Global Research Editor’s Note

We bring to the attention of our readers the following text of Osama bin Laden’s interview with Ummat, a Pakistani daily, published in Karachi on September 28, 2001. It was translated into English by the BBC World Monitoring Service and made public on September 29, 2001.

The authenticity of this interview remains to be confirmed. It is available in recognized electronic news archives including the BBC. Its authenticity has not been questioned.  

The interview tends to demystify the Osama bin Laden persona.

Osama bin Laden categorically denies his involvement in the 9/11 attacks.  Bin Laden’s statements in this interview are markedly different from those made in the alleged Osama video tapes.

In this interview, Osama bin Laden exhibits an understanding of US foreign policy. He expresses his views regarding the loss of life on 9/11. He focusses on CIA support to the narcotics trade.

He also makes statements as to who, in his opinion, might be the likely perpetrator of  the September 11 attacks.

This is an important text which has not been brought to the attention of Western public opinion.

We have highlighted key sections of this interview.

It is our hope that the text of this interview, published on 28 September 2001 barely a week before the onset of the war on Afghanistan, will contribute to a better understanding of the history of Al Qaeda, the role of Osama bin Laden and the tragic events of September 11, 2001.

This interview is published for informational purposes only. GR does not in any way endorse the statements in this interview.

Michel  Chossudovsky, September 9, 2014


Full text of September 2001 Pakistani paper’s “exclusive” interview with Usamah Bin-Ladin

Ummat (in Urdu)

translated from Urdu

Karachi, 28 September 2001, pp. 1 and 7.

Ummat’s introduction

Kabul: Prominent Arab mojahed holy warrior Usamah Bin-Ladin has said that he or his al-Qa’idah group has nothing to do with the 11 September suicidal attacks in Washington and New York. He said the US government should find the attackers within the country. In an exclusive interview with daily “Ummat”, he said these attacks could be the act of those who are part of the American system and are rebelling against it and working for some other system. Or, Usamah said, this could be the act of those who want to make the current century a century of conflict between Islam and Christianity. Or, the American Jews, who are opposed to President Bush ever since the Florida elections, might be the masterminds of this act. There is also a great possibility of the involvement of US intelligence agencies, which need billions of dollars worth of funds every year. He said there is a government within the government in the United States.

The secret agencies, he said, should be asked as to who are behind the attacks. Usamah said support for attack on Afghanistan was a matter of need for some Muslim countries and compulsion for others. However, he said, he was thankful to the courageous people of Pakistan who erected a bulwark before the wrong forces. He added that the Islamic world was attaching great expectations with Pakistan and, in time of need, “we will protect this bulwark by sacrificing of lives”.

Following is the interview in full detail:

Ummat: You have been accused of involvement in the attacks in New York and Washington. What do you want to say about this? If you are not involved, who might be?

Usamah [Osama bin Laden]: In the name of Allah, the most beneficent, the most merciful. Praise be to Allah, Who is the creator of the whole universe and Who made the earth as an abode for peace, for the whole mankind. Allah is the Sustainer, who sent Prophet Muhammad for our guidance. I am thankful to the Ummat Group of Publications, which gave me the opportunity to convey my viewpoint to the people, particularly the valiant and Momin true Muslim people of Pakistan who refused to believe in lie of the demon.

I have already said that I am not involved in the 11 September attacks in the United States. As a Muslim, I try my best to avoid telling a lie. I had no knowledge of these attacks, nor do I consider the killing of innocent women, children, and other humans as an appreciable act. Islam strictly forbids causing harm to innocent women, children, and other people.

Such a practice is forbidden ever in the course of a battle. It is the United States, which is perpetrating every maltreatment on women, children, and common people of other faiths, particularly the followers of Islam. All that is going on in Palestine for the last 11 months is sufficient to call the wrath of God upon the United States and Israel.

There is also a warning for those Muslim countries, which witnessed all these as a silent spectator. What had earlier been done to the innocent people of Iraq, Chechnya, and Bosnia?

Only one conclusion could be derived from the indifference of the United States and the West to these acts of terror and the patronage of the tyrants by these powers that America is an anti-Islamic power and it is patronizing the anti-Islamic forces. Its friendship with the Muslim countries is just a show, rather deceit. By enticing or intimidating these countries, the United States is forcing them to play a role of its choice. Put a glance all around and you will see that the slaves of the United States are either rulers or enemies of Muslims .

The US has no friends, nor does it want to keep any because the prerequisite of friendship is to come to the level of the friend or consider him at par with you. America does not want to see anyone equal to it. It expects slavery from others. Therefore, other countries are either its slaves or subordinates.

However, our case is different. We have pledged slavery to God Almighty alone and after this pledge there is no possibility to become the slave of someone else. If we do that, it will be disregardful to both our Sustainer and his fellow beings. Most of the world nations upholding their freedom are the religious ones, which are the enemies of United States, or the latter itself considers them as its enemies. Or the countries, which do not agree to become its slaves, such as China, Iran, Libya, Cuba, Syria, and the former Russia as received .

Whoever committed the act of 11 September are not the friends of the American people. I have already said that we are against the American system, not against its people, whereas in these attacks, the common American people have been killed.

According to my information, the death toll is much higher than what the US government has stated. But the Bush administration does not want the panic to spread. The United States should try to trace the perpetrators of these attacks within itself; the people who are a part of the US system, but are dissenting against it. Or those who are working for some other system; persons who want to make the present century as a century of conflict between Islam and Christianity so that their own civilization, nation, country, or ideology could survive. They can be any one, from Russia to Israel and from India to Serbia. In the US itself, there are dozens of well-organized and well-equipped groups, which are capable of causing a large-scale destruction. Then you cannot forget the American Jews, who are annoyed with President Bush ever since the elections in Florida and want to avenge him.

Then there are intelligence agencies in the US, which require billions of dollars worth of funds from the Congress and the government every year. This funding issue was not a big problem till the existence of the former Soviet Union but after that the budget of these agencies has been in danger.

They needed an enemy. So, they first started propaganda against Usamah and Taleban and then this incident happened. You see, the Bush administration approved a budget of 40bn dollars. Where will this huge amount go? It will be provided to the same agencies, which need huge funds and want to exert their importance.

Now they will spend the money for their expansion and for increasing their importance. I will give you an example. Drug smugglers from all over the world are in contact with the US secret agencies. These agencies do not want to eradicate narcotics cultivation and trafficking because their importance will be diminished. The people in the US Drug Enforcement Department are encouraging drug trade so that they could show performance and get millions of dollars worth of budget. General Noriega was made a drug baron by the CIA and, in need, he was made a scapegoat. In the same way, whether it is President Bush or any other US president, they cannot bring Israel to justice for its human rights abuses or to hold it accountable for such crimes. What is this? Is it not that there exists a government within the government in the United Sates? That secret government must be asked as to who made the attacks.

Ummat: A number of world countries have joined the call of the United States for launching an attack on Afghanistan. These also include a number of Muslim countries. Will Al-Qa’idah declare a jihad against these countries as well?

Usamah: I must say that my duty is just to awaken the Muslims; to tell them as to what is good for them and what is not. What does Islam says and what the enemies of Islam want?

Al-Qa’idah was set up to wage a jihad against infidelity, particularly to encounter the onslaught of the infidel countries against the Islamic states. Jihad is the sixth undeclared element of Islam. The first five being the basic holy words of Islam, prayers, fast, pilgrimage to Mecca, and giving alms Every anti-Islamic person is afraid of it. Al-Qa’idah wants to keep this element alive and active and make it part of the daily life of the Muslims. It wants to give it the status of worship. We are not against any Islamic country nor we consider a war against an Islamic country as jihad.

