val), (Leu: Ile, Val), (Lys: Arg), (Met: Leu, Tyr), (Ser: Thr), (Thr: Ser), (Tip: Tyr), (Tyr: Trp, Phe), and (Val: Ile, Leu). Embodiments of this disclosure thus contemplate functional or biological equivalents of a polypeptide and immunogen as set forth above. In particular, embodiments of the polypeptides and immunogens optionally include variants having about 50%, 60%, 70%, 80%, 90%, and 95% sequence identity to the polypeptide of interest.

The invention provides vaccine formulations for the prevention and treatment of infections with hEbola virus. In certain embodiments, the vaccine of the invention comprises recombinant and chimeric viruses of the hEbola virus. In certain embodiments, the virus is attenuated.

In another embodiment of this aspect of the invention, inactivated vaccine formulations are prepared using conventional techniques to “kill” the chimeric viruses. Inactivated vaccines are “dead” in the sense that their infectivity has been destroyed. Ideally, the infectivity of the virus is destroyed without affecting its immunogenicity. In order to prepare inactivated vaccines, the chimeric virus may be grown in cell culture or in the allantois of the chick embryo, purified by zonal ultracentrifugation, inactivated by formaldehyde or β-propiolactone, and pooled. The resulting vaccine is usually inoculated intramuscularly or intranasally.

Inactivated viruses are optionally formulated with a suitable adjuvant in order to enhance the immunological response. Such adjuvants illustratively include but are not limited to mineral gels, e.g., aluminum hydroxide; surface active substances such as lysolecithin, pluronic polyols, polyanions; peptides; oil emulsions; and potentially useful human adjuvants such as BCG and Corynebacterium parvum.

In another aspect, the present invention also provides DNA vaccine formulations including a nucleic acid or fragment of the inventive hEbola virus, e.g., the virus having Accession No. 200706291, or nucleic acid molecules having the sequence of SEQ ID NOs: 1 or 10, or a fragment thereof. In another specific embodiment, the DNA vaccine formulations of the present invention comprise a nucleic acid or fragment thereof encoding the antibodies which immunospecifically bind hEbola viruses. In DNA vaccine formulations, a vaccine DNA comprises a viral vector, such as that derived from the hEbola virus, bacterial plasmid, or other expression vector, bearing an insert including a nucleic acid molecule of the present invention operably linked to one or more control elements, thereby allowing expression of the vaccinating proteins encoded by the nucleic acid molecule in a vaccinated subject. Such vectors can be prepared by recombinant DNA technology as recombinant or chimeric viral vectors carrying a nucleic acid molecule of the present invention.

A nucleic acid as used herein refers to single- or double-stranded molecules which are optionally DNA, including the nucleotide bases A, T, C and G, or RNA, including the bases A, U (substitutes for T), C, and G. The nucleic acid may represent a coding strand or its complement. Nucleic acids are optionally identical in sequence to the sequence which is naturally occurring or include alternative codons which encode the same amino acid as that which is found in the naturally occurring sequence. Furthermore, nucleic acids optionally include codons which represent conservative substitutions of amino acids as are well known in the art.

As used herein, the term “isolated nucleic acid” means a nucleic acid separated or substantially free from at least some of the other components of the naturally occurring organism, for example, the cell structural components commonly found associated with nucleic acids in a cellular environment and/or other nucleic acids. The isolation of nucleic acids is illustratively accomplished by techniques such as cell lysis followed by phenol plus chloroform extraction, followed by ethanol precipitation of the nucleic acids. The nucleic acids of this invention are illustratively isolated from cells according to methods well known in the art for isolating nucleic acids. Alternatively, the nucleic acids of the present invention are optionally synthesized according to standard protocols well described in the literature for synthesizing nucleic acids. Modifications to the nucleic acids of the invention are also contemplated, provided that the essential structure and function of the peptide or polypeptide encoded by the nucleic acid are maintained.

The nucleic acid encoding the peptide or polypeptide of this invention is optionally part of a recombinant nucleic acid construct comprising any combination of restriction sites and/or functional elements as are well known in the art which facilitate molecular cloning and other recombinant DNA manipulations. Thus, the present invention further provides a recombinant nucleic acid construct including a nucleic acid encoding a polypeptide of this invention.

Generally, it may be more convenient to employ as the recombinant polynucleotide a cDNA version of the polynucleotide. It is believed that the use of a cDNA version will provide advantages in that the size of the gene will generally be much smaller and more readily employed to transfect the targeted cell than will a genomic gene, which will typically be up to an order of magnitude larger than the cDNA gene. However, the inventor does not exclude the possibility of employing a genomic version of a particular gene where desired.

As used herein, the terms “engineered” and “recombinant” cells are synonymous with “host” cells and are intended to refer to a cell into which an exogenous DNA segment or gene, such as a cDNA or gene has been introduced. Therefore, engineered cells are distinguishable from naturally occurring cells which do not contain a recombinantly introduced exogenous DNA segment or gene. A host cell is optionally a naturally occurring cell that is transformed with an exogenous DNA segment or gene or a cell that is not modified. A host cell preferably does not possess a naturally occurring gene encoding RSV G protein. Engineered cells are, thus, cells having a gene or genes introduced through the hand of man. Recombinant cells illustratively include those having an introduced cDNA or genomic DNA, and also include genes positioned adjacent to a promoter not naturally associated with the particular introduced gene.

To express a recombinant encoded polypeptide in accordance with the present invention one optionally prepares an expression vector that comprises a polynucleotide under the control of one or more promoters. To bring a coding sequence “under the control of” a promoter, one positions the 5′ end of the translational initiation site of the reading frame generally between about 1 and 50 nucleotides “downstream” of (i.e., 3′ of) the chosen promoter. The “upstream” promoter stimulates transcription of the inserted DNA and promotes expression of the encoded recombinant protein. This is the meaning of “recombinant expression” in the context used here.

Many standard techniques are available to construct expression vectors containing the appropriate nucleic acids and transcriptional/translational control sequences in order to achieve protein or peptide expression in a variety of host-expression systems. Cell types available for expression include, but are not limited to, bacteria, such as E. coli and B. subtilis transformed with recombinant phage DNA, plasmid DNA or cosmid DNA expression vectors.

Certain examples of prokaryotic hosts illustratively include E. coli strain RR1, E. coli LE392, E. coli B, E. coli 1776 (ATCC No. 31537) as well as E. coli W3110 (F-, lambda-, prototrophic, ATCC No. 273325); bacilli such as Bacillus subtilis; and other enterobacteria such as Salmonella typhimurium, Serratia marcescens, and various Pseudomonas species.

In general, plasmid vectors containing replicon and control sequences that are derived from species compatible with the host cell are used in connection with these hosts. The vector ordinarily carries a replication site, as well as marking sequences that are capable of providing phenotypic selection in transformed cells. For example, E. coli is often transformed using pBR322, a plasmid derived from an E. coli species. Plasmid pBR322 contains genes for ampicillin and tetracycline resistance and thus provides easy means for identifying transformed cells. The pBR322 plasmid, or other microbial plasmid or phage may also contain, or be modified to contain, promoters that can be used by the microbial organism for expression of its own proteins.

In addition, phage vectors containing replicon and control sequences that are compatible with the host microorganism are optionally used as transforming vectors in connection with these hosts. For example, the phage lambda is optionally utilized in making a recombinant phage vector that can be used to transform host cells, such as E. coli LE392.

Further useful vectors include pIN vectors and pGEX vectors, for use in generating glutathione S-transferase (GST) soluble fusion proteins for later purification and separation or cleavage. Other suitable fusion proteins are those with β-galactosidase, ubiquitin, or the like.

Promoters that are most commonly used in recombinant DNA construction include the β-lactamase (penicillinase), lactose and tryptophan (trp) promoter systems. While these are the most commonly used, other microbial promoters have been discovered and utilized, and details concerning their nucleotide sequences have been published, enabling those of skill in the art to ligate them functionally with plasmid vectors.

For expression in Saccharomyces, the plasmid YRp7, for example, is commonly used. This plasmid contains the trp1 gene, which provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, for example ATCC No. 44076 or PEP4-1. The presence of the trp1 lesion as a characteristic of the yeast host cell genome then provides an effective environment for detecting transformation by growth in the absence of tryptophan.

Suitable promoting sequences in yeast vectors illustratively include the promoters for 3-phosphoglycerate kinase or other glycolytic enzymes, such as enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase, and glucokinase. In constructing suitable expression plasmids, the termination sequences associated with these genes are also preferably ligated into the expression vector 3′ of the sequence desired to be expressed to provide polyadenylation of the mRNA and termination.

Other suitable promoters, which have the additional advantage of transcription controlled by growth conditions, illustratively include the promoter region for alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degradative enzymes associated with nitrogen metabolism, and the aforementioned glyceraldehyde-3-phosphate dehydrogenase, and enzymes responsible for maltose and galactose utilization.

In addition to microorganisms, cultures of cells derived from multicellular organisms are also operable as hosts. In principle, any such cell culture is operable, whether from vertebrate or invertebrate culture. In addition to mammalian cells, these include insect cell systems infected with recombinant virus expression vectors (e.g., baculovirus); and plant cell systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors (e.g., Ti plasmid) containing one or more coding sequences.

In a useful insect system, Autographica californica nuclear polyhedrosis virus (AcNPV) is used as a vector to express foreign genes. The virus grows in Spodoptera frugiperda cells. The isolated nucleic acid coding sequences are cloned into non-essential regions (for example the polyhedron gene) of the virus and placed under control of an AcNPV promoter (for example, the polyhedron promoter). Successful insertion of the coding sequences results in the inactivation of the polyhedron gene and production of non-occluded recombinant virus (i.e., virus lacking the proteinaceous coat coded for by the polyhedron gene). These recombinant viruses are then used to infect Spodoptera frugiperda cells in which the inserted gene is expressed (e.g., U.S. Pat. No. 4,215,051).

Examples of useful mammalian host cell lines include VERO and HeLa cells, Chinese hamster ovary (CHO) cell lines, W138, BHK, COS-7, 293, HepG2, NIH3T3, RIN and MDCK cell lines. In addition, a host cell is preferably chosen that modulates the expression of the inserted sequences, or modifies and processes the gene product in the specific fashion desired. Such modifications (e.g., glycosylation) and processing (e.g., cleavage) of protein products may be important for the function of the encoded protein.

Different host cells have characteristic and specific mechanisms for the post-translational processing and modification of proteins. Appropriate cell lines or host systems are preferably chosen to ensure the correct modification and processing of the foreign protein expressed. Expression vectors for use in mammalian cells ordinarily include an origin of replication (as necessary), a promoter located in front of the gene to be expressed, along with any necessary ribosome binding sites, RNA splice sites, polyadenylation site, and transcriptional terminator sequences. The origin of replication is preferably provided either by construction of the vector to include an exogenous origin, such as may be derived from SV40 or other viral (e.g., Polyoma, Adeno, VSV, BPV) source, or may be provided by the host cell chromosomal replication mechanism. If the vector is integrated into the host cell chromosome, the latter is often sufficient.

The promoters are optionally derived from the genome of mammalian cells (e.g., metallothionein promoter) or from mammalian viruses (e.g., the adenovirus late promoter; the vaccinia virus 7.5K promoter). Further, it is also possible, and may be desirable, to utilize promoter or control sequences normally associated with the desired gene sequence, provided such control sequences are compatible with the host cell systems.

A number of viral based expression systems are operable herein, for example, commonly used promoters are derived from polyoma, Adenovirus 2, Adenovirus 5, cytomegalovirus and Simian Virus 40 (SV40). The early and late promoters of SV40 virus are useful because both are obtained easily from the virus as a fragment which also contains the SV40 viral origin of replication. Smaller or larger SV40 fragments are also operable, particularly when there is included the approximately 250 bp sequence extending from the HindIII site toward the BglI site located in the viral origin of replication.

In cases where an adenovirus is used as an expression vector, the coding sequences are preferably ligated to an adenovirus transcription/translation control complex, e.g., the late promoter and tripartite leader sequence. This chimeric gene is then optionally inserted in the adenovirus genome by in vitro or in vivo recombination. Insertion in a non-essential region of the viral genome (e.g., region E1 or E3) will result in a recombinant virus that is viable and capable of expressing proteins in infected hosts.

Specific initiation signals may also be required for efficient translation of the claimed isolated nucleic acid coding sequences. These signals include the ATG initiation codon and adjacent sequences. Exogenous translational control signals, including the ATG initiation codon, may additionally need to be provided. One of ordinary skill in the art would readily be capable of determining this need and providing the necessary signals. It is well known that the initiation codon must be in-frame (or in-phase) with the reading frame of the desired coding sequence to ensure translation of the entire insert. These exogenous translational control signals and initiation codons are optionally of a variety of origins, both natural and synthetic. The efficiency of expression is optionally enhanced by the inclusion of appropriate transcription enhancer elements or transcription terminators.