We are in favour of armed jihad only against those infidel countries, which are killing innocent Muslim men, women, and children just because they are Muslims. Supporting the US act is the need of some Muslim countries and the compulsion of others. However, they should think as to what will remain of their religious and moral position if they support the attack of the Christians and the Jews on a Muslim country like Afghanistan. The orders of Islamic shari’ah jurisprudence for such individuals, organizations, and countries are clear and all the scholars of the Muslim brotherhood are unanimous on them. We will do the same, which is being ordered by the Amir ol-Momenin the commander of the faithful Mola Omar and the Islamic scholars. The hearts of the people of Muslim countries are beating with the call of jihad. We are grateful to them.

Ummat: The losses caused in the attacks in New York and Washington have proved that giving an economic blow to the US is not too difficult. US experts admit that a few more such attacks can bring down the American economy. Why is al-Qa’idah not targeting their economic pillars?

Usamah: I have already said that we are not hostile to the United States. We are against the system, which makes other nations slaves of the United States, or forces them to mortgage their political and economic freedom. This system is totally in control of the American Jews, whose first priority is Israel, not the United States. It is simply that the American people are themselves the slaves of the Jews and are forced to live according to the principles and laws laid by them. So, the punishment should reach Israel. In fact, it is Israel, which is giving a blood bath to innocent Muslims and the US is not uttering a single word.

Ummat: Why is harm not caused to the enemies of Islam through other means, apart from the armed struggle? For instance, inciting the Muslims to boycott Western products, banks, shipping lines, and TV channels.

Usamah: The first thing is that Western products could only be boycotted when the Muslim fraternity is fully awakened and organized. Secondly, the Muslim companies should become self-sufficient in producing goods equal to the products of Western companies. Economic boycott of the West is not possible unless economic self-sufficiency is attained and substitute products are brought out. You see that wealth is scattered all across the Muslim world but not a single TV channel has been acquired which can preach Islamic injunctions according to modern requirements and attain an international influence. Muslim traders and philanthropists should make it a point that if the weapon of public opinion is to be used, it is to be kept in the hand. Today’s world is of public opinion and the fates of nations are determined through its pressure. Once the tools for building public opinion are obtained, everything that you asked for can be done.

Ummat: The entire propaganda about your struggle has so far been made by the Western media. But no information is being received from your sources about the network of Al-Qa’idah and its jihadi successes. Would you comment?

Usamah: In fact, the Western media is left with nothing else. It has no other theme to survive for a long time. Then we have many other things to do. The struggle for jihad and the successes are for the sake of Allah and not to annoy His bondsmen. Our silence is our real propaganda. Rejections, explanations, or corrigendum only waste your time and through them, the enemy wants you to engage in things which are not of use to you. These things are pulling you away from your cause.

The Western media is unleashing such a baseless propaganda, which make us surprise but it reflects on what is in their hearts and gradually they themselves become captive of this propaganda. They become afraid of it and begin to cause harm to themselves. Terror is the most dreaded weapon in modern age and the Western media is mercilessly using it against its own people. It can add fear and helplessness in the psyche of the people of Europe and the United States. It means that what the enemies of the United States cannot do, its media is doing that. You can understand as to what will be the performance of the nation in a war, which suffers from fear and helplessness.

Ummat: What will the impact of the freeze of al-Qa’idah accounts by the US?

Usamah: God opens up ways for those who work for Him. Freezing of accounts will not make any difference for Al-Qa’idah or other jihad groups. With the grace of Allah, al-Qa’idah has more than three such alternative financial systems, which are all separate and totally independent from each other. This system is operating under the patronage of those who love jihad. What to say of the United States, even the combined world cannot budge these people from their path.

These people are not in hundreds but in thousands and millions. Al-Qa’idah comprises of such modern educated youths who are aware of the cracks inside the Western financial system as they are aware of the lines in their hands. These are the very flaws of the Western fiscal system, which are becoming a noose for it and this system could not recuperate in spite of the passage of so many days.

Ummat: Are there other safe areas other than Afghanistan, where you can continue jihad?

Usamah: There are areas in all parts of the world where strong jihadi forces are present, from Indonesia to Algeria, from Kabul to Chechnya, from Bosnia to Sudan, and from Burma to Kashmir. Then it is not the problem of my person. I am helpless fellowman of God, constantly in the fear of my accountability before God. It is not the question of Usamah but of Islam and, in Islam too, of jihad. Thanks to God, those waging a jihad can walk today with their heads raised. Jihad was still present when there was no Usamah and it will remain as such even when Usamah is no longer there. Allah opens up ways and creates loves in the hearts of people for those who walk on the path of Allah with their lives, property, and children. Believe it, through jihad, a man gets everything he desires. And the biggest desire of a Muslim is the after life. Martyrdom is the shortest way of attaining an eternal life.

Ummat: What do you say about the Pakistan government policy on Afghanistan attack?

Usamah: We are thankful to the Momin and valiant people of Pakistan who erected a blockade in front of the wrong forces and stood in the first file of battle. Pakistan is a great hope for the Islamic brotherhood. Its people are awakened, organized, and rich in the spirit of faith. They backed Afghanistan in its war against the Soviet Union and extended every help to the mojahedin and the Afghan people. Then these are the same Pakistanis who are standing shoulder by shoulder with the Taleban. If such people emerge in just two countries, the domination of the West will diminish in a matter of days. Our hearts beat with Pakistan and, God forbid, if a difficult time comes we will protect it with our blood. Pakistan is sacred for us like a place of worship. We are the people of jihad and fighting for the defence of Pakistan is the best of all jihads to us. It does not matter for us as to who rules Pakistan. The important thing is that the spirit of jihad is alive and stronger in the hearts of the Pakistani people.

Copyright Ummat in Urdu, BBC translation in English, 2001

Read about Osama Bin Laden in Michel Chossudovsky’s international best-seller

According to Chossudovsky, the  “war on terrorism” is a complete fabrication based on the illusion that one man, Osama bin Laden, outwitted the $40 billion-a-year American intelligence apparatus. The “war on terrorism” is a war of conquest. Globalisation is the final march to the “New World Order”, dominated by Wall Street and the U.S. military-industrial complex.

Order Directly from Global Research

original

America’s “War on Terrorism”

by Michel
Chossudovsky

Welcome to the newly redesigned Global Research website!

September 8th, 2012 by Global Research

Dear Readers,

Welcome to the newly redesigned Global Research website!

We are very proud to launch an updated version of our website, featuring the same timely and analytical content as before, in a display that will be easier for our readers to navigate so that you can get the information you need as quickly and easily as possible.

On this website, you will be able to access an archive of more than 30,000 articles published by Global Research.

We thank all of our readers for the feedback you have sent us over the years and hope you will enjoy your browsing experience.

These changes would not be possible without your support, and for that we extend our sincere appreciation.

To help us cover the costs of important projects and necessary upgrades like this, we kindly ask that you consider making a donation to Global Research.

We also take this opportunity to invite you to become a Member of Global Research

If we stand together, we can fight media lies and expose the truth. There is too much at stake to choose ignorance.

Be aware, stay informed, spread the message of peace far and wide.

Feedback and suggestions regarding our new website are most welcome. To post a comment, kindly visit us on the Global Research facebook page

Sincerely,

 

The Global Research Team

THE 9/11 READER. The September 11, 2001 Terror Attacks

September 11th, 2014 by Prof Michel Chossudovsky

 

Note to Readers: Remember to bookmark this page for future reference.
Please Forward the GR I-Book far and wide. Post it on Facebook.



[scroll down for I-BOOK Table of Contents]

*

GLOBAL RESEARCH ONLINE

INTERACTIVE READER SERIES

GR I-BOOK No.  7 

THE 9/11 READER

The September 11, 2001 Terror Attacks

9/11 Truth: Revealing the Lies,  Commemorating the 9/11 Tragedy

Michel Chossudovsky (Editor)

August 2012


The 911/ Reader is part of Global Research’s Online Interactive I-Book Reader, which brings together, in the form of chapters, a collection of Global Research feature articles, including debate and analysis, on a broad theme or subject matter.  To consult our Online Interactive I-Book Reader Series, click here.


 

INTRODUCTION

The tragic events of September 11, 2001 constitute a fundamental landmark in American history. a decisive watershed, a breaking point. Millions of people have been misled regarding the causes and consequences of 9/11.

September 11 2001 opens up an era of crisis, upheaval and militarization of American society.

A far-reaching overhaul of US military doctrine was launched in the wake of 9/11.

Endless wars of aggression under the humanitarian cloak of “counter-terrorism” were set in motion. 

9/11 was also a stepping stone towards the relentless repeal of civil liberties, the militarization of law enforcement and the inauguration of “Police State USA”.

September 11, 2001 marks the onslaught of the “Global War on Terrorism” (GWOT), used as a pretext and a justification by the US and its NATO allies to carry out a “war without borders”, a global war of conquest. 

At eleven o’clock, on the morning of September 11, the Bush administration had already announced that Al Qaeda was responsible for the attacks on the World Trade Center (WTC) and the Pentagon. This assertion was made prior to the conduct of an indepth police investigation.

CIA Director George Tenet stated that same morning that Osama bin Laden had the capacity to plan  “multiple attacks with little or no warning.”

Secretary of State Colin Powell called the attacks “an act of war” and President Bush confirmed in an evening televised address to the Nation that he would “make no distinction between the terrorists who committed these acts and those who harbor them”.

Former CIA Director James Woolsey, without mentioning Afghanistan, pointed his finger at “state sponsorship,” implying the complicity of one or more foreign governments. In the words of former National Security Adviser, Lawrence Eagleburger, “I think we will show when we get attacked like this, we are terrible in our strength and in our retribution.”

That same evening at 9:30 pm, a “War Cabinet” was formed integrated by a select number of top intelligence and military advisors. And at 11:00 pm, at the end of that historic meeting at the White House, the “War on Terrorism” was officially launched.

The tragic events of 9/11 provided the required justification to wage war on Afghanistan on “humanitarian grounds”, with the full support of World public opinion and the endorsement of the “international community”.  Several prominent “progressive” intellectuals made a case for “retaliation against terrorism”, on moral and ethical grounds. The “just cause” military doctrine (jus ad bellum) was accepted and upheld at face value as a legitimate response to 9/11. 

In the wake of 9/11, the antiwar movement was completely isolated. The trade unions and civil society organizations had swallowed the media lies and government propaganda. They had accepted a war of retribution against Afghanistan, an impoverished country in Central Asia of 30 million people.

The myth of the “outside enemy” and the threat of “Islamic terrorists” was the cornerstone of the Bush administration’s military doctrine, used as a pretext to invade Afghanistan and Iraq, not to mention the repeal of civil liberties and constitutional government in America.

Amply documented but rarely mentioned by the mainstream media, Al Qaeda is a creation of the CIA going back to the Soviet- Afghan war. This was a known fact, corroborated by numerous sources including official documents of the US Congress, which the mainstream media chose to either dismiss or ignore. The intelligence community had time and again acknowledged that they had indeed supported Osama bin Laden, but that in the wake of the Cold War: “he turned against us”.

The 9/11 Commission Report has largely upheld the “outside enemy” mythology, heralding Al Qaeda as the “mastermind” organization behind the 9/11 attacks.

The official 9/11 narrative has not only distorted the causes underling the collapse of the World Trade Center buildings, it has also erased the historical record of US covert support to international terrorism, while creating the illusion that America and “Western Civilization” are threatened.

Without an “outside enemy”, there could be no “war on terrorism”. The entire national security agenda would collapse “like a deck of cards”. The war criminals in high office would have no leg to stand on.

After 9/11, the campaign of media disinformation served not only to drown the truth but also to kill much of the historical evidence on how this illusive Al Qaeda “outside enemy” had been fabricated and transformed into “Enemy Number One”.

Click to view video

VIDEO: AFTER 9/11: TEN YEARS OF WAR

Special GRTV Feature Production
- by James Corbett – 2011-09-08

***

The 911 Reader is composed of a carefully selected collection of key articles published by Global Research in the course of the last eleven years.

9/11 was an important landmark for Global Research. Our website was launched on September 9, 2001, two days prior to 9/11. Our coverage of 9/11 was initiated on September 12, 2001.

Within this collection of more than 60 chapters, we have included several important reports from our archives, published by Global Research in the immediate aftermath of the attacks. These articles provide a focus on issues pertaining to the 9/11 Timeline, foreknowledge of the 9/11 attacks, the attack on the Pentagon, the issue of insider trading on Wall Street in the days preceding 9/11 pointing to foreknowledge of the attacks.

What prevails is a complex web of lies and fabrications, pertaining to various dimensions of the 9/11 tragedy. The falsehoods contained in the official 9/11 narrative are manifold, extending from the affirmation that Osama bin Laden was the mastermind, to the assertion by the National Institute of Standards and Technology (NIST) that the WTC buildings collapsed due to the impacts of fire. (see Part III).

Where was Osama bin Laden on September 11, 2001?

Is there any proof to the effect that Osama bin Laden, the bogeyman, coordinated the 9/11 attacks as claimed in the official 9/11 narrative?

According to CBS news (Dan Rather, January 28, 2002), “Enemy Number One” was admitted to the urology ward of a Pakistani military hospital in Rawalpindi on September 10, 2001, courtesy of America’s indefectible ally Pakistan. He could have been arrested at short notice which would have “saved us a lot of trouble”, but then we would not have had an Osama Legend, which has fed the news chain as well as presidential speeches in the course of the last eleven years.

DAN RATHER. As the United states and its allies in the war on terrorism press the hunt for Osama bin Laden, CBS News has exclusive information tonight about where bin Laden was and what he was doing in the last hours before his followers struck the United States September 11.

This is the result of hard-nosed investigative reporting by a team of CBS news journalists, and by one of the best foreign correspondents in the business, CBS`s Barry Petersen. Here is his report.

(BEGIN VIDEOTAPE) BARRY PETERSEN, CBS CORRESPONDENT (voice-over): Everyone remembers what happened on September 11. Here`s the story of what may have happened the night before. It is a tale as twisted as the hunt for Osama bin Laden.

CBS News has been told that the night before the September 11 terrorist attack, Osama bin Laden was in Pakistan. He was getting medical treatment with the support of the very military that days later pledged its backing for the U.S. war on terror in Afghanistan. (transcript of CBS report, see http://www.globalresearch.ca/articles/CBS203A.html , see also http://www.cbsnews.com/stories/2002/01/28/eveningnews/main325887.shtml

CBS News footage of the Rawalpindi, Pakistan, hospital where bin Laden was allegedly treated the day before 9/11. [Source: CBS News]

 

CBS News footage of the Rawalpindi, Pakistan, hospital where bin Laden was allegedly treated the day before 9/11.