In eukaryotic expression, one will also typically desire to incorporate into the transcriptional unit an appropriate polyadenylation site if one was not contained within the original cloned segment. Typically, the poly A addition site is placed about 30 to 2000 nucleotides “downstream” of the termination site of the protein at a position prior to transcription termination.

For long-term, high-yield production of recombinant proteins, stable expression is preferred. For example, cell lines that stably express constructs encoding proteins are engineered. Rather than using expression vectors that contain viral origins of replication, host cells are preferably transformed with vectors controlled by appropriate expression control elements (e.g., promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.), and a selectable marker. Following the introduction of foreign DNA, engineered cells may be allowed to grow for 1-2 days in an enriched medium, and then are switched to a selective medium. The selectable marker in the recombinant plasmid confers resistance to the selection and allows cells to stably integrate the plasmid into their chromosomes and grow to form foci, which in turn can be cloned and expanded into cell lines.

A number of selection systems are illustratively used, including, but not limited, to the herpes simplex virus thymidine kinase, hypoxanthine-guanine phosphoribosyltransferase and adenine phosphoribosyltransferase genes, in tk−, hgprt− or aprt− cells, respectively. Also, antimetabolite resistance is optionally used as the basis of selection for dhfr, which confers resistance to methotrexate; gpt, which confers resistance to mycophenolic acid; neo, which confers resistance to the aminoglycoside G-418; and hygro, which confers resistance to hygromycin. It is appreciated that numerous other selection systems are known in the art that are similarly operable in the present invention.

The nucleic acids encoding the peptides and polypeptides of this invention are optionally administered as nucleic acid vaccines. For the purposes of vaccine delivery, a nucleic acid encoding a peptide or polypeptide of this invention is preferably in an expression vector that includes viral nucleic acid including, but not limited to, vaccinia virus, adenovirus, retrovirus and/or adeno-associated virus nucleic acid. The nucleic acid or vector of this invention is optionally in a liposome or a delivery vehicle which can be taken up by a cell via receptor-mediated or other type of endocytosis. The nucleic acid vaccines of this invention are preferably in a pharmaceutically acceptable carrier or administered with an adjuvant. The nucleic acids encoding the peptides and polypeptides of this invention can also be administered to cells in vivo or ex vivo.

It is contemplated that the isolated nucleic acids of the disclosure are optionally “overexpressed”, i.e., expressed in increased levels relative to its natural expression in cells of its indigenous organism, or even relative to the expression of other proteins in the recombinant host cell. Such overexpression is assessed by a variety of methods illustratively including radio-labeling and/or protein purification. However, simple and direct methods are preferred, for example, those involving SDS/PAGE and protein staining or immunoblotting, followed by quantitative analyses, such as densitometric scanning of the resultant gel or blot. A specific increase in the level of the recombinant protein or peptide in comparison to the level in natural in transfected cells is indicative of overexpression, as is a relative abundance of the specific protein in relation to the other proteins produced by the host cell and, e.g., visible on a gel.

Various heterologous vectors are described for DNA vaccinations against viral infections. For example, the vectors described in the following references, incorporated herein by reference, may be used to express hEbola sequences instead of the sequences of the viruses or other pathogens described; in particular, vectors described for hepatitis B virus (Michel, M. L. et al., 1995, DAN-mediated immunization to the hepatitis B surface antigen in mice: Aspects of the humoral response mimic hepatitis B viral infection in humans, Proc. Natl. Aca. Sci. USA 92:5307-5311; Davis, H. L. et al., 1993, DNA-based immunization induces continuous secretion of hepatitis B surface antigen and high levels of circulating antibody, Human Molec. Genetics 2:1847-1851), HIV virus (Wang, B. et al., 1993, Gene inoculation generates immune responses against human immunodeficiency virus type 1, Proc. Natl. Acad. Sci. USA 90:4156-4160; Lu, S. et al., 1996, Simian immunodeficiency virus DNA vaccine trial in Macques, J. Virol. 70:3978-3991; Letvin, N. L. et al., 1997, Potent, protective anti-HIV immune responses generated by bimodal HIV envelope DNA plus protein vaccination, Proc Natl Acad Sci USA. 94(17):9378-83), and influenza viruses (Robinson, H L et al., 1993, Protection against a lethal influenza virus challenge by immunization with a haemagglutinin-expressing plasmid DNA, Vaccine 11:957-960; Ulmer, J. B. et al., Heterologous protection against influenza by injection of DNA encoding a viral protein, Science 259:1745-1749), as well as bacterial infections, such as tuberculosis (Tascon, R. E. et al., 1996, Vaccination against tuberculosis by DNA injection, Nature Med. 2:888-892; Huygen, K. et al., 1996, Immunogenicity and protective efficacy of a tuberculosis DNA vaccine, Nature Med., 2:893-898), and parasitic infection, such as malaria (Sedegah, M., 1994, Protection against malaria by immunization with plasmid DNA encoding circumsporozoite protein, Proc. Natl. Acad. Sci. USA 91:9866-9870; Doolan, D. L. et al., 1996, Circumventing genetic restriction of protection against malaria with multigene DNA immunization: CD8+T cell-interferon .delta., and nitric oxide-dependent immunity, J. Exper. Med., 1183:1739-1746).

Many methods are optionally used to introduce the vaccine formulations described above. These include, but are not limited to, oral, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, and intranasal routes. Alternatively, in a preferred embodiment the chimeric virus vaccine formulation is introduced via the natural route of infection of the pathogen for which the vaccine is designed. The DNA vaccines of the present invention are optionally administered in saline solutions by injections into muscle or skin using a syringe and needle (Wolff J. A. et al., 1990, Direct gene transfer into mouse muscle in vivo, Science 247:1465-1468; Raz, E., 1994, Intradermal gene immunization: The possible role of DNA uptake in the induction of cellular immunity to viruses, c. Natl. Acd. Sci. USA 91:9519-9523). Another way to administer DNA vaccines operable herein is called the “gene gun” method, whereby microscopic gold beads coated with the DNA molecules of interest is fired into cells (Tang, D. et al., 1992, Genetic immunization is a simple method for eliciting an immune response, Nature 356:152-154). For general reviews of the methods for DNA vaccines, see Robinson, H. L., 1999, DNA vaccines: basic mechanism and immune responses (Review), Int. J. Mol. Med. 4(5):549-555; Barber, B., 1997, Introduction: Emerging vaccine strategies, Seminars in Immunology 9(5):269-270; and Robinson, H. L. et al., 1997, DNA vaccines, Seminars in Immunology 9(5):271-283.

Attenuation of hEbola Virus or Variants Thereof

The hEbola virus or variants thereof of the invention are optionally genetically engineered to exhibit an attenuated phenotype. In particular, the viruses of the invention exhibit an attenuated phenotype in a subject to which the virus is administered as a vaccine. Attenuation can be achieved by any method known to a skilled artisan. Without being bound by theory, the attenuated phenotype of the viruses of the invention is caused, e.g., by using a virus that naturally does not replicate well in an intended host species, for example, by reduced replication of the viral genome, by reduced ability of the virus to infect a host cell, or by reduced ability of the viral proteins to assemble to an infectious viral particle relative to the wild type species of the virus.

The attenuated phenotypes of hEbola virus or variants thereof are optionally tested by any method known to the artisan. A candidate virus, for example, is optionally tested for its ability to infect a host or for the rate of replication in a cell culture system. In certain embodiments, growth curves at different temperatures are used to test the attenuated phenotype of the virus. For example, an attenuated virus is able to grow at 35° C., but not at 39° C. or 40° C. In certain embodiments, different cell lines are used to evaluate the attenuated phenotype of the virus. For example, an attenuated virus may only be able to grow in monkey cell lines but not the human cell lines, or the achievable virus titers in different cell lines are different for the attenuated virus. In certain embodiments, viral replication in the respiratory tract of a small animal model, including but not limited to, hamsters, cotton rats, mice and guinea pigs, is used to evaluate the attenuated phenotypes of the virus. In other embodiments, the immune response induced by the virus, including but not limited to, the antibody titers (e.g., assayed by plaque reduction neutralization assay or ELISA) is used to evaluate the attenuated phenotypes of the virus. In a specific embodiment, the plaque reduction neutralization assay or ELISA is carried out at a low dose. In certain embodiments, the ability of the hEbola virus to elicit pathological symptoms in an animal model is tested. A reduced ability of the virus to elicit pathological symptoms in an animal model system is indicative of its attenuated phenotype. In a specific embodiment, the candidate viruses are tested in a monkey model for nasal infection, indicated by mucus production.

The viruses of the invention are optionally attenuated such that one or more of the functional characteristics of the virus are impaired. In certain embodiments, attenuation is measured in comparison to the wild type species of the virus from which the attenuated virus is derived. In other embodiments, attenuation is determined by comparing the growth of an attenuated virus in different host systems. Thus, for a non-limiting example, hEbola virus or a variant thereof is attenuated when grown in a human host if the growth of the hEbola or variant thereof in the human host is reduced compared to the non-attenuated hEbola or variant thereof.

In certain embodiments, the attenuated virus of the invention is capable of infecting a host, is capable of replicating in a host such that infectious viral particles are produced. In comparison to the wild type species, however, the attenuated species grows to lower titers or grows more slowly. Any technique known to the skilled artisan can be used to determine the growth curve of the attenuated virus and compare it to the growth curve of the wild type virus.

In certain embodiments, the attenuated virus of the invention (e.g., a recombinant or chimeric hEbola) cannot replicate in human cells as well as the wild type virus (e.g., wild type hEbola) does. However, the attenuated virus can replicate well in a cell line that lacks interferon functions, such as Vero cells.

In other embodiments, the attenuated virus of the invention is capable of infecting a host, of replicating in the host, and of causing proteins of the virus of the invention to be inserted into the cytoplasmic membrane, but the attenuated virus does not cause the host to produce new infectious viral particles. In certain embodiments, the attenuated virus infects the host, replicates in the host, and causes viral proteins to be inserted in the cytoplasmic membrane of the host with the same efficiency as the wild type hEbola. In other embodiments, the ability of the attenuated virus to cause viral proteins to be inserted into the cytoplasmic membrane into the host cell is reduced compared to the wild type virus. In certain embodiments, the ability of the attenuated hEbola virus to replicate in the host is reduced compared to the wild type virus. Any technique known to the skilled artisan can be used to determine whether a virus is capable of infecting a mammalian cell, of replicating within the host, and of causing viral proteins to be inserted into the cytoplasmic membrane of the host.

In certain embodiments, the attenuated virus of the invention is capable of infecting a host. In contrast to the wild type hEbola, however, the attenuated hEbola cannot be replicated in the host. In a specific embodiment, the attenuated hEbola virus can infect a host and can cause the host to insert viral proteins in its cytoplasmic membranes, but the attenuated virus is incapable of being replicated in the host. Any method known to the skilled artisan can be used to test whether the attenuated hEbola has infected the host and has caused the host to insert viral proteins in its cytoplasmic membranes.

In certain embodiments, the ability of the attenuated virus to infect a host is reduced compared to the ability of the wild type virus to infect the same host. Any technique known to the skilled artisan can be used to determine whether a virus is capable of infecting a host.

In certain embodiments, mutations (e.g., missense mutations) are introduced into the genome of the virus, for example, into the sequence of SEQ ID NOs: 1 or 10, or to generate a virus with an attenuated phenotype. Mutations (e.g., missense mutations) can be introduced into the structural genes and/or regulatory genes of the hEbola. Mutations are optionally additions, substitutions, deletions, or combinations thereof. Such variant of hEbola can be screened for a predicted functionality, such as infectivity, replication ability, protein synthesis ability, assembling ability, as well as cytopathic effect in cell cultures. In a specific embodiment, the missense mutation is a cold-sensitive mutation. In another embodiment, the missense mutation is a heat-sensitive mutation. In another embodiment, the missense mutation prevents a normal processing or cleavage of the viral proteins.

In other embodiments, deletions are introduced into the genome of the hEbola virus, which result in the attenuation of the virus.

In certain embodiments, attenuation of the virus is achieved by replacing a gene of the wild type virus with a gene of a virus of a different species, of a different subgroup, or of a different variant. In another aspect, attenuation of the virus is achieved by replacing one or more specific domains of a protein of the wild type virus with domains derived from the corresponding protein of a virus of a different species. In certain other embodiments, attenuation of the virus is achieved by deleting one or more specific domains of a protein of the wild type virus.