CBS News footage of the Rawalpindi, Pakistan, hospital where bin Laden was allegedly treated the day before 9/11. [Source: CBS News]

The foregoing CBS report which  is of utmost relevance indicates two obvious facts:

1. Osama bin Laden could not reasonably have coordinated the 9/11 attacks from his hospital bed;

2. The hospital was under the jurisdiction of the Pakistani Armed Forces, which has close links to the Pentagon. Osama bin Laden’s whereabouts were known to both the Pakistani and US military.

 U.S. military and intelligence advisers based in Rawalpindi. were working closely with their Pakistani counterparts. Again, no attempt was made to arrest America’s best known fugitive. Defense Secretary Donald Rumsfeld claimed, at the time, that the whereabouts of Osama bin Laden were unknown. According to Rumsfeld:  “Its like looking for a needle in a stack of hay”.

October 7, 2001: Waging America’s 9/11 War of Retribution against Afghanistan

The immediate response of the US and its allies to the 9/11 attacks was to the declare a war of retribution against Afghanistan on the grounds that the Taliban government was protecting “terror mastermind” Osama bin Laden. By allegedly harboring bin Laden, the Taliban were complicit, according to both the US administration and NATO, for having waged an act of war against the United States.

Parroting official statements, the Western media mantra on September 12, 2001 had already approved the launching of “punitive actions” directed against civilian targets in Afghanistan. In the words of William Saffire writing in the New York Times: “When we reasonably determine our attackers’ bases and camps, we must pulverize them — minimizing but accepting the risk of collateral damage” — and act overtly or covertly to destabilize terror’s national hosts”.

This decision was taken by the Bush-Cheney war cabinet in the evening of September 11, 2001. It was based on the presumption, “confirmed” by the head of the CIA that Al Qaeda was behind the attacks.

On the following morning, September 12, 2001, NATO’s Atlantic Council meeting in Brussels, endorsed the Bush administration’s declaration of war on Afghanistan, invoking Article 5 of the Washington Treaty.

An act of war by a foreign nation (Afghanistan) against a member of the Atlantic Alliance (the USA) is an act of war against all members under NATO’s doctrine of collective security. Under any stretch of the imagination, the attack on the World Trade Center and Pentagon cannot be categorized as an act of war by a foreign country. But nobody seemed to have raised this issue.

Meanwhile, on two occasions in the course of September 2001, the Afghan government –through diplomatic channels– offered to hand over Osama Bin laden to US Justice. These overtures were turned down by president Bush, on the grounds that America “does not negotiate with terrorists”.

The war on Afghanistan was launched 26 days later on the morning of October 7, 2001. The timing of this war begs the question: how long does it take to plan and implement a major theater war several thousand miles away. Military analysts will confirm that a major theater war takes months and months, up to a year or more of advanced preparations. The war on Afghanistan was already in the advanced planning stages prior to September 11, 2001, which begs the question of foreknowledge of the 9/11 attacks.

The repeal of civil liberties in America was launched in parallel with the bombing and invasion of Afghanistan, almost immediately following 9/11 with the adoption of the PATRIOT legislation and the setting up of a Homeland Security apparatus, under the pretext of protecting Americans. This post-911 legal and institutional framework had been carefully crafted prior to the 9/11 attacks.

Al Qaeda is a US Intelligence Asset

Important to the understanding of 9/11, US intelligence is the unspoken architect of “Islamic terrorism” going back to the heyday of the Soviet-Afghan war.

Bin Laden was 22 years old and was trained in a CIA sponsored guerrilla training camp. Education in Afghanistan in the years preceding the Soviet-Afghan war was largely secular. With religious textbooks produced in Nebraska, the number of CIA sponsored religious schools (madrasahs) increased from 2,500 in 1980 to over 39,000.

“Advertisements, paid for from CIA funds, were placed in newspapers and newsletters around the world offering inducements and motivations to join the [Islamic] Jihad.” (Pervez Hoodbhoy, Peace Research, 1 May 2005)

 ”The United States spent millions of dollars to supply Afghan schoolchildren with textbooks filled with violent images and militant Islamic teachings….The primers, which were filled with talk of jihad and featured drawings of guns, bullets, soldiers and mines, have served since then as the Afghan school system’s core curriculum. Even the Taliban used the American-produced books,..”, (Washington Post, 23 March 2002)

Under the Reagan administration, US foreign policy evolved towards the unconditional support and endorsement of the Islamic “freedom fighters”. This endorsement has not in any way been modified.

In a twisted irony, throughout the post 911 era,  US intelligence in liaison with Britain’s MI6, an Israel’s Mossad, continues to provide covert support to the radical Islamist organization allegedly responsible for the 9/11 attacks. Al Qaeda and its various affiliated groups including the Libya Islamic Fighting Group (LIFG) and factions within the Free Syria Army (FSA) are directly supported by the US and NATO.

In a bitter irony, the US and its allies claim to be waging a “war on terrorism” against the alleged architects of 9/11, while also using Al Qaeda operatives as their foot-soldiers.


Front row, from left: Major Gen. Hamid Gul, director general of Pakistan’s
Inter-Services Intelligence Directorate (ISI), Director of Central Intelligence Agency (CIA)
Willian Webster; Deputy Director for Operations Clair George; an ISI colonel; and senior CIA official,
Milt Bearden at a Mujahideen training camp in North-West Frontier Province of Pakistan in 1987.
(source RAWA)


Ronald Reagan meets Afghan Mujahideen Commanders at the White House in 1985 (Reagan Archives)

VIDEO (30 Sec.)

The Collapse of the World Trade Center Buildings

Based on the findings of  Richard Gage of Architects and Engineers for 9/11 Truth, the collapse of the World Trade Center buildings was not caused by fire resulting from the crash of the planes:

In more than 100 steel-framed, high-rise fires (most of them very hot, very large and very long-lasting), not one has collapsed, ever. So it behooves all of us, as your own former chief of NIST’s Fire Science Division, Dr. James Quintiere, said, “to look at real alternatives that might have been the cause of these collapses.”

Let’s start with temperatures – 1,340° F. temperatures, recorded in thermal images of the surface of the World Trade Center rubble pile a week after 9/11 by NASA’s AVIRIS equipment on USGS overflights. Such temperatures cannot be achieved by oxygen-starved hydrocarbon fires. Such fires burn at only 600 to 800° F. Remember, there was no fire on the top of the pile. The source of this incredible heat was therefore below the surface of the rubble, where it must have been far hotter than 1,340 degrees.

Mark Loizeaux, president of Controlled Demolition, Inc., who was hired for the Building 7 cleanup, said that “molten steel was found at 7 WTC.” Leslie Robertson, World Trade Center structural engineer, stated that on October 5, “21 days after the attacks, the fires were still burning and molten steel was still running.” Fire department personnel, recorded on video, reported seeing “molten steel running down the channel rails… like you’re in a foundry – like lava from a volcano.” Joe O’Toole, a Bronx firefighter, saw a crane lifting a steel beam vertically from deep within a pile. He said “it was dripping from the molten steel.” Bart Voorsanger, an architect hired to save “relics from the rubble,” stated about the multi-ton “meteorite” that it was a “fused element of molten steel and concrete.”

Steel melts at about 2,850 degrees Fahrenheit, about twice the temperature of the World Trade Center Tower 1 and 2 fires as estimated by NIST. So what melted the steel?

Appendix C of FEMA’s BPAT Report documents steel samples showing rapid oxidation, sulfidation, and intergranular melting. A liquid eutectic mixture, including sulfur from an unknown source, caused intense corrosion of the steel, gaping holes in wide flange beams, and the thinning of half-inch-thick flanges to almost razor-sharpness in the World Trade Center 7 steel. The New York Times called this “the deepest mystery uncovered in the investigation.”

NIST left all of this crucial forensic evidence out of its report. Why? Because it didn’t fit in with the official conspiracy theory.