When a live attenuated vaccine is used, its safety should also be considered. The vaccine preferably does not cause disease. Any techniques known in the art for improving vaccine safety are operable in the present invention. In addition to attenuation techniques, other techniques are optionally be used. One non-limiting example is to use a soluble heterologous gene that cannot be incorporated into the virion membrane. For example, a single copy of the soluble version of a viral transmembrane protein lacking the transmembrane and cytosolic domains thereof is used.

Various assays are optionally used to test the safety of a vaccine. For example, sucrose gradients and neutralization assays are used to test the safety. A sucrose gradient assay is optionally used to determine whether a heterologous protein is inserted in a virion. If the heterologous protein is inserted in the virion, the virion is preferably tested for its ability to cause symptoms in an appropriate animal model since the virus may have acquired new, possibly pathological, properties.

5.4 Adjuvants and Carrier Molecules

hEbola-associated antigens are administered with one or more adjuvants. In one embodiment, the hEbola-associated antigen is administered together with a mineral salt adjuvants or mineral salt gel adjuvant. Such mineral salt and mineral salt gel adjuvants include, but are not limited to, aluminum hydroxide (ALHYDROGEL, REHYDRAGEL), aluminum phosphate gel, aluminum hydroxyphosphate (ADJU-PHOS), and calcium phosphate.

In another embodiment, hEbola-associated antigen is administered with an immunostimulatory adjuvant. Such class of adjuvants include, but are not limited to, cytokines (e.g., interleukin-2, interleukin-7, interleukin-12, granulocyte-macrophage colony stimulating factor (GM-CSF), interferon-γ interleukin-1β (IL-1β), and IL-1β peptide or Sclavo Peptide), cytokine-containing liposomes, triterpenoid glycosides or saponins (e.g., QuilA and QS-21, also sold under the trademark STIMULON, ISCOPREP), Muramyl Dipeptide (MDP) derivatives, such as N-acetyl-muramyl-L-threonyl-D-isoglutamine (Threonyl-MDP, sold under the trademark TERMURTIDE), GMDP, N-acetyl-nor-muramyl-L-alanyl-D-isoglutamine, N-acetylmuramyl-L-alanyl-D-isoglutaminyl-L-alanine-2-(1′-2′-dipalmitoyl-s-n-glycero-3-hydroxy phosphoryloxy)-ethylamine, muramyl tripeptide phosphatidylethanolamine (MTP-PE), unmethylated CpG dinucleotides and oligonucleotides, such as bacterial DNA and fragments thereof, LPS, monophosphoryl Lipid A (3D-MLA sold under the trademark MPL), and polyphosphazenes.

In another embodiment, the adjuvant used is a particular adjuvant, including, but not limited to, emulsions, e.g., Freund’s Complete Adjuvant, Freund’s Incomplete Adjuvant, squalene or squalane oil-in-water adjuvant formulations, such as SAF and MF59, e.g., prepared with block-copolymers, such as L-121 (polyoxypropylene/polyoxyetheylene) sold under the trademark PLURONIC L-121, Liposomes, Virosomes, cochleates, and immune stimulating complex, which is sold under the trademark ISCOM.

In another embodiment, a microparticular adjuvant is used. Microparticular adjuvants include, but are not limited to, biodegradable and biocompatible polyesters, homo- and copolymers of lactic acid (PLA) and glycolic acid (PGA), poly(lactide-co-glycolides) (PLGA) microparticles, polymers that self-associate into particulates (poloxamer particles), soluble polymers (polyphosphazenes), and virus-like particles (VLPs) such as recombinant protein particulates, e.g., hepatitis B surface antigen (HbsAg).

Yet another class of adjuvants that are optionally used include mucosal adjuvants, including but not limited to heat-labile enterotoxin from Escherichia coli (LT), cholera holotoxin (CT) and cholera Toxin B Subunit (CTB) from Vibrio cholerae, mutant toxins (e.g., LTK63 and LTR72), microparticles, and polymerized liposomes.

In other embodiments, any of the above classes of adjuvants are optionally used in combination with each other or with other adjuvants. For example, non-limiting examples of combination adjuvant preparations used to administer the hEbola-associated antigens of the invention include liposomes containing immunostimulatory protein, cytokines, T-cell and/or B-cell peptides, or microbes with or without entrapped IL-2 or microparticles containing enterotoxin. Other adjuvants known in the art are also included within the scope of the invention (see Vaccine Design: The Subunit and Adjuvant Approach, Chap. 7, Michael F. Powell and Mark J. Newman (eds.), Plenum Press, New York, 1995, which is incorporated herein in its entirety).

The effectiveness of an adjuvant is illustratively determined by measuring the induction of antibodies directed against an immunogenic polypeptide containing a hEbola polypeptide epitope, the antibodies resulting from administration of this polypeptide in vaccines which are also comprised of the various adjuvants.

The polypeptides are optionally formulated into the vaccine as neutral or salt forms. Pharmaceutically acceptable salts include the acid additional salts (formed with free amino groups of the peptide) and which are formed with inorganic acids, such as, for example, hydrochloric or phosphoric acids, or organic acids such as acetic, oxalic, tartaric, maleic, and the like. Salts formed with free carboxyl groups are optionally derived from inorganic bases, such as, for example, sodium potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, 2-ethylamino ethanol, histidine, procaine and the like.

The vaccines of the invention are preferably multivalent or univalent. Multivalent vaccines are made from recombinant viruses that direct the expression of more than one antigen.

Many methods are operable herein to introduce the vaccine formulations of the invention; these include but are not limited to oral, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal routes, and via scarification (scratching through the top layers of skin, e.g., using a bifurcated needle).

The patient to which the vaccine is administered is preferably a mammal, most preferably a human, but is also optionally a non-human animal including but not limited to lower primates, cows, horses, sheep, pigs, fowl (e.g., chickens), goats, cats, dogs, hamsters, mice and rats.

Preparation of Antibodies

Antibodies that specifically recognize a polypeptide of the invention, such as, but not limited to, polypeptides including the sequence of SEQ ID NOs: 2-9, 59, or 11-19 and other polypeptides as described herein, or hEbola epitope or antigen-binding fragments thereof are used in a preferred embodiment for detecting, screening, and isolating the polypeptide of the invention or fragments thereof, or similar sequences that might encode similar enzymes from the other organisms. For example, in one specific embodiment, an antibody which immunospecifically binds hEbola epitope, or a fragment thereof, is used for various in vitro detection assays, including enzyme-linked immunosorbent assays (ELISA), radioimmunoassays, western blot, etc., for the detection of a polypeptide of the invention or, preferably, hEbola, in samples, for example, a biological material, including cells, cell culture media (e.g., bacterial cell culture media, mammalian cell culture media, insect cell culture media, yeast cell culture media, etc.), blood, plasma, serum, tissues, sputum, naseopharyngeal aspirates, etc.

Antibodies specific for a polypeptide of the invention or any epitope of hEbola are optionally generated by any suitable method known in the art. Polyclonal antibodies to an antigen of interest, for example, the hEbola virus from Deposit Accession No. 200706291, or including a nucleotide sequence of SEQ ID NOs: 1 or 10, are optionally produced by various procedures well known in the art. For example, an antigen is optionally administered to various host animals including, but not limited to, rabbits, mice, rats, etc., to induce the production of antisera containing polyclonal antibodies specific for the antigen. Various adjuvants are optionally used to increase the immunological response, depending on the host species, and include but are not limited to, Freund’s (complete and incomplete) adjuvant, mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanins, dinitrophenol, and potentially useful adjuvants for humans such as BCG (Bacille Calmette-Guerin) and Corynebacterium parvum. Such adjuvants are also well known in the art.

Monoclonal antibodies are optionally prepared using a wide variety of techniques known in the art including the use of hybridoma, recombinant, and phage display technologies, or a combination thereof. In one example, monoclonal antibodies are produced using hybridoma techniques including those known in the art and taught, for example, in Harlow et al., Antibodies: A Laboratory Manual (Cold Spring Harbor Laboratory Press, 2nd ed. 1988); Hammerling, et al., in: Monoclonal Antibodies and T-Cell Hybridomas, pp. 563-681 (Elsevier, N.Y., 1981) (both of which are incorporated by reference in their entireties). The term “monoclonal antibody” as used herein is not limited to antibodies produced through hybridoma technology. The term “monoclonal antibody” refers to an antibody that is derived from a single clone, including any eukaryotic, prokaryotic, or phage clone, and not the method by which it is produced.

Methods for producing and screening for specific antibodies using hybridoma technology are routine and well known in the art. In a non-limiting example, mice are immunized with an antigen of interest or a cell expressing such an antigen. Once an immune response is detected, e.g., antibodies specific for the antigen are detected in the mouse serum, the mouse spleen is harvested and splenocytes isolated. The splenocytes are then fused by well known techniques to any suitable myeloma cells. Hybridomas are selected and cloned by limiting dilution. The hybridoma clones are then assayed by methods known in the art for cells that secrete antibodies capable of binding the antigen. Ascites fluid, which generally contains high levels of antibodies, is optionally generated by inoculating mice intraperitoneally with positive hybridoma clones.

Antibody fragments which recognize specific epitopes are optionally generated by known techniques. For example, Fab and F(ab′)2 fragments are illustratively produced by proteolytic cleavage of immunoglobulin molecules, using enzymes such as papain (to produce Fab fragments) or pepsin (to produce F(ab′)2 fragments). F(ab′)2 fragments preferably contain the complete light chain, and the variable region, the CH1 region and the hinge region of the heavy chain.

The antibodies of the invention or fragments thereof are optionally produced by any method known in the art for the synthesis of antibodies, in particular, by chemical synthesis or preferably, by recombinant expression techniques.

The nucleotide sequence encoding an antibody is obtained from any information available to those skilled in the art (i.e., from Genbank, the literature, or by routine cloning and sequence analysis). If a clone containing a nucleic acid encoding a particular antibody or an epitope-binding fragment thereof is not available, but the sequence of the antibody molecule or epitope-binding fragment thereof is known, a nucleic acid encoding the immunoglobulin may be chemically synthesized or obtained from a suitable source (e.g., an antibody cDNA library, or a cDNA library generated from, or nucleic acid, preferably poly A+RNA, isolated from any tissue or cells expressing the antibody, such as hybridoma cells selected to express an antibody) by PCR amplification using synthetic primers hybridizable to the 3′ and 5′ ends of the sequence or by cloning using an oligonucleotide probe specific for the particular gene sequence to identify, e.g., a cDNA clone from a cDNA library that encodes the antibody. Amplified nucleic acids generated by PCR are optionally then cloned into replicable cloning vectors using any method known in the art.

Once the nucleotide sequence of the antibody is determined, the nucleotide sequence of the antibody is optionally manipulated using methods well known in the art for the manipulation of nucleotide sequences, e.g., recombinant DNA techniques, site directed mutagenesis, PCR, etc. (see, for example, the techniques described in Sambrook et al., supra; and Ausubel et al., eds., 1998, Current Protocols in Molecular Biology, John Wiley & Sons, NY, which are both incorporated by reference herein in their entireties), to generate antibodies having a different amino acid sequence by, for example, introducing amino acid substitutions, deletions, and/or insertions into the epitope-binding domain regions of the antibodies or any portion of antibodies which may enhance or reduce biological activities of the antibodies.

Recombinant expression of an antibody requires construction of an expression vector containing a nucleotide sequence that encodes the antibody. Once a nucleotide sequence encoding an antibody molecule or a heavy or light chain of an antibody, or portion thereof has been obtained, the vector for the production of the antibody molecule is optionally produced by recombinant DNA technology using techniques known in the art as discussed in the previous sections. Methods which are known to those skilled in the art are optionally used to construct expression vectors containing antibody coding sequences and appropriate transcriptional and translational control signals. These methods include, for example, in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. The nucleotide sequence encoding the heavy-chain variable region, light-chain variable region, both the heavy-chain and light-chain variable regions, an epitope-binding fragment of the heavy- and/or light-chain variable region, or one or more complementarity determining regions (CDRs) of an antibody are optionally cloned into such a vector for expression. Thus, prepared expression vector is optionally then introduced into appropriate host cells for the expression of the antibody. Accordingly, the invention includes host cells containing a polynucleotide encoding an antibody specific for the polypeptides of the invention or fragments thereof.