Last year, physicist Steven Jones, two other physicists, and a geologist analyzed the slag at the ends of the beams and in the samples of the previously molten metal. They found iron, aluminum, sulfur, manganese and fluorine – the chemical evidence of thermate, a high-tech incendiary cutting charge used by the military to cut through steel like a hot knife through butter. The by-product of the thermate reaction is molten iron! There’s no other possible source for all the molten iron that was found. One of thermate’s key ingredients is sulfur, which can form the liquid eutectic that FEMA found and lower the melting point of steel.

In addition, World Trade Center 7′s catastrophic structural failure showed every characteristic of explosive, controlled demolition. … The destruction began suddenly at the base of the building. Several first responders reported explosions occurring about a second before the collapse. There was the symmetrical, near-free-fall speed of collapse, through the path of greatest resistance – with 40,000 tons of steel designed to resist this load – straight down into its own footprint. This requires that all the columns have to fail within a fraction of a second of each other – perimeter columns as well as core columns. There was also the appearance of mistimed explosions (squibs?) at the upper seven floors on the network video recordings of the collapse. And we have expert testimony from a European demolitions expert, Danny Jowenko, who said “This is controlled demolition… a team of experts did this… This is professional work, without any doubt.”

Fire cannot produce these effects. Fire produces large, gradual deformations and asymmetrical collapses. Thermate can produce all of these effects used in conjunction with linear shaped charges. If the thermate is formed into ultra-fine particles, as has been accomplished at Los Alamos National Laboratory, it is called super-thermate, and is very explosive.(Richard Gage, January 2008)

The following AE911Truth Video provides irrefutable evidence that the WTC center towers were brought down through controlled demolition.

According to David Ray Griffin: “The official theory of the collapse, therefore, is essentially a fire theory, so it cannot be emphasized too much that fire has never caused large steel-frame buildings to collapse—never, whether before 9/11, or after 9/11, or anywhere in the world on 9/11 except allegedly New York City—never.” (See David Ray Griffin).

According to Architects and Engineers for 9/11 Truth, based on solid scientific analysis and evidence, the collapse of the WTC towers was engineered through controlled demolition. While AE11Truth does not speculate on who might be behind the conspiracy to bring down the WTC buildings, they nonetheless suggest that the carrying out such an operation would require a carefully planned course of action with prior access to the buildings as well as an advanced level of expertise in the use of explosives, etc.

The Collapse of WTC Building Seven

The most grotesque lie pertains to the BBC and CNN announcement in the afternoon of September 11, that WTC Building Seven (The Solomon Building) had collapsed. The BBC report went live at 5.00pm, 21 minutes before the actual occurrence of the collapse, indelibly pointing to foreknowledge of the collapse of WTC 7.  CNN anchor Aaron Brown announced that the building “has either collapsed or is collapsing” about an hour before the event. (See WTC7.net the hidden story of Building 7: Foreknowledge of WTC 7′s Collapse)

The Collapse of WTC Building Seven.

CNN anchor Aaron Brown seems to struggle to make sense of what he is seeing one minute after announcing that WTC Building 7, whose erect facade is clearly visible in his view towards the Trade Center, has or is collapsing.

Coverup and Complicity

The 911 Reader presents factual information and analysis which points to cover-up and complicity at the highest levels of the US government.

This body of articles by prominent authors, scholars, architects, engineers, largely refutes the official narrative of the 9/11 Commission Report, which is reviewed in Part IV. It  dispels the notion that America was attacked on September 11, 2001 on the orders of Osama bin Laden.

This is a central issue because US military doctrine since 9/11 has been predicated on “defending the American Homeland” against Islamic terrorists as well as waging pre-emptive wars against Al Qaeda and its various “state sponsors”.  Afghanistan was bombed and invaded as part of the “war on terrorism”. In March 2003, Iraq was also invaded.

War Propaganda

Fiction prevails over reality. For propaganda to be effective, public opinion must firmly endorse the official 9/11 narrative to the effect that Al Qaeda was behind the attacks. A well organized structure of media disinformation (Part XI) is required to reach this objective. Perpetuating the 9/11 Legend also requires defying as well smearing the 9/11 Truth Movement.

Throughout the post 9/11 era, a panoply of Al Qaeda related events and circumstances is presented to public opinion on a daily basis. These include terrorist threats, warnings and attacks, police investigations, insurgencies and counter-insurgencies, country-level regime change, social conflict, sectarian violence, racism, religious divisions, Islamic thought, Western values, etc.

In turn, 9/11, Al Qaeda – War on Terrorism rhetoric permeates political discourse at all levels of government, including bipartisan debate on Capitol Hill, in committees of the House and the Senate, at the British House of Commons, and, lest we forget, at the United Nations Security Council.

September 11 and Al Qaeda concepts, repeated ad nauseam have potentially traumatic impacts on the human mind and the ability of normal human beings to analyze and comprehend the “real outside World” of war, politics and the economic crisis.

What is at stake is human consciousness and comprehension based on concepts and facts.

With September 11 there are no verifiable “facts” and “concepts”, because 9/11 as well as Al Qaeda have evolved into a media mythology, a legend, an invented ideological construct, used as an unsubtle tool of media disinformation and war propaganda.

Al Qaeda constitutes a stylized, fake and almost folkloric abstraction of terrorism, which permeates the inner consciousness of millions of people around the World.

Reference to Al Qaeda has become a dogma, a belief, which most people espouse unconditionally.

Is this political indoctrination? Is it brain-washing? If so what is the underlying objective?

People’s capacity to independently analyse World events, as well as address causal relationships pertaining to politics and society, is significantly impaired. That is the objective!

The routine use of  9/11 and Al Qaeda to generate blanket explanations of complex political events is meant to create confusion. It prevents people from thinking.

All of these complex Al Qaeda related occurrences are explained –by politicians, the corporate media, Hollywood and the Washington think tanks under a single blanket “bad guys” heading, in which Al Qaeda is casually and repeatedly pinpointed as “the cause” of numerous terror events around the World.

The Alleged Role of Iraq in the 9/11 Attacks

9/11 mythology has been a mainstay of war propaganda. In the course of 2002, leading up to the invasion of Iraq in March 2003,  “Osama bin Laden” and “Weapons of Mass Destruction” statements circulated profusely in the news chain. While Washington’s official position was that Saddam Hussein was not behind the 9/11 attacks, insinuations abounded both in presidential speeches as well as in the Western media. According to Bush,  in an October 2002 press conference:

The threat comes from Iraq. It arises directly from the Iraqi regime’s own actions — its history of aggression, and its drive toward an arsenal of terror. .,..  We also must never forget the most vivid events of recent history. On September the 11th, 2001, America felt its vulnerability — even to threats that gather on the other side of the earth. We resolved then, and we are resolved today, to confront every threat, from any source [Iraq], that could bring sudden terror and suffering to America. President Bush Outlines Iraqi Threat, October 7, 2002)

Barely two weeks before the invasion of Iraq, September 11, 2001 was mentioned abundantly by president Bush. In the weeks leading up to the March invasion, 45 percent of  Americans believed Saddam Hussein was “personally involved” in the Sept. 11, 2001 attacks. (See . The impact of Bush linking 9/11 and Iraq / The Christian Science Monitor – CSMonitor.com, March 14, 2003)

Meanwhile, a new terrorist mastermind had emerged: Abu Musab Al-Zarqawi.

In Colin Powell’s historic address to the United Nations Security Council, in February 2003, detailed “documentation” on a sinister relationship between Saddam Hussein and Abu Musab Al-Zarqawi was presented, focussing on his ability to produce deadly chemical, biological and radiological weapons, with the full support and endorsement of the secular Baathist regime. The implication of Colin’s Powell’s assertions, which were totally fabricated, was that Saddam Hussein and an Al Qaeda affiliated organization had joined hands in the production of WMD in Northern Iraq and that the Hussein government was a “state sponsor” of terrorism.

The main thrust of the disinformation campaign continued in the wake of the March 2003 US-led invasion of Iraq. It consisted in presenting the Iraqi resistance movement as “terrorists”. The image of “terrorists opposed to democracy” fighting US “peacekeepers” appeared on television screens and news tabloids across the globe.

Iran: Alleged State Sponsor of 9/11

In the wake of the Iraq invasion, the same alleged “state sponsorship” of terrorism accusations emerged in relation to Iran.

In December 2011, the Islamic Republic of Iran was condemned by a Manhattan court, for its alleged role in supporting Al Qaeda in the 9/11 attacks.

The investigation into Tehran’s alleged role was launched in 2004, pursuant to a recommendation of the 9/11 Commission “regarding an apparent link between Iran, Hezbollah, and the 9/11 hijackers”. The 91/11 Commission’s recommendation was that the this “apparent link” required  “further investigation by the U.S. government.” (9/11 Commission Report , p. 241). (See Iran 911 Case ).

In the December 2011 court judgment (Havlish v. Iran)  “U.S. District Judge George B. Daniels ruled  that Iran and Hezbollah materially and directly supported al Qaeda in the September 11, 2001 attacks and are legally responsible for damages to hundreds of family members of 9/11 victims who are plaintiffs in the case”.

According to the plaintiffs attorneys “Iran, Hezbollah, and al Qaeda formed a terror alliance in the early 1990s. Citing their national security and intelligence experts, the attorneys explained “how the pragmatic terror leaders overcame the Sunni-Shi’a divide in order to confront the U.S. (the “Great Satan”) and Israel (the “Lesser Satan”)”. Iran and Hezbollah allegedly provided “training to members of al Qaeda in, among other things, the use of explosives to destroy large buildings.” (See Iran 911 Case ).

This judicial procedure is nothing more than another vicious weapon in the fabricated “War on Terror” to be used against another Muslim country, with a view to destabilizing Iran as well as justifying ongoing military threats. It also says a lot more about the people behind the lawsuit than about the accused. The expert witnesses who testified against Iran are very active in warmongering neocon circles. They belong to a web of architects of the 21st century Middle-Eastern wars, ranging from high profile propagandists to intelligence and military officers, including former U.S. officials.

But what makes this case absurd is that in September 2011, a few months before the judgment, Iranian President Mahmoud Ahmadinejad, who has questioned the official 9/11 narrative, was accused by Al-Qaeda leaders of  “spreading conspiracy theories about the 9/11 attacks”. The semi-official media outlet of Al Qaeda in the Arabian Peninsula, insisted that al-Qaeda “had been behind the attacks and criticised the Iranian president for discrediting the terrorist group.” (See Julie Levesque, Iran Accused of being behind 9/11 Attacks. U.S. Court Judgment, December 2011 (Havlish v. Iran), Global Research,  May 11, 2012)

Al Qaeda: US-NATO Foot-soldiers

Ironically, while Washington accuses Iran and Afghanistan of supporting terrorism, the historical record and evidence indelibly point to the “state sponsorship” of Al Qaeda by the CIA, MI6 and their counterparts in Pakistan, Qatar and Saudi Arabia.

Al Qaeda death squads have been recruited to wage America’s humanitarian wars throughout the Middle East and North Africa.

In Syria Al Qaeda units were recruited by NATO and the Turkish High command: “Also discussed in Brussels and Ankara, our sources report, is a campaign to enlist thousands of Muslim volunteers in Middle East countries and the Muslim world to fight alongside the Syrian rebels.” (http://www.debka.com/article/21255/  Debkafile, August 31, 2011).

In Libya, jihadists from Afghanistan trained by the CIA were dispatched to fight with the “pro-democracy” rebels under the helm of “former” Libya Islamic Fighting Group (LIFG) Commander Abdel Hakim Belhadj:

Western policy makers admit that NATO’s operations in Libya have played the primary role in emboldening Al Qaeda’s AQIM faction (Al Qaeda in the Islamic Maghreb). The Fortune 500-funded Brookings Institution’s Bruce Riedel in his article, “The New Al Qaeda Menace,” admits that AQIM is now heavily armed thanks to NATO’s intervention in Libya, and that AQIM’s base in Mali, North Africa, serves as a staging ground for terrorist activities across the region. http://www.globalresearch.ca/al-qaeda-and-natos-pan-arab-terrorist-blitzkrieg/

Table of Contents of the 9/11 Reader

In Part I, the 911 Reader provides a review of what happened on the morning of 9/11, at the White House, on Capitol Hill, the Pentagon, at Strategic Command Headquarters (USSTRATCOM), What was the response of the US Air Force in the immediate wake of the attacks?  Part II focusses on “What Happened on the Planes” as described in the 9/11 Commission Report.

Part III sheds light on what caused the collapse of the World Trade Center buildings. It also challenges the official narrative with regard to the attack on the Pentagon.

Part IV reviews and refutes the findings of the 9/11 Commission Report.

Part V focusses on the issue of foreknowledge by Western intelligence agencies. Part VI examines the issue of how foreknowledge of the attacks was used as an instrument of insider trading on airline stocks in the days preceding September 11, 2001. The bonanza financial gains resulting from insurance claims to the leaseholders of the WTC buildings is also examined.

Part VII focusses on the history and central role of Al Qaeda as a US intelligence asset. Since the Soviet-Afghan war, US intelligence has supported the formation of various jihadist organizations. An understanding of this history is crucial in refuting the official 9/11 narrative which claims that Al Qaeda, was behind the attacks.

Part VIII centers on the life and death of 9/11 “Terror Mastermind” Osama bin Laden, who was recruited by the CIA in the heyday of the Soviet Afghan war. This section also includes an analysis of the mysterious death of Osama bin Laden, allegedly executed by US Navy Seals in a suburb of Islamabad in May 2011.

Part  IX  focusses on “False Flags” and the Pentagon’s “Second 9/11″. Part X examines the issue of “Deep Events” with contributions by renowned scholars Peter Dale Scott and Daniele Ganser.

Part XI  examines the structure of 9/11 propaganda which consists in “creating” as well “perpetuating” a  “9/11 Legend”. How is this achieved? Incessantly, on a daily basis, Al Qaeda, the alleged 9/11 Mastermind is referred to by the Western media, government officials, members of the US Congress, Wall Street analysts, etc. as an underlying cause of numerous World events.

Part XII focusses on the practice of 9/11 Justice directed against the alleged culprits of the 9/11 attacks.

The legitimacy of 9/11 propaganda requires fabricating “convincing evidence” and “proof” that those who are accused actually carried out the attacks. Sentencing of Muslims detained in Guantanamo is part of war propaganda. It depicts innocent men who are accused of the 9/11 attacks, based on confessions acquired through systematic torture throughout their detention.

Part  XIII focusses on 9/11 Truth.  The objective of 9/11 Truth is to ultimately dismantle the propaganda apparatus which is manipulating the human mindset. The 9/11 Reader concludes with a retrospective view of 9/11 ten years later.