The host cell is optionally co-transfected with two expression vectors of the invention, the first vector encoding a heavy chain derived polypeptide and the second vector encoding a light chain derived polypeptide. The two vectors illustratively contain identical selectable markers which enable equal expression of heavy and light chain polypeptides or different selectable markers to ensure maintenance of both plasmids. Alternatively, a single vector is optionally used which encodes, and is capable of expressing, both heavy and light chain polypeptides. In such situations, the light chain should be placed before the heavy chain to avoid an excess of toxic free heavy chain (Proudfoot, Nature, 322:52, 1986; and Kohler, Proc. Natl. Acad. Sci. USA, 77:2 197, 1980). The coding sequences for the heavy and light chains optionally include cDNA or genomic DNA.

In another embodiment, antibodies are generated using various phage display methods known in the art. In phage display methods, functional antibody domains are displayed on the surface of phage particles which carry the polynucleotide sequences encoding them. In a particular embodiment, such phage is utilized to display antigen binding domains, such as Fab and Fv or disulfide-bond stabilized Fv, expressed from a repertoire or combinatorial antibody library (e.g., human or murine). Phage expressing an antigen binding domain that binds the antigen of interest is optionally selected or identified with antigen, e.g., using labeled antigen or antigen bound or captured to a solid surface or bead. Phages used in these methods are typically filamentous phage, including fd and M13. The antigen binding domains are expressed as a recombinantly fused protein to either the phage gene III or gene VIII protein. Examples of phage display methods that can be used to make the immunoglobulins, or fragments thereof, of the present invention include those disclosed in Brinkman et al., J. Immunol. Methods, 182:41-50, 1995; Ames et al., J. Immunol. Methods, 184:177-186, 1995; Kettleborough et al., Eur. J. Immunol., 24:952-958, 1994; Persic et al., Gene, 187:9-18, 1997; Burton et al., Advances in Immunology, 57:191-280, 1994; PCT application No. PCT/GB91/01134; PCT publications WO 90/02809; WO 91/10737; WO 92/01047; WO 92/18619; WO 93/11236; WO 95/15982; WO 95/20401; and U.S. Pat. Nos. 5,698,426; 5,223,409; 5,403,484; 5,580,717; 5,427,908; 5,750,753; 5,821,047; 5,571,698; 5,427,908; 5,516,637; 5,780,225; 5,658,727; 5,733,743 and 5,969,108; each of which is incorporated herein by reference in its entirety.

As described in the above references, after phage selection, the antibody coding regions from the phage is optionally isolated and used to generate whole antibodies, including human antibodies, or any other desired fragments, and expressed in any desired host, including mammalian cells, insect cells, plant cells, yeast, and bacteria, e.g., as described in detail below. For example, techniques to recombinantly produce Fab, Fab′ and F(ab′)2 fragments are optionally employed using methods known in the art such as those disclosed in PCT publication WO 92/22324; Mullinax et al., BioTechniques, 12(6):864-869, 1992; and Sawai et al., AJR1, 34:26-34, 1995; and Better et al., Science, 240:1041-1043, 1988 (each of which is incorporated by reference in its entirety). Examples of techniques operable to produce single-chain Fvs and antibodies include those described in U.S. Pat. Nos. 4,946,778 and 5,258,498; Huston et al., Methods in Enzymology, 203:46-88, 1991; Shu et al., PNAS, 90:7995-7999, 1993; and Skerra et al., Science, 240:1038-1040, 1988.

Once an antibody molecule of the invention has been produced by any methods described above, or otherwise known in the art, it is then optionally purified by any method known in the art for purification of an immunoglobulin molecule, for example, by chromatography (e.g., ion exchange, affinity, particularly by affinity for the specific antigen after Protein A or Protein G purification, and sizing column chromatography), centrifugation, differential solubility, or by any other standard technique(s) for the purification of proteins. Further, the antibodies of the present invention or fragments thereof are optionally fused to heterologous polypeptide sequences described herein or otherwise known in the art to facilitate purification. Illustrative examples include 6×His tag, FLAG tag, biotin, avidin, or other system.

For some uses, including in vivo use of antibodies in humans and in vitro detection assays, it is preferable to use chimeric, humanized, or human antibodies. A chimeric antibody is a molecule in which different portions of the antibody are derived from different animal species, such as antibodies having a variable region derived from a murine monoclonal antibody and a constant region derived from a human immunoglobulin. Methods for producing chimeric antibodies are known in the art. See e.g., Morrison, Science, 229:1202, 1985; Oi et al., BioTechniques, 4:214 1986; Gillies et al., J. Immunol. Methods, 125:191-202, 1989; U.S. Pat. Nos. 5,807,715; 4,816,567; and 4,816,397, which are incorporated herein by reference in their entireties. Humanized antibodies are antibody molecules from non-human species that bind the desired antigen having one or more complementarity determining regions (CDRs) from the non-human species and framework regions from a human immunoglobulin molecule. Often, framework residues in the human framework regions will be substituted with the corresponding residue from the CDR donor antibody to alter, preferably improve, antigen binding. These framework substitutions are identified by methods well known in the art, e.g., by modeling of the interactions of the CDR and framework residues to identify framework residues important for antigen binding and sequence comparison to identify unusual framework residues at particular positions. See, e.g., Queen et al., U.S. Pat. No. 5,585,089; Riechmann et al., Nature, 332:323, 1988, which are incorporated herein by reference in their entireties. Antibodies are humanized using a variety of techniques known in the art including, for example, CDR-grafting (EP 239,400; PCT publication WO 91/09967; U.S. Pat. Nos. 5,225,539; 5,530,101 and 5,585,089), veneering or resurfacing (EP 592,106; EP 519,596; Padlan, Molecular Immunology, 28(4/5):489-498, 1991; Studnicka et al., Protein Engineering, 7(6):805-814, 1994; Roguska et al., Proc Natl. Acad. Sci. USA, 91:969-973, 1994), and chain shuffling (U.S. Pat. No. 5,565,332), all of which are hereby incorporated by reference in their entireties.

Completely human antibodies are particularly desirable for therapeutic treatment of human patients. Human antibodies are made by a variety of methods known in the art illustratively including phage display methods described above using antibody libraries derived from human immunoglobulin sequences. See U.S. Pat. Nos. 4,444,887 and 4,716,111; and PCT publications WO 98/46645; WO 98/50433; WO 98/24893; WO 98/16654; WO 96/34096; WO 96/33735; and WO 91/10741, each of which is incorporated herein by reference in its entirety.

Human antibodies are also illustratively produced using transgenic mice which are incapable of expressing functional endogenous immunoglobulins, but which can express human immunoglobulin genes. For an overview of this technology for producing human antibodies, see Lonberg and Huszar, Int. Rev. Immunol., 13:65-93, 1995. For a detailed discussion of this technology for producing human antibodies and human monoclonal antibodies and protocols for producing such antibodies, see, e.g., PCT publications WO 98/24893; WO 92/01047; WO 96/34096; WO 96/33735; European Patent No. 0 598 877; U.S. Pat. Nos. 5,413,923; 5,625,126; 5,633,425; 5,569,825; 5,661,016; 5,545,806; 5,814,318; 5,885,793; 5,916,771; and 5,939,598, which are incorporated by reference herein in their entireties. In addition, companies such as Abgenix, Inc. (Fremont, Calif.), Medarex (NJ) and Genpharm (San Jose, Calif.) can be engaged to provide human antibodies directed against a selected antigen using technology similar to that described above.

Completely human antibodies which recognize a selected epitope are optionally generated using a technique referred to as “guided selection.” In this approach a selected non-human monoclonal antibody, e.g., a mouse antibody, is used to guide the selection of a completely human antibody recognizing the same epitope. (Jespers et al., Bio/technology, 12:899-903, 1988).

Antibodies fused or conjugated to heterologous polypeptides are optionally used in in vitro immunoassays and in purification methods (e.g., affinity chromatography) known in the art. See e.g., PCT publication No. WO 93/21232; EP 439,095; Naramura et al., Immunol. Lett., 39:91-99, 1994; U.S. Pat. No. 5,474,981; Gillies et al., PNAS, 89:1428-1432, 1992; and Fell et al., J. Immunol., 146:2446-2452, 1991, which are incorporated herein by reference in their entireties.

Antibodies may also be illustratively attached to solid supports, which are particularly useful for immunoassays or purification of the polypeptides of the invention or fragments, derivatives, analogs, or variants thereof, or similar molecules having the similar enzymatic activities as the polypeptide of the invention. Such solid supports include, but are not limited to, glass, cellulose, polyacrylamide, nylon, polystyrene, polyvinyl chloride or polypropylene.

Pharmaceutical Compositions and Kits

The present invention encompasses pharmaceutical compositions including antiviral agents of the present invention. In a specific embodiment, the antiviral agent is preferably an antibody which immunospecifically binds and neutralizes the hEbola virus or variants thereof, or any proteins derived therefrom. In another specific embodiment, the antiviral agent is a polypeptide or nucleic acid molecule of the invention. The pharmaceutical compositions have utility as an antiviral prophylactic agent are illustratively administered to a subject where the subject has been exposed or is expected to be exposed to a virus.

Various delivery systems are known and operable to administer the pharmaceutical composition of the invention, illustratively, encapsulation in liposomes, microparticles, microcapsules, recombinant cells capable of expressing the mutant viruses, and receptor mediated endocytosis (see, e.g., Wu and Wu, 1987, J. Biol. Chem. 262:4429 4432). Methods of introduction include but are not limited to intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, and oral routes. The compounds may be administered by any convenient route, for example by infusion or bolus injection, by absorption through epithelial or mucocutaneous linings (e.g., oral mucosa, rectal and intestinal mucosa, etc.) and optionally administered together with other biologically active agents. Administration is systemic or local. In a preferred embodiment, it is desirable to introduce the pharmaceutical compositions of the invention into the lungs by any suitable route. Pulmonary administration can also be employed, e.g., by use of an inhaler or nebulizer, and formulation with an aerosolizing agent.

In a specific embodiment, it is desirable to administer the pharmaceutical compositions of the invention locally to the area in need of treatment. This administration may be achieved by, for example, and not by way of limitation, local infusion during surgery, topical application, e.g., in conjunction with a wound dressing after surgery, by injection, by means of a catheter, by means of a suppository, by means of nasal spray, or by means of an implant, the implant being of a porous, non-porous, or gelatinous material, including membranes, such as sialastic membranes, or fibers. In one embodiment, administration can be by direct injection at the site (or former site) infected tissues.

In another embodiment, the pharmaceutical composition is delivered in a vesicle, in particular a liposome (see Langer, 1990, Science 249:1527-1533; Treat et al., in Liposomes in the Therapy of Infectious Disease and Cancer, Lopez Berestein and Fidler (eds.), Liss, New York, pp. 353-365 (1989); Lopez-Berestein, ibid., pp. 317-327; see generally ibid.).

In yet another embodiment, the pharmaceutical composition is delivered in a controlled release system. In one embodiment, a pump is used (see Langer, supra; Sefton, 1987, CRC Crit. Ref. Biomed. Eng. 14:201; Buchwald et al., 1980, Surgery 88:507; and Saudek et al., 1989, N. Engl. J. Med. 321:574). In another embodiment, polymeric materials are used (see Medical Applications of Controlled Release, Langer and Wise (eds.), CRC Pres., Boca Raton, Fla. (1974); Controlled Drug Bioavailability, Drug Product Design and Performance, Smolen and Ball (eds.), Wiley, New York (1984); Ranger and Peppas, J. Macromol. Sci. Rev. Macromol. Chem. 23:61 (1983); see also Levy et al., 1985, Science 228:190; During et al., 1989, Ann. Neurol. 25:351; Howard et al., 1989, J. Neurosurg. 71:105). In yet another embodiment, a controlled release system is placed in proximity of the composition’s target, i.e., the lung, thus, requiring only a fraction of the systemic dose (see, e.g., Goodson, in Medical Applications of Controlled Release, supra, vol. 2, pp. 115-138 (1984)).

Other controlled release systems are discussed in the review by Langer (Science 249:1527-1533 (1990)) the contents of which are incorporated herein by reference.

The pharmaceutical compositions of the present invention illustratively include a therapeutically effective amount of a live attenuated, inactivated or killed West African hEbola virus, or recombinant or chimeric hEbola virus, and a pharmaceutically acceptable carrier. In a specific embodiment, the term “pharmaceutically acceptable” means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans. The term “carrier” refers to a diluent, adjuvant, excipient, or vehicle with which the pharmaceutical composition is administered. Such pharmaceutical carriers are illustratively sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a preferred carrier when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions are optionally employed as liquid carriers, particularly for injectable solutions. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like. The composition, if desired, also contains wetting or emulsifying agents, or pH buffering agents. These compositions optionally take the form of solutions, suspensions, emulsion, tablets, pills, capsules, powders, sustained release formulations and the like. The composition is optionally formulated as a suppository, with traditional binders and carriers such as triglycerides. Oral formulation illustratively includes standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, etc. Examples of suitable pharmaceutical carriers are described in “Remington’s Pharmaceutical Sciences” by E. W. Martin. The formulation should suit the mode of administration.

In a preferred embodiment, the composition is formulated in accordance with routine procedures as a pharmaceutical composition adapted for intravenous administration to human beings. Typically, compositions for intravenous administration are solutions in sterile isotonic aqueous buffer. The composition also includes an optional solubilizing agent and a local anesthetic such as lignocaine to ease pain at the site of the injection. Generally, the ingredients are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water-free concentrate in a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent. Where the composition is to be administered by infusion, it can be dispensed with an infusion bottle containing sterile pharmaceutical grade water or saline. Where the composition is administered by injection, an ampoule of sterile water for injection or saline is optionally provided so that the ingredients may be mixed prior to administration.

The pharmaceutical compositions of the invention are illustratively formulated as neutral or salt forms. Pharmaceutically acceptable salts illustratively include those formed with free amino groups such as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc., and those formed with free carboxyl groups such as those derived from sodium, potassium, ammonium, calcium, ferric hydroxides, isopropylamine, triethylamine, 2 ethylamino ethanol, histidine, procaine, etc.

The amount of the pharmaceutical composition of the invention which will be effective in the treatment of a particular disorder or condition will depend on the nature of the disorder or condition, and can be determined by standard clinical techniques. In addition, in vitro assays are optionally employed to help identify optimal dosage ranges. The precise dose to be employed in the formulation will also depend on the route of administration, and the seriousness of the disease or disorder, and should be decided according to the judgment of the practitioner and each patient’s circumstances. However, suitable dosage ranges for intravenous administration are generally about 20 to 500 micrograms of active compound per kilogram body weight. Suitable dosage ranges for intranasal administration are generally about 0.01 pg/kg body weight to 1 mg/kg body weight. Effective doses may be extrapolated from dose response curves derived from in vitro or animal model test systems.

Suppositories generally contain active ingredient in the range of 0.5% to 10% by weight; oral formulations preferably contain 10% to 95% active ingredient.

The invention also provides a pharmaceutical pack or kit including one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention. Optionally associated with such container(s) is a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration. In a preferred embodiment, the kit contains an antiviral agent of the invention, e.g., an antibody specific for the polypeptides encoded by a nucleotide sequence of SEQ ID NOs: 1 or 10, or as shown in SEQ ID NOs: 2-9, 59, or 11-19, or any hEbola epitope, or a polypeptide or protein of the present invention, or a nucleic acid molecule of the invention, alone or in combination with adjuvants, antivirals, antibiotics, analgesic, bronchodilators, or other pharmaceutically acceptable excipients.

The present invention further encompasses kits including a container containing a pharmaceutical composition of the present invention and instructions for use.

Detection Assays

The present invention provides a method for detecting an antibody, which immunospecifically binds to the hEbola virus, in a biological sample, including for example blood, serum, plasma, saliva, urine, feces, etc., from a patient suffering from hEbola infection, and/or hemorrhagic fever. In a specific embodiment, the method including contacting the sample with the hEbola virus, for example, of Deposit Accession No. 200706291, or having a genomic nucleic acid sequence of SEQ ID NOs: 1 or 10, directly immobilized on a substrate and detecting the virus-bound antibody directly or indirectly by a labeled heterologous anti-isotype antibody. In another specific embodiment, the sample is contacted with a host cell which is infected by the hEbola virus, for example, of Deposit Accession No. 200706291, or having a genomic nucleic acid sequence of SEQ ID NOs: 1 or 10, and the bound antibody is optionally detected by immunofluorescent assay.

An exemplary method for detecting the presence or absence of a polypeptide or nucleic acid of the invention in a biological sample involves obtaining a biological sample from various sources and contacting the sample with a compound or an agent capable of detecting an epitope or nucleic acid (e.g., mRNA, genomic DNA) of the hEbola virus such that the presence of the hEbola virus is detected in the sample. A preferred agent for detecting hEbola mRNA or genomic RNA of the invention is a labeled nucleic acid probe capable of hybridizing to mRNA or genomic RNA encoding a polypeptide of the invention. The nucleic acid probe is, for example, a nucleic acid molecule including the nucleotide sequence of SEQ ID NOs: 1 or 10, a complement thereof, or a portion thereof, such as an oligonucleotide of at least 15, 20, 25, 30, 50, 100, 250, 500, 750, 1000 or more contiguous nucleotides in length and sufficient to specifically hybridize under stringent conditions to a hEbola mRNA or genomic RNA.

As used herein, the term “stringent conditions” describes conditions for hybridization and washing under which nucleotide sequences having at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% identity to each other typically remain hybridized to each other. Such hybridization conditions are described in, for example but not limited to, Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1 6.3.6; Basic Methods in Molecular Biology, Elsevier Science Publishing Co., Inc., N.Y. (1986), pp. 75 78, and 84 87; and Molecular Cloning, Cold Spring Harbor Laboratory, N.Y. (1982), pp. 387 389, and are well known to those skilled in the art. A preferred, non-limiting example of stringent hybridization conditions is hybridization in 6× sodium chloride/sodium citrate (SSC), 0.5% SDS at about 68° C. followed by one or more washes in 2×SSC, 0.5% SDS at room temperature. Another preferred, non-limiting example of stringent hybridization conditions is hybridization in 6×SSC at about 45° C. followed by one or more washes in 0.2×SSC, 0.1% SDS at 50 to 65° C.

A nucleic acid probe, polynucleotide, oligonucleotide, or other nucleic acid is preferably purified. An “isolated” or “purified” nucleotide sequence is substantially free of cellular material or other contaminating proteins from the cell or tissue source from which the nucleotide is derived, or is substantially free of chemical precursors or other chemicals when chemically synthesized. The language “substantially free of cellular material” includes preparations of a nucleotide/oligonucleotide in which the nucleotide/oligonucleotide is separated from cellular components of the cells from which it is isolated or produced. Thus, a nucleotide/oligonucleotide that is substantially free of cellular material includes preparations of the nucleotide having less than about 30%, 20%, 10%, 5%, 2.5%, or 1%, (by dry weight) of contaminating material. When nucleotide/oligonucleotide is produced by chemical synthesis, it is preferably substantially free of chemical precursors or other chemicals, i.e., it is separated from chemical precursors or other chemicals which are involved in the synthesis of the protein. Accordingly, such preparations of the nucleotide/oligonucleotide have less than about 30%, 20%, 10%, or 5% (by dry weight) of chemical precursors or compounds other than the nucleotide/oligonucleotide of interest. In a preferred embodiment of the present invention, the nucleotide/oligonucleotide is isolated or purified.

In another preferred specific embodiment, the presence of hEbola virus is detected in the sample by a reverse transcription polymerase chain reaction (RT-PCR) using the primers that are constructed based on a partial nucleotide sequence of the genome of hEbola virus, for example, that of Deposit Accession No. 200706291, or having a genomic nucleic acid sequence of SEQ ID NOs: 1 or 10. In a non-limiting specific embodiment, preferred primers to be used in a RT-PCR method are the primers are described in detail herein.

In more preferred specific embodiment, the present invention provides a real-time quantitative PCR assay to detect the presence of hEbola virus in a biological sample by subjecting the cDNA obtained by reverse transcription of the extracted total RNA from the sample to PCR reactions using the specific primers described in detail herein, and a fluorescence dye, such as SYBR® Green I, which fluoresces when bound nonspecifically to double-stranded DNA. The fluorescence signals from these reactions are captured at the end of extension steps as PCR product is generated over a range of the thermal cycles, thereby allowing the quantitative determination of the viral load in the sample based on an amplification plot.

A preferred agent for detecting hEbola is an antibody that specifically binds a polypeptide of the invention or any hEbola epitope, preferably an antibody with a detectable label. Antibodies are illustratively polyclonal, or more preferably, monoclonal. An intact antibody, or a fragment thereof (e.g., Fab or F(ab′)2) is operable herein.

The term “labeled”, with regard to the probe or antibody, is intended to encompass direct labeling of the probe or antibody by coupling (i.e., physically linking) a detectable substance to the probe or antibody, optionally via a linker, as well as indirect labeling of the probe or antibody by reactivity with another reagent that is directly labeled. Examples of indirect labeling include detection of a primary antibody using a fluorescently labeled secondary antibody and end-labeling of a DNA probe with biotin such that it is detectable with fluorescently labeled streptavidin. The detection method of the invention is optionally used to detect mRNA, protein (or any epitope), or genomic RNA in a sample in vitro as well as in vivo. Exemplary in vitro techniques for detection of mRNA include northern hybridizations, in situ hybridizations, RT-PCR, and RNase protection. In vitro techniques for detection of an epitope of hEbola illustratively include enzyme linked immunosorbent assays (ELISAs), western blots, immunoprecipitations and immunofluorescence. In vitro techniques for detection of genomic RNA include northern hybridizations, RT-PCT, and RNase protection. Furthermore, in vivo techniques for detection of hEbola include introducing into a subject organism a labeled antibody directed against the polypeptide. In one embodiment, the antibody is labeled with a radioactive marker whose presence and location in the subject organism is detected by standard imaging techniques, including autoradiography.

In a specific embodiment, the methods further involve obtaining a control sample from a control subject, contacting the control sample with a compound or agent capable of detecting hEbola, e.g., a polypeptide of the invention or mRNA or genomic RNA encoding a polypeptide of the invention, such that the presence of hEbola or the polypeptide or mRNA or genomic RNA encoding the polypeptide is detected in the sample, and comparing the absence of hEbola or the polypeptide or mRNA or genomic RNA encoding the polypeptide in the control sample with the presence of hEbola, or the polypeptide or mRNA or genomic DNA encoding the polypeptide in the test sample.

The invention also encompasses kits for detecting the presence of hEbola or a polypeptide or nucleic acid of the invention in a test sample. The kit illustratively includes a labeled compound or agent capable of detecting hEbola or the polypeptide or a nucleic acid molecule encoding the polypeptide in a test sample and, in certain embodiments, a means for determining the amount of the polypeptide or mRNA in the sample (e.g., an antibody which binds the polypeptide or an oligonucleotide probe which binds to DNA or mRNA encoding the polypeptide). Kits optionally include instructions for use.

For antibody-based kits, the kit illustratively includes: (1) a first antibody (e.g., attached to a solid support) which binds to a polypeptide of the invention or hEbola epitope; and, optionally, (2) a second, different antibody which binds to either the polypeptide or the first antibody and is preferably conjugated to a detectable agent.

For oligonucleotide-based kits, the kit illustratively includes: (1) an oligonucleotide, e.g., a detectably labeled oligonucleotide, which hybridizes to a nucleic acid sequence encoding a polypeptide of the invention or to a sequence within the hEbola genome; or (2) a pair of primers useful for amplifying a nucleic acid molecule containing an hEbola sequence. The kit optionally includes a buffering agent, a preservative, or a protein stabilizing agent. The kit optionally includes components necessary for detecting the detectable agent (e.g., an enzyme or a substrate). The kit optionally contains a control sample or a series of control samples which can be assayed and compared to the test sample contained. Each component of the kit is usually enclosed within an individual container and all of the various containers are within a single package along with instructions for use.

Screening Assays to Identify Antiviral Agents

The invention provides methods for the identification of a compound that inhibits the ability of hEbola virus to infect a host or a host cell. In certain embodiments, the invention provides methods for the identification of a compound that reduces the ability of hEbola virus to replicate in a host or a host cell. Any technique well known to the skilled artisan is illustratively used to screen for a compound useful to abolish or reduce the ability of hEbola virus to infect a host and/or to replicate in a host or a host cell.

In certain embodiments, the invention provides methods for the identification of a compound that inhibits the ability of hEbola virus to replicate in a mammal or a mammalian cell. More specifically, the invention provides methods for the identification of a compound that inhibits the ability of hEbola virus to infect a mammal or a mammalian cell. In certain embodiments, the invention provides methods for the identification of a compound that inhibits the ability of hEbola virus to replicate in a mammalian cell. In a specific embodiment, the mammalian cell is a human cell.