PART  I

Timeline: What Happened on the Morning of September 11, 2001

Nothing Urgent: The Curious Lack of Military Action on the Morning of September. 11, 2001
- by George Szamuely – 2012-08-12
Political Deception: The Missing Link behind 9-11
- by Michel Chossudovsky – 2002-06-20
On the morning of September 11, Pakistan’s Chief Spy General Mahmoud Ahmad, the alleged “money-man” behind the 9-11 hijackers, was at a breakfast meeting on Capitol Hill hosted by Senator Bob Graham and Rep. Porter Goss, the chairmen of the Senate and House Intelligence committees.
9/11 Contradictions: Bush in the Classroom
- by Dr. David Ray Griffin – 2008-04-04
9/11 Contradictions: When Did Cheney Enter the Underground Bunker?
- by David Ray Griffin – 2008-04-24
VIDEO: Pilots For 9/11 Truth: Intercepted
Don’t miss this important documentary, now on GRTV
- 2012-05-16

PART II

What Happened on the Planes

“United 93″: What Happened on the Planes?
- by Michel Chossudovsky – 2006-05-01
  Phone Calls from the 9/11 Airliners
Response to Questions Evoked by My Fifth Estate Interview
- by Prof David Ray Griffin – 2010-01-12
Given the cell phone technology available in 2001, cell phone calls from airliners at altitudes of more than a few thousand feet, were virtually impossible
Ted Olson’s Report of Phone Calls from Barbara Olson on 9/11: Three Official Denials
- by David Ray Griffin – 2008-04-01
Ted Olson’s report was very important. It provided apparent “evidence” that American 77 had struck the Pentagon.

 

PART III

What Caused the Collapse of

The WTC Buildings and the Pentagon?

The Destruction of the World Trade Center: Why the Official Account Cannot Be True
- by Dr. David Ray Griffin – 2006-01-29
The official theory about the Twin Towers says that they collapsed because of the combined effect of the impact of the airplanes and the resulting fires
Evidence Refutes the Official 9/11 Investigation: The Scientific Forensic Facts
- by Richard Gage, Gregg Roberts – 2010-10-13
VIDEO: Controlled Demolitions Caused the Collapse of the World Trade Center (WTC) buildings on September 11, 2001
- by Richard Gage – 2009-09-20
VIDEO: 9/11: The Myth and The Reality
Now on GRTV
- by Prof. David Ray Griffin – 2011-08-30
Undisputed Facts Point to the Controlled Demolition of WTC 7
- by Richard Gage – 2008-03-28
VIDEO: 9/11 Explosive Evidence: Experts Speak Out
See the trailer for this ground-breaking film on GRTV
- 2011-08-03
9/11: “Honest Mistake” or BBC Foreknowledge of Collapse of WTC 7? Jane Standley Breaks Her Silence
- by James Higham – 2011-08-18
The Collapse of WTC Building Seven.
Interview. Comment by Elizabeth Woodworth
- by David Ray Griffin – 2009-10-17
  Building What? How SCADs Can Be Hidden in Plain Sight: The 9/11 “Official Story” and the Collapse of WTC Building Seven
- by Prof David Ray Griffin – 2010-05-30
Besides omitting and otherwise falsifying evidence, NIST also committed the type of scientific fraud called fabrication, which means simply “making up results.”
VIDEO; Firefighters’ Analysis of the 9/11 Attacks Refutes the Official Report
- by Erik Lawyer – 2012-08-27
VIDEO: Pentagon Admits More 9/11 Remains Dumped in Landfill
- by James Corbett – 2012-03-01
The Pentagon revealed that some of the unidentifiable remains from victims at the Pentagon and Shanksville sites on September 11, 2001 were disposed of in a landfill.
9/11: The Attack on the Pentagon on September 11, 2001
The Official Version Amounts to an Enormous Lie
- by Thierry Meyssan – 2012-08-16

PART IV

Lies and Fabrications: The 9/11 Commission Report

A National Disgrace: A Review of the 9/11 Commission Report
- by David Ray Griffin – 2005-03-24
The 9/11 Commission Report: A 571 Page Lie
- by Dr. David Ray Griffin – 2005-09-08
September 11, 2001: 21 Reasons to Question the Official Story about 9/11
- by David Ray Griffin – 2008-09-11
911 “Conspiracy Theorists” Vindicated: Pentagon deliberately misled Public Opinion
Military officials made false statements to Congress and to the 911 Commission
- by Michel Chossudovsky – 2006-08-02
The 9/11 Commission’s Incredible Tales
Flights 11, 175, 77, and 93
- by Prof. David Ray Griffin – 2005-12-13
9/11 and the War on Terror: Polls Show What People Think 10 Years Later
- by Washington’s Blog – 2011-09-10

PART  V

Foreknowledge of 9/11

  VIDEO: The SECRET SERVICE ON 9/11: What did the Government Know?
Learn more on this week’s GRTV Feature Interview
- by Kevin Ryan, James Corbett – 2012-04-10
9/11 Foreknowledge and “Intelligence Failures”: “Revealing the Lies” on 9/11 Perpetuates the “Big Lie”
- by Prof. Michel Chossudovsky – 2011-09-14
“Foreknowledge” and “Failure to act” upholds the notion that the terrorist attacks (“act of war”) “waged by Muslims against America” are real, when all the facts and findings point towards coverup and complicity at the highest levels of the US government.
Foreknowledge of 9/11 by Western Intelligence Agencies
- by Michael C. Ruppert – 2012-08-21

PART VI

Insider Trading and the 9/11 Financial Bonanza

9/11 Attacks: Criminal Foreknowledge and Insider Trading lead directly to the CIA’s Highest Ranks
CIA Executive Director “Buzzy” Krongard managed Firm that handled “Put” Options on UAL
- by Michael C. Ruppert – 2012-08-13
The 9/11 Attacks on the World Trade Center (WTC): Unspoken Financial Bonanza
- by Prof Michel Chossudovsky – 2012-04-27
SEPTEMBER 11, 2001: Insider Trading 9/11 … the Facts Laid Bare
- by Lars Schall – 2012-03-20
Osama Bin Laden and The 911 Illusion: The 9/11 Short-Selling Financial Scam
- by Dean Henderson – 2011-05-09

PART VII

9/11 and the “Global War on Terrorism” (GWOT)

Political Deception: The Missing Link behind 9-11
- by Michel Chossudovsky – 2002-06-20
On the morning of September 11, Pakistan’s Chief Spy General Mahmoud Ahmad, the alleged “money-man” behind the 9-11 hijackers, was at a breakfast meeting on Capitol Hill hosted by Senator Bob Graham and Rep. Porter Goss, the chairmen of the Senate and House Intelligence committees.
9/11 ANALYSIS: From Ronald Reagan and the Soviet-Afghan War to George W Bush and September 11, 2001
- by Michel Chossudovsky – 2010-09-09
Osama bin Laden was recruited by the CIA in 1979. The US spent millions of dollars to supply Afghan schoolchildren with textbooks filled with violent images and militant Islamic teachings.