In another embodiment, a cell is contacted with a test compound and infected with the hEbola virus. In certain embodiments, a control culture is infected with the hEbola virus in the absence of a test compound. The cell is optionally contacted with a test compound before, concurrently with, or subsequent to the infection with the hEbola virus. In a specific embodiment, the cell is a mammalian cell. In an even more specific embodiment, the cell is a human cell. In certain embodiments, the cell is incubated with the test compound for at least 1 minute, at least 5 minutes, at least 15 minutes, at least 30 minutes, at least 1 hour, at least 2 hours, at least 5 hours, at least 12 hours, or at least 1 day. The titer of the virus is optionally measured at any time during the assay. In certain embodiments, a time course of viral growth in the culture is determined. If the viral growth is inhibited or reduced in the presence of the test compound, the test compound is identified as being effective in inhibiting or reducing the growth or infection of the hEbola virus. In a specific embodiment, the compound that inhibits or reduces the growth of the hEbola virus is tested for its ability to inhibit or reduce the growth rate of other viruses to test its specificity for the hEbola virus.

In one embodiment, a test compound is administered to a model animal and the model animal is infected with the hEbola virus. In certain embodiments, a control model animal is infected with the hEbola virus without the administration of a test compound. The test compound is optionally administered before, concurrently with, or subsequent to the infection with the hEbola virus. In a specific embodiment, the model animal is a mammal. In an even more specific embodiment, the model animal is, but is not limited to, a cotton rat, a mouse, or a monkey. The titer of the virus in the model animal is optionally measured at any time during the assay. In certain embodiments, a time course of viral growth in the culture is determined. If the viral growth is inhibited or reduced in the presence of the test compound, the test compound is identified as being effective in inhibiting or reducing the growth or infection of the hEbola virus. In a specific embodiment, the compound that inhibits or reduces the growth of the hEbola in the model animal is tested for its ability to inhibit or reduce the growth rate of other viruses to test its specificity for the hEbola virus.

According to the method of the invention, a human or an animal is optionally treated for for EboBun or EboIC, other viral infection or bacterial infection by administering an effective amount of an inventive therapeutic composition. Preferably, a vaccine is administered prophylactically. An “effective amount” is an amount that will induce an immune response in a subject. Illustratively, an effective amount of the compositions of this invention ranges from nanogram/kg to milligram/kg amounts for young children and adults. Equivalent dosages for lighter or heavier body weights can readily be determined. The dose should be adjusted to suit the individual to whom the composition is administered and will vary with age, weight and metabolism of the individual. The exact amount of the composition required will vary from subject to subject, depending on the species, age, weight and general condition of the subject, the particular peptide or polypeptide used, its mode of administration and the like. An appropriate amount can be determined by one of ordinary skill in the art using only routine experimentation given the teachings herein. One skilled in the art will realize that dosages are best optimized by the practicing physician or veterinarian and methods for determining dose amounts and regimens and preparing dosage forms are described, for example, in Remington’s Pharmaceutical Sciences, (Martin, E. W., ed., latest edition), Mack Publishing Co., Easton, Pa. Preferably, a single administration is operable to induce an immune response.

Methods involving conventional biological techniques are described herein. Such techniques are generally known in the art and are described in detail in methodology treatises such as Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, ed. Sambrook et al., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989; and Current Protocols in Molecular Biology, ed. Ausubel et al., Greene Publishing and Wiley-Interscience, New York, 1992 (with periodic updates). Immunological methods (e.g., preparation of antigen-specific antibodies, immunoprecipitation, and immunoblotting) are described, e.g., in Current Protocols in Immunology, ed. Coligan et al., John Wiley & Sons, New York, 1991; and Methods of Immunological Analysis, ed. Masseyeff et al., John Wiley & Sons, New York, 1992.

Embodiments of inventive compositions and methods are illustrated in the following detailed examples. These examples are provided for illustrative purposes and are not considered limitations on the scope of inventive compositions and methods.

EXAMPLES Example 1 Newly Discovered Ebola Virus Associated with Hemorrhagic Fever Outbreak in Bundibugyo, Uganda

In late November 2007 HF cases were reported in the townships of Bundibugyo and Kikyo in Bundibugyo District, Western Uganda (FIG. 1A). These samples were assayed as described by Towner, J S, et al., PLoS Pathog, 2008 November; 4(11): e1000212, the contents of which are incorporated herein by reference for methods, results, reagents, and all other aspects of the publication. A total of 29 blood samples were initially collected from suspect cases and showed evidence of acute ebolavirus infection in eight specimens using a broadly reactive ebolavirus antigen capture assay known to cross-react with the different ebolavirus species’ and an IgM capture assay based on Zaire ebolavirus reagents (Table 1). These specimens were negative when initially tested with highly sensitive real-time RT-PCR assays specific for all known Zaire and Sudan ebolaviruses and marburgviruses. However, further evidence of acute ebolavirus infection was obtained using a traditionally less sensitive (relative to the real-time RT-PCR assays) but more broadly reactive filovirus L gene-specific RT-PCR assay (1 specimen) (Table 1). Sequence analysis of the PCR fragment (400 bp of the virus L gene) revealed the reason for the initial failure of the real-time RT-PCR assays, as the sequence was distinct from that of the 4 known species of ebolavirus, although distantly related to Côte d’Ivoire ebolavirus. In total, 9 of 29 specimens showed evidence of ebolavirus infection, and all tests were negative for marburgvirus (data not shown).

Approximately 70% of the virus genome was rapidly sequenced from total RNA extracted from a patient serum (#200706291) using a newly established metagenomics pyrosequencing method (454 Life Sciences) which involves successive rounds of random DNA amplification8. Using the newly derived draft sequence, a real-time RT-PCR assay specific for the NP gene of this virus was quickly developed and evaluated. The assay was shown to have excellent sensitivity (Table 1), finding positive all the initial six samples that tested positive by either virus antigen capture (five specimens) or virus isolation assays (four specimens). The antigen-capture, IgM, IgG and newly designed real-time PCR assays were quickly transferred to the Uganda Virus Research Institute during the course of the outbreak to facilitate rapid identification and isolation of Ebola cases in the affected area for efficient control of the outbreak. The outbreak continued through late December 2007, and resulted in 149 suspected cases and 37 deaths9.

Table 1. Ebolavirus diagnostic results of initial 29 specimens obtained from Bundibugyo District with numerical specimen numbers assigned. RT-PCR refers to results obtained from conventional PCR using the broadly reactive Filo A/B primers13. Ag, IgM, and IgG refer to results from ELISA-based assays10, 11 with Zaire ebolavirus reagents while virus isolation refers to culture attempts on Vero E6 cells’2. Q-RT-PCR refers to results obtained using the optimized Bundibugyo ebolavirus specific real-time RT-PCR assay with cycle threshold (Ct) values of positive (Pos) samples indicated in the far right column. * Specimen #200706291 is the clinical sample from which prototype isolate #811250 was obtained.

 

TABLE 1
Sample RT- Virus Q- RT-
No. PCR Ag IgM IgG Isolation PCR Ct
200706288 neg neg neg neg neg neg 40
200706289 neg neg neg neg neg neg 40
200706290 neg neg neg neg neg neg 40
200706291* Pos Pos neg neg Pos Pos 23.64
200706292 neg neg neg neg neg neg 40
200706293 neg neg neg neg neg neg 40
200706294 neg neg neg neg neg neg 40
200706295 neg neg neg neg neg neg 40
200706296 neg neg Pos Pos neg neg 40
200706297 neg neg Pos Pos neg neg 40
200706298 neg Pos Pos Pos neg Pos 34.83
200706299 neg neg Pos Pos neg neg 40
200706300 neg neg neg neg neg neg 40
200706301 neg neg neg neg neg neg 40
200706302 neg Pos Pos neg neg Pos 35.01
200706303 neg neg neg neg neg neg 40
200706304 neg neg neg neg Pos Pos 38.18
200706305 neg neg neg neg neg neg 40
200706306 neg neg neg neg neg neg 40
200706307 neg neg neg neg neg neg 40
200706320 ND Pos neg neg Pos Pos 30.24
200706321 ND neg neg neg neg neg 40
200706322 ND neg neg neg neg neg 40
200706323 ND neg neg neg neg neg 40
200706324 ND neg neg neg neg neg 40
200706325 ND neg neg neg neg neg 40
200706326 ND neg neg neg neg neg 40
200706327 ND Pos neg neg Pos Pos 34.41
200706328 ND neg neg neg neg neg 40

The entire genome sequence of this virus was completed using a classic primer walking sequencing approach on RNA. The complete genome of the Eb ebolavirus was not available, so it too was derived by a similar combination of random primed pyrosequencing and primer walking approaches. Acquisition of these sequences allowed for the first time the phylogenetic analysis of the complete genomes of representatives of all known species of Ebola and Marburg viruses. The analysis revealed that the newly discovered virus differed from the four existing ebolavirus species (FIG. 1), with approximately 32% nucleotide difference from even the closest relative, EboIC (Table 2). Similar complete genome divergence (35-45%) is seen between the previously characterized ebolavirus species.

Table 2. Identity matrix based on comparisons of full-length genome sequences of Zaire ebolaviruses 1976 (Genbank accession number NC002549) and 1995 (Genbank accession number AY354458), Sudan ebolavirus 2000 (Genbank accession number NC006432), Cote d’Ivoire ebolavirus 1994 (SEQ ID NO: 10), Reston ebolavirus 1989 (Genbank accession number NC004161), and Bundibugyo ebolavirus 2007 (SEQ ID NO: 1).

 

TABLE 2
Zaire Sudan EboIC EboBun Reston
’95 ’00 ’94 ’07 ’89
Zaire ’76 .988 .577 .630 .632 .581
Zaire ’95 .577 .631 .633 .581
Sudan ’00 .577 .577 .609
EboIC ’94 .683 .575
EboBun ’07 .576

The material and information obtained from the discovery of the new unique virus EboBun and the realization that together with EboIC these viruses represent a Glade of Bundibungyo-Ivory Coast Ebola virus species is valuable, and makes possible the development of clinical, diagnostic and research tools directed to human hEbola infection.

Material and Methods

Ebolavirus Detection and Virus Isolation.

Several diagnostic techniques were used for each sample: (i) antigen capture, IgG, and IgM assays were performed as previously described11 (ii) virus isolation attempts were performed on Vero E6 cells’2 and monitored for 14 days; (iii) RNA was extracted and tested for Zaire16 and Sudan ebolavirus and marburgvirus4 using real-time quantitative RT-PCR assays designed to detect all known species of each respective virus species the primers/probe for the Sudan ebolavirus assay were EboSudBMG 1(+) 5′-GCC ATG GIT TCA GGT TTG AG-3′ (SEQ ID NO: 21), EboSudBMG 1(−) 5′-GGT IAC ATT GGG CAA CAA TTC A-3′ (SEQ ID NO: 22) and Ebola Sudan BMG Probe 5′FAM-AC GGT GCA CAT TCT CCT TTT CTC GGA-BHQ1 (SEQ ID NO: 23)]; (iv) the conventional RT-PCR was performed with the filo A/B primer set as previously described16 using Superscript III (Invitrogen) according to the manufacturer’s instructions. The specimen 200706291 was selected as the reference sample for further sequence analysis.

Genome Sequencing.

Pyrosequencing was carried out utilizing the approach developed by 454 Life Sciences, and the method described by Cox-Foster et al.8 Subsequent virus whole genome primer walking was performed as previously described17 but using the primers specific for Bundibugyo ebolavirus RT-PCR amplification. In total, the entire virus genome was amplified in six overlapping RT-PCR fragments (all primers listed 5′ to 3′): fragment A (predicted size 2.7 kb) was amplified using forward-GTGAGACAAAGAATCATTCCTG (SEQ ID NO: 24) with reverse-CATCAATTGCTCAGAGATCCACC (SEQ ID NO: 25); fragment B (predicted size 3.0 kb) was amplified using forward-CCAACAACACTGCATGTAAGT (SEQ ID NO: 26) with reverse-AGGTCGCGTTAATCTTCATC (SEQ ID NO: 27); fragment C (predicted size 3.5 kb) was amplified using forward-GATGGTTGAGTTACTTTCCGG (SEQ ID NO: 28) with reverse-GTCTTGAGTCATCAATGCCC (SEQ ID NO: 29); fragment D (predicted size 3.1 kb) was amplified using forward-CCACCAGCACCAAAGGAC (SEQ ID NO: 30) with reverse-CTATCGGCAATGTAACTATTGG (SEQ ID NO: 31); fragment E (predicted size 3.4 kb) was amplified using forward-GCCGTTGTAGAGGACACAC (SEQ ID NO: 32) with reverse-CACATTAAATTGTTCTAACATGCAAG (SEQ ID NO: 33) and fragment F (predicted size 3.5 kb) was amplified using forward-CCTAGGTTATTTAGAAGGGACTA (SEQ ID NO: 34) with reverse-GGT AGA TGT ATT GAC AGC AAT ATC (SEQ ID NO: 35).

The exact 5′ and 3′ ends of Bundibugyo ebolavirus were determined by 3′ RACE from virus RNA extracted from virus infected Vero E6 cell monolayers using TriPure isolation reagent. RNAs were then polyadenylated in vitro using A-Plus poly(A) polymerase tailing kit (Epicenter Biotechnologies) following the manufacturer’s instructions and then purified using an RNeasy kit (Qiagen) following standard protocols. Ten microliters of in vitro polyadenylated RNA were added as template in RT-PCR reactions, using SuperScript III One-Step RT-PCR system with Platinum Taq High Fidelity (Invitrogen) following the manufacturer’s protocol. Two parallel RT-PCR reactions using the oligo(dT)-containing 3′RACE-AP primer (Invitrogen) mixed with 1 of 2 viral specific primers, Ebo-U 692(−) ACAAAAAGCTATCTGCACTAT (SEQ ID NO: 36) and Ebo-V18269(+) CTCAGAAGCAAAATTAATGG (SEQ ID NO: 37), generated ˜700 nt long fragments containing the 3′ ends of either genomic and antigenomic RNAs. The resulting RT-PCR products were analyzed by agarose electrophoresis, and DNA bands of the correct sizes were purified using QIAquick Gel Extraction Kit (Qiagen) and sequenced using standard protocols (ABI).

The nucleotide sequence of the Côte d’Ivoire ebolavirus (EboIC) isolate RNA was initially determined using the exact same pyrosequencing strategy as that used for Bundibugyo ebolavirus described above. This method generated sequence for approximately 70% of the entire genome. This draft sequence was then used to design a whole genome primer walking strategy for filling any gaps and confirming the initial sequence. The following Côte d’Ivoire ebolavirus-specific primers were used to generate RT-PCR fragments, designated A-F, as follows: Fragment A (predicted size 3.0 kb) was amplified using forward-GTGTGCGAATAACTATGAGGAAG (SEQ ID NO: 38) and reverse-GTCTGTGCAATGTTGATGAAGG (SEQ ID NO: 39); Fragment B (predicted size 3.2 kb) was amplified using forward-CATGAAAACCACACTCAACAAC (SEQ ID NO: 40) and reverse-GTTGCCTTAATCTTCATCAAGTTC (SEQ ID NO: 41); Fragment C (predicted size 3.0 kb) was amplified using forward-GGCTATAATGAATTTCCTCCAG (SEQ ID NO: 42) and reverse-CAAGTGTATTTGTGGTCCTAGC (SEQ ID NO: 43); fragment D (predicted size 3.5 kb) was amplified using forward-GCTGGAATAGGAATCACAGG (SEQ ID NO: 44) and reverse-CGGTAGTCTACAGTTCTTTAG (SEQ ID NO: 45); fragment E (predicted size 4.0 kb) was amplified using forward-GACAAAGAGATTAGATTAGCTATAG (SEQ ID NO: 46) and reverse-GTAATGAGAAGGTGTCATTTGG (SEQ ID NO: 47); fragment F (predicted size 2.9 kb) was amplified using forward-CACGACTTAGTTGGACAATTGG (SEQ ID NO: 48) and reverse-CAGACACTAATTAGATCTGGAAG (SEQ ID NO: 49); fragment G (predicted size 1.3 kb) was amplified using forward-CGGACACACAAAAAGAAWRAA (SEQ ID NO: 50) and reverse-CGTTCTTGACCTTAGCAGTTC (SEQ ID NO: 51); and fragment H (predicted size 2.5 kb) was amplified using forward-GCACTATAAGCTCGATGAAGTC (SEQ ID NO: 52) and reverse-TGGACACACAAAAARGARAA (SEQ ID NO: 53). A gap in the sequence contig was located between fragments C and D and this was resolved using the following primers to generate a predicted fragment of 1.5 kb: forward-CTGAGAGGATCCAGAAGAAAG (SEQ ID NO: 54) and reverse-GTGTAAGCGTTGATATACCTCC (SEQ ID NO: 55). The terminal ˜20 nucleotides of the sequence were not experimentally determined but were inferred by comparing with the other known Ebola genome sequences.

Bundibugyo ebolavirus Real-Time RT-PCR Assay.

The primers and probe used in the Bundibugyo ebolavirus specific Q-RT-PCR assay were as follows: EboU965(+): 5′-GAGAAAAGGCCTGTCTGGAGAA-3′ (SEQ ID NO: 56), EboU1039(−): 5′-TCGGGTATTGAATCAGACCTTGTT-3′ (SEQ ID NO: 57) and EboU989 Prb: 5′Fam-TTCAACGACAAATCCAAGTGCACGCA-3′BHQ1 (SEQ ID NO 58). Q-RT-PCR reactions were set up using Superscript III One-Step Q-RT-PCR (Invitrogen) according to the manufacturer’s instructions and run for 40 cycles with a 58° C. annealing temperature.

Phylogenetic Analysis.

Modeltest 3.718 was used to examine 56 models of nucleotide substitution to determine the model most appropriate for the data. The General Time Reversible model incorporating invariant sites and a gamma distribution (GTR+I+G) was selected using the Akaike Information Criterion (AIC). Nucleotide frequencies were A=0.3278, C=0.2101, G=0.1832, T=0.2789, the proportion of invariant sites=0.1412, and the gamma shape parameter=1.0593. A maximum likelihood analysis was subsequently performed in PAUP*4.0b1019 using the GTR+I+G model parameters. Bootstrap support values were used to assess topological support and were calculated based on 1,000 pseudoreplicates20.

In addition, a Bayesian phylogenetic analysis was conducted in MrBayes 3.221 using the GTR+I+G model of nucleotide substitution. Two simultaneous analyses, each with four Markov chains, were run for 5,000,000 generations sampling every 100 generations. Prior to termination of the run, the AWTY module was used to assess Markov Chain Monte Carlo convergence to ensure that the length of the analysis was sufficient22. Trees generated before the stabilization of the likelihood scores were discarded (burn in =40), and the remaining trees were used to construct a consensus tree. Nodal support was assessed by posterior probability values (>95=statistical support).

Example 2 Immunization against EboBun

To determine the capability of immunogens to elict an immune response in non-human primates (NHP), 12 cynomolgus macaques, of which 10 are immunized with VSVΔG/EboBunGP either orally (OR; n=4), intranasally (IN; n=4) or intramuscularly (IM; n=2) in accordance with all animal control and safety guidelines and essentially as described by Qiu, X, et al., PLoS ONE. 2009; 4(5): e5547. The remaining 2 control animals are vaccinated intramuscularly with VSVΔG/MARVGP. VSVΔG/MARVGP does not provide heterologous protection against EboBun, therefore these NHPs succumb to EboBun infection. Animals are acclimatized for 14 days prior to infection. Animals are fed and monitored twice daily (pre- and post-infection) and fed commercial monkey chow, treats and fruit. Husbandry enrichment consists of commercial toys and visual stimulation.

The recombinant VSVΔG/EboBun vaccines are synthesized expressing the EboBun glycoprotein (GP) (SEQ ID NO: 9), soluble glycoprotein (sGP) (SEQ ID NO: 4), or nucleoprotein (NP) (SEQ ID NO: 3). Control VSVΔG/MARVGP vaccines represent the analogous proteins from Lake victoria marburgvirus (MARV) (strain Musoke). The following results for GP are similar for sGP and NP. Vaccines are generated using VSV (Indiana serotype) as described previously. Garbutt, M, et al., J Virol, 2004; 78(10):5458-5465; Schnell, M J, et al., PNAS USA, 1996; 93(21):11359-11365. EboBun challenge virus is passaged in Vero E6 cells prior to challenge, as described previously Jones, S M, et al., Nat Med, 2005; 11(7):786-790; Jahrling, P B, et al., J Infect Dis, 1999; 179 (Suppl 1):S224-34. An EboBun immunogen peptide pool consisting of 15mers with 11 amino acid overlaps (Sigma-Genosys) spanning the entire sequence of the EboBun immunogens and strain Mayinga 1976 GP are used.

Twelve filovirus naïve cynomolgus monkeys randomized into four groups receive 2 ml of 1×107 PFU/ml of vaccine in Dulbecco’s modified Eagle’s medium (DMEM). Animals in the three experimental groups are vaccinated with either: 1) 2 ml orally (OR) (n=4); 2) 1 ml dripped into each nostril, intranasally (IN) (n=4); or 3) 1 ml each into two sites intramuscularly (IM) (n=2). The two controls are injected intramuscularly with 2 ml of 1×107 PFU/ml of VSVΔG/MARVGP. All animals are challenged intramuscularly 28 days later with 1,000 PFU of EboBun.

Routine examination is conducted on 0, 2, 4, 6, 10, 14 and 21 days post-vaccination, then 0, 3, 6, 10, 14, 19, 26 days, 6 and 9 months after the EboBun challenge. For the examinations animals are anaesthetized by intramuscular injection with 10 mg/kg of ketaset (Ayerst). Examinations include haematological analysis, monitoring temperature (rectal), respiration rate, lymph nodes, weight, hydration, discharges and mucous membranes. Also, swabs (throat, oral, nasal, rectal, vaginal) and blood samples are collected (4 ml from femoral vein, 1 ml in EDTA vacutainer tube; 3 ml in serum separator vacutainer tube). Cynomolgus monkey PBMCs are isolated using BD CPT sodium citrate Vacutainers (Becton Dickinson) as per manufacturer’s protocol.

All VSVΔG/EboBunGP immunized animals are protected from high dose challenge. These animals show no evidence of clinical illness after vaccination or EboBun challenge. Both control animals demonstrate typical symptoms associated with EboBun HF including fever, macular rashes, lethargy, and unresponsiveness. Continued infection requires euthanization. Hematology analyses at each examination date demonstrate increases in the platelet-crit in the OR and IN groups post-challenge, however, no significant changes are observed in any NHPs post-immunization or in the VSVΔG/EboBunGP immunized NHPs post-challenge.

EboBun antibody production from humoral antibody response to vaccination and challenge is examined by a virus like particle (VLP) based ELISA assay. Generation of EboBun VLPs is performed by the protocol for ZEBOV as described by Wahl-Jensen, V., et al., J Virol, 2005; 79(4):2413-2419. ELISA is performed by the protocol described by Qiu, X, et al., PLoS ONE. 2009; 4(5): e5547.

The VSVΔG/MARVGP immunized animals do not develop a detectable antibody response to EboBun. In contrast, potent antibody responses are detected in all VSVΔG/EboBunGP immunized animals independent of immunization route. Between days 14 and 21 post-vaccination, all VSVΔG/EboBunGP immunized NHPs develop high levels of IgA, IgM, and IgG against EboBunGP. After challenge the IgM titres do not exceed the post-vaccination levels, however, IgG and IgA antibody titres are increased peaking 14 days post-challenge then slowly decreasing before maintaining a relatively high antibody titre up to 9 months.

The level of neutralization antibodies is detected by a EboBun-GFP flow cytometric neutralization assay in serum collected at days 0 and 21 post-vaccination. Samples are assayed in duplicate for their ability to neutralize an infection with EboBun-GFP in VeroE6 cells. Serially diluted serum samples are incubated with an equal volume of EboBun-GFP in DMEM, at 37° C., 5% CO2 for 1 hr followed by addition of 150 μl per well of a confluent 12 well plate of VeroE6 cells (MOI=0.0005). After 2 hours at 37° C., 5% CO2, 1 ml of DMEM, 2% fetal bovine serym (FBS), 100 U/ml penicillin, 100 μg/ml streptomycin is added per well and incubated for 5 days. Cells are harvested by removing the culture supernatant, washing with 1 ml PBS, 0.04% EDTA, then adding 800 μl of PBS 0.04% EDTA for 5 minutes at 37° C. before adding 8 ml PBS, 4% paraformaldehyde (PFA) and overnight incubation. The cells are acquired (10,000 events) and analyzed with CellQuest Pro v3.3 on a Becton Dickinson FACSCalibur flow cytometer.

The OR and IN routes produce EboBunGP-specific neutralizing antibodies with the OR route producing the highest titres post-vaccination. The IM immunization produces detectable levels of neutralizing antibody. In comparison, 3/4 NHPs in the OR group demonstrate a 50% reduction in EboBun-GFP positive cells at a titre of 1:40. Similarly, the IN route results in a reduction of EboBun-GFP positive cells at the 1:40 dilution.

EboBunGP-specific effector cellular immune responses are determined using IL-2 and IFN-γ ELISPOT assays as described by Qin, X, et al., PLoS ONE. 2009; 4(5): e5547 to determine the number of IL-2 and IFN-γ secreting lymphocytes. Prior to challenge on days 10 to 14 post-vaccination there is a detectable EboBun immunogen-specific IFN-γ response in all immunized animals. The IM route is the most potent, inducing approximately 2-fold more IFN-γ secreting cells than OR (p<0.001) or IN (p=0.043) routes. A strong post-challenge secondary IFN-γ response is induced in all VSVΔG/EboBun immunized animals with the IM route producing the most IFN-γ cells at day 6. By day 10 the OR group demonstrates a stronger response. The IFN-γ in the IN group rises steadily, peaking at day 26 post-challenge with 4.3 and 2 fold more EboBun specific IFN-γ secreting cells than the IM (p=0.003) and OR (p=0.075) group, respectively. All three routes produce strong EboBun-specific IFN-γ responses.

Post-vaccination, the IM group also has more EboBunGP-specific IL-2 secreting cells than either of the mucosally immunized groups. Post-challenge, the IM route continues to dominate early after challenge peaking on day 10. This difference shows a trend when compared to the IN group (p=0.067) and is significant when compared to the OR group (p<0.001). Additionally, the IN group has more IL-2 producing cells than the OR group (p=0.090) on day 10 post-challenge. By day 26 post-challenge all three routes continue to produce a EboBunGP-specific IL-2 response, however, the IN group response is strongest. At day 26 post-challenge the IN group has the most potent IFN-γ and IL-2 responses, as well as the highest IgA and IgG antibody titre, indicating this immunization route, followed by a EboBun challenge, results in the development of potent and sustained effector responses.

Absolute lymphocyte numbers for CD3+, CD4+, and CD8+ (CD3+4) T cell populations are determined by flow cytometry. No decrease is observed in the lymphocyte populations for any of the VSVΔG/EboBunGP vaccinated NHPs. In contrast, control animals who are not protected from EboBun show lymphocyte numbers decreased by 28-57%.

Macrophage numbers are slightly increased in control animals. However, the number of CD14+ cells is greater in the VSVΔG/EboBunGP vaccinated groups with the IM route showing the most significant increases.

In order to determine the long term immune response after challenge, EboBunGP-specific CD4+ and CD8+ memory T-lymphocytes are examined for their ability to proliferate (CFSE) or produce IFN-γ in response to EboBunGP peptides at 6 months post-vaccination. EboBunGP-specific memory responses are observed as a result of vaccination followed by a ZEBOV challenge. These responses persist for at least 6 months. The memory populations in OR and IN inoculation routes demonstrate the greatest potential for proliferation and IFN-γ production post-challenge.

Any patents or publications mentioned in this specification are incorporated herein by reference to the same extent as if each individual publication is specifically and individually indicated to be incorporated by reference.

The compositions and methods described herein are presently representative of preferred embodiments, exemplary, and not intended as limitations on the scope of the invention. Changes therein and other uses will occur to those skilled in the art. Such changes and other uses can be made without departing from the scope of the invention as set forth in the claims. All numerical ranges are inclusive of the whole integers and decimals between the endpoints, and inclusive of the endpoints.

REFERENCES

 

  • 1. Suzuki, Y., and Gojobori, T., (1997) The origin and evolution of Ebola and Marburg viruses. Mol Bio Evol, 14(8): 800-806.
  • 2. Sanchez, A., Geisbert, T. W., Feldmann, H. in Fields Virology (ed. Knipe, D. M., Howley, P. M.) 1409-1448 (Lippincott Williams and Wilkins, Philadelphia, 2007).
  • 3. Leroy, E. M. et al., (2005) Fruit bats as reservoirs of Ebola virus. Nature, 438, 575-6.
  • 4. Towner, J. S. et al., (2007) Marburg virus infection detected in a common African bat. PLoS ONE, 2(8), e764.
  • 5. Swanepoel, R. et al., (2007) Studies of reservoir hosts for Marburg virus. Emerg Infect Dis, 13(12), 1847-51.
  • 6. Le Guenno, B. et al., (1995) Isolation and partial characterization of a new species of Ebola virus. Lancet, 345(8960), 1271-4.
  • 7. Ksiazek, T. G. et al. (1999) Clinical virology of Ebola hemorrhagic fever (EHF): virus, virus antigen, IgG and IgM antibody findings among EHF patients in Kikwit, 1995. J. Infect Dis 179 (suppl 1), S177-S187.
  • 8. Cox-Foster, D. L. et al. (2007) A metagenomic survey of microbes in honey bee colony collapse disorder. Science 318, 283-7.
  • 9. World Health Organization (2008) Ebola outbreak contained in Uganda. Features, 22 February, www.who.int/features/2008/ebola_outbreak/en/.
  • 10. Sullivan, N. J., Sanchez, A., Rollin, P. E., Yang, Z.-Y. & Nabel, G. J. (2000) Development of a preventive vaccine for Ebola virus infection in primates. Nature 408, 605-609.
  • 11. Ksiazek, T. G., West, C. P., Rollin, P. E., Jahrling, P. B. & Peters, C. J. (1999) ELISA for the detection of antibodies to Ebola viruses. J. Infect Dis 179 (suppl 1), S191-S198.
  • 12. Rodriguez, L. et al. (1999) Persistence and genetic stability of Ebola virus during the outbreak in Kikwit, Zaire 1995. J. Infect Dis 179 (suppl 1), S170-S176.
  • 13. Sanchez, A. et al. Detection and molecular characterization of Ebola viruses causing disease in human and nonhuman primates. J. Infect Dis 179 (suppl 1), S164-S169 (1999).
  • 14. Jones, S. M. et al. (2005) Live attenuated recombinant vaccine protects nonhuman primates against Ebola and Marburg viruses. Nat Med 11, 786-90.
  • 15. Geisbert, T. W. et al. (2008) Recombinant vesicular stomatitis virus vector mediates postexposure protection against Sudan Ebola hemorrhagic fever in nonhuman primates. J Virol 82, 5664-8.
  • 16. Towner, J. S., Sealy, T. K., Ksiazek, T. & Nichol, S. T. (2007) High-throughput molecular detection of hemorrhagic fever virus threats with applications for outbreak settings. J. Inf Dis 196 (suppl 2), S205-212.
  • 17. Towner, J. S. et al. (2006) Marburgvirus genomics and association with a large hemorrhagic fever outbreak in Angola. J Virol 80, 6497-516.
  • 18. Posada, D. & Crandall, K. A. (1998) MODELTEST: testing the model of DNA substitution. Bioinformatics 14, 817-818.
  • 19. Swofford, D. L. (2002) PAUP*: phylogenetic analysis using parsimony (*and other methods) version 4.0b10. Sinauer Assoc., Sunderland, Mass.
  • 20. Felsenstein, J. (1985) Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39, 783-791.
  • 21. Ronquist, F. & Huelsenbeck, J. P. (2003) MRBAYES 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19, 1572-1574.
  • 22. Nylander, J. A. A., Wilgenbusch, J. C., Warren, D. L. & Swofford, D. L. (2008) AWTY (are we there yet?): a system for graphical exploration of MCMC convergence in Bayesian phylogenetics. Bioinformatics 24, 581-583.
Patent Citations
Cited Patent Filing date Publication date Applicant Title
US20010053519 * Mar 6, 2000 Dec 20, 2001 Fodor Stephen P.A. Nucleotide sequences for use as tool in genetic engineering
WO2009128867A2 * Jan 7, 2009 Oct 22, 2009 Warf – Wisconsin Alumni Research Foundation Recombinant biologically contained filovirus
* Cited by examiner
Non-Patent Citations
Reference
1 * Ebihara et al. Journal of Infectious Diseases 196:S313-22, 2007
2 * Genbank AF086833.2
3 * GenBank FJ217162.1, 21 Nov 2008
4 * Le Guenno et al (Lancet 345:1271-74, 1995)
5 * Neumann et al. Journal of Virology 76:406-410, 2002
6 * Sanchez et al (Virus Research 113:16-25, 2005)
7 * Towner et al (Virology 332:20-27, 2005)
8 * Warfield et al (Journal of Infectious Diseases 196:S276-283, 15 Nov. 2007),
* Cited by examiner
Classifications
U.S. Classification 424/93.6, 530/325, 435/236, 530/330, 530/327, 435/235.1, 530/350, 530/328, 514/1.1, 530/324, 514/44.00R, 536/23.72, 530/326, 530/329
International Classification A61K38/02, A61K31/7088, C07H21/04, C07K7/06, C12N7/04, A61K35/76, C07H21/02, C12N7/00, C07K14/08, C07K7/08
Cooperative Classification C07K16/10, G01N33/56983, C12N7/00, C12N2760/14145, C07K2316/96, C12N2810/6072, C12N2760/14143, A61K39/12, A61K2039/53, A61K2039/5256, G01N2333/08
European Classification A61K39/12, C07K16/10, G01N33/569K, C12N7/00
Legal Events
Date Code Event Description
Apr 25, 2011 AS Assignment
Owner name: THE GOVERNMENT OF THE UNITED STATES OF AMERICA AS
Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:TOWNER, JONATHAN S.;NICHOL, STUART T.;COMER, JAMES A.;AND OTHERS;SIGNING DATES FROM 20110415 TO 20110425;REEL/FRAME:026177/0586

As Canada hits Russia with a new package of sanctions targeting Russian military officials, defense companies and the largest state-owned bank, political analyst Prof. Michel Chossudovsky believes the country is simply copying the policy of the US towards Moscow and adds that it is mostly a move to curry favor in the polls with the country’s Ukrainian diaspora.

“I think that there are essentially two elements here,” he told Radio VR.

“One pertains to the fact that in recent years, particularly under the government of Prime Minister Harper, Canadian foreign policy is a ‘copy and paste’ of that of Washington. Essentially, there is an agreement on basic principles. The US and Canada have integrated military commands, the two economies are heavily integrated and the corporate elites overlap with one another.”

“That’s the first element,” he added.

“The second has to do with the 1.2 million Ukrainians, or people of Ukrainian descent, who are largely concentrated in the western provinces – [such as] Manitoba.”

“And this, from the point of view of Prime Minister Stephen Harper, is an important source of political support in forthcoming elections and he has played on that,”

said Prof. Chossudovsky.

“But at the same time, that Ukrainian community in Canada is not necessarily aligned with the Poroshenko government. It has diverse opinions, and some people within that community are extremely critical of the ongoing processes and the Poroshenko government’s support of Nazi elements and so on.”

Prof. Chossudovsky also commented on Poroshenko’s trip abroad, including his visit to Ottawa, calling it a “public relations tour”.

“The prime minister has already promised that Canada would deploy so-called non-combat troops from the Canadian army and navy and air force,” he said.

“Non-combat sounds a bit contradictory. [They are] to join allies in Eastern Europe and I assume they may be even deployed inside Ukraine; that is an object for discussion.”

There is a financial assistance package, added Prof. Chossudovsky, but it is not particularly significant, and it would be a loan rather than direct foreign aid.

“And I think that we are dealing with a little bit of propaganda here, with public relations. Poroshenko is on a public relations tour.  And I think most of these positions taken by the Ottawa government are formulated in liaison with the US State Department.”

Women hold posters of hunger striking Palestinian prisoners outside the Red Cross offices in Jerusalem in June. (Saeed Qaq / APA images)

This past summer, as Israeli weapons deindustrialized Gaza and decimated its civilians, leftist publications in Latin America began circulating a 2012 essay by the renowned Uruguayan writer Eduardo Galeano. Writing in the wake of Israel’s November 2012 onslaught in Gaza, Galeano lamented the “erasing of Palestine from the map.” Palestinians, he wrote, “cannot breathe without permission” and “when they vote for someone who they shouldn’t, they are punished.”

For Galeano, a historian of Latin America, the 2006 election in Gaza, won by Hamas, seemed a lot like the 1932 election in El Salvador. While El Salvador’s military rulers conceded a place on the ballot for the long-marginalized Communist Party (just asGeorge W. Bush did with Hamas in 2006), they swiftly annulled the results after a Communist triumph, and within days launched a genocidal campaign targeting the party’s indigenous peasant base.

Similarly, after Bush’s “democracy promotion” elicited the “wrong” result in Gaza, the United States and Israel worked to undermine the winner of the election using a variety of methods, including orchestrating an abortive coup attempt with the Ramallah-basedPalestinian Authority. Meanwhile, Israel has continued to impose a suffocating blockadeon Gaza since 2007, which has the sadistic goal of keeping its people “on a diet” and its “economy on the brink of collapse.”

Linked plights

For Galeano and others, the respective plights of Latin Americans and Palestinians are not only linked in a fertile historical analogy — bridging the gulf of their separate oppressions is an unassailable fact.

In the second half of the twentieth century, Israel supplied repressive Latin American governments, from Guatemala to Argentina, with weapons, military tra