 

  The Central Role of Al Qaeda in Bush’s National Security Doctrine
“Revealing the Lies” on 9/11 Perpetuates the “Big Lie”
- by Michel Chossudovsky – 2007-07-12
NATO’s Doctrine of Collective Security
- by Michel Chossudovsky – 2009-12-21
- by Michel Chossudovsky – 2010-08-30
What is now unfolding is a generalized process of demonization of an entire population group
Osamagate
- by Michel Chossudovsky – 2001-10-09
The main justification for waging this war has been totally fabricated. The American people have been deliberately and consciously misled by their government into supporting a major military adventure which affects our collective future.
The “Demonization” of Muslims and the Battle for Oil
- by Michel Chossudovsky – 2007-01-04
Muslim countries possess three quarters of the World’s oil reserves. In contrast, the United States of America has barely 2 percent of total oil reserves.
  Was America Attacked by Muslims on 9/11?
- by David Ray Griffin – 2008-09-10
Much of US foreign policy since 9/11 has been based on the assumption that America was attacked by Muslims on 9/11.
  New Documents Detail America’s Strategic Response to 9/11
Rumsfeld’s War Aim: “Significantly Change the World’s Political Map”
- by National Security Archive – 2011-09-12

PART VIII

The Alleged 9/11 Mastermind:

The Life and Death of  Osama bin Laden

Who Is Osama Bin Laden?
- by Michel Chossudovsky – 2001-09-12
  VIDEO: The Last Word on Osama Bin Laden
- by James Corbett – 2011-05-24
Osama bin Laden: A Creation of the CIA
- by Michel Chossudovsky – 2011-05-03
Interview with Osama bin Laden. Denies his Involvement in 9/11
Full text of Pakistani paper’s Sept 01 “exclusive” interview
- 2011-05-09
Where was Osama on September 11, 2001?
- by Michel Chossudovsky – 2008-09-11
On September 10. 2001, Osama was in a Pakistan military hospital in Rawalpindi, courtesy of America’s indefectible ally Pakistan
Osama bin Laden, among the FBI’s “Ten Most Wanted Fugitives”: Why was he never indicted for his alleged role in 9/11?
- by Michel Chossudovsky – 2006-09-17
Osama bin Laden: Already Dead… Evidence that Bin Laden has been Dead for Several Years
- by Prof. David Ray Griffin – 2011-05-02
The Mysterious Death of Osama bin Laden: Creating Evidence Where There Is None
- by Dr. Paul Craig Roberts – 2011-08-04
The Assassination of Osama bin Laden: Glaring Anomalies in the Official Narrative
Osama was Left Handed…
- by Felicity Arbuthnot – 2011-05-11
The Assassination of Osama Bin Laden
- by Fidel Castro Ruz – 2011-05-07
Dancing on the Grave of 9/11. Osama and “The Big Lie”
- by Larry Chin – 2011-05-05

PART  IX

 ”False Flags”: The Pentagon’s Second 9/11

The Pentagon’s “Second 911″
“Another [9/11] attack could create both a justification and an opportunity to retaliate against some known targets”
- by Michel Chossudovsky – 2006-08-10
The presumption of this military document, is that a Second 911 attack “which is lacking today” would usefully create both a “justification and an opportunity” to wage war on “some known targets
Crying Wolf: Terror Alerts based on Fabricated Intelligence
- by Michel Chossudovsky – 2006-08-20
This is not the first time that brash and unsubstantiated statements have been made regarding an impending terror attack, which have proven to be based on “faulty intelligence”.

PART X

“Deep Events” and State Violence

The Doomsday Project and Deep Events: JFK, Watergate, Iran-Contra, and 9/11
- by Prof. Peter Dale Scott – 2011-11-22
The Doomsday Project is the Pentagon’s name for the emergency planning “to keep the White House and Pentagon running during and after a nuclear war or some other major crisis.”
JFK and 9/11
Insights Gained from Studying Both
- by Dr. Peter Dale Scott – 2006-12-20
In both 9/11 and the JFK assassination, the US government and the media immediately established a guilty party. Eventually, in both cases a commission was set up to validate the official narrative.
Able Danger adds twist to 9/11
9/11 Ringleader connected to secret Pentagon operation
- by Dr. Daniele Ganser – 2005-08-27
Atta was connected to a secret operation of the Pentagon’s Special Operations Command (SOCOM) in the US. A top secret Pentagon project code-named Able Danger identified Atta and 3 other 9/11 hijackers as members of an al-Qaida cell more than a year before the attacks.
9/11, Deep State Violence and the Hope of Internet Politics
- by Prof. Peter Dale Scott – 2008-06-11
The unthinkable – that elements inside the state would conspire with criminals to kill innocent civilians – has become thinkable…
Al Qaeda: The Database.
- by Pierre-Henri Bunel – 2011-05-12

PART XI

Propaganda: Creating and Perpetuating the 9/11 Legend

September 11, 2001: The Propaganda Preparation for 9/11: Creating the Osama bin Laden “Legend”
- by Chaim Kupferberg – 2011-09-11
THE 9/11 MYTH: State Propaganda, Historical Revisionism, and the Perpetuation of the 9/11 Myth
- by Prof. James F. Tracy – 2012-05-06
  Al Qaeda and Human Consciousness: Al Qaeda, Al Qaeda…. An Incessant and Repetitive Public Discourse
- by Prof. Michel Chossudovsky – 2012-03-24
9/11 Truth, Inner Consciousness and the “Public Mind”
- by James F. Tracy – 2012-03-18

PART XII

Post 9/11 “Justice”

IRAN ACCUSED OF BEING BEHIND 9/11 ATTACKS.
U.S. Court Judgment, December 2011 (Havlish v. Iran)
- by Julie Lévesque – 2012-05-11
U.S. Court Judgment, December 2011 (Havlish v. Iran)
American Justice”: The Targeted Assassination of Osama Bin Laden
Extrajudicial executions are unlawful
- by Prof. Marjorie Cohn – 2011-05-10
ALLEGED “MASTERMIND” OF 9/11 ON TRIAL IN GUANTANAMO: Military Tribunals proceed Despite Evidence of Torture
- by Tom Carter – 2012-05-30
Self-confessed 9/11 “mastermind” falsely confessed to crimes he didn’t commit
- by Washington’s Blog – 2012-07-15
911 MILITARY TRIAL: Pentagon Clears Way for Military Trial of Five charged in 9/11 Attacks
- by Bill Van Auken – 2012-04-06
Khalid Sheikh Mohammed’s trial will convict us all
- by Paul Craig Roberts – 2009-11-25

PART XIII

9/11 Truth

Revealing the Lies,  Commemorating the 9/11 Tragedy

VIDEO: Commemorating the 10th Anniversary of 9/11
- by Prof. Michel Chossudovsky – 2011-09-01
VIDEO: AFTER 9/11: TEN YEARS OF WAR
Special GRTV Feature Production
- by James Corbett – 2011-09-08

*   *  *

Read about 9/11 in Michel Chossudovsky’s international best-seller America’s “War on Terrorism”

According to Chossudovsky, the  “war on terrorism” is a complete fabrication based on the illusion that one man, Osama bin Laden, outwitted the $40 billion-a-year American intelligence apparatus. The “war on terrorism” is a war of conquest. Globalisation is the final march to the “New World Order”, dominated by Wall Street and the U.S. military-industrial complex.

Order Directly from Global Research

America's War on Terrorism

Salafism and the CIA: Destabilizing the Russian Federation?

September 14th, 2012 by F. William Engdahl

Part I: Syria comes to the Russian Caucasus

On August 28 Sheikh Said Afandi, acknowledged spiritual leader of the Autonomous Russian Republic of Dagestan, was assassinated. A jihadist female suicide bomber managed to enter his house and detonate an explosive device.

The murder target had been carefully selected. Sheikh Afandi, a seventy-five-year old Sufi Muslim leader, had played the critical role in attempting to bring about reconciliation in Dagestan between jihadist Salafi Sunni Muslims and other factions, many of whom in Dagestan see themselves as followers of Sufi. With no replacement of his moral stature and respect visible, authorities fear possible outbreak of religious war in the tiny Russian autonomous republic.[1]

The police reported that the assassin was an ethnic Russian woman who had converted to Islam and was linked to an Islamic fundamentalist or Salafist insurgency against Russia and regional governments loyal to Moscow in the autonomous republics and across the volatile Muslim-populated North Caucasus region.

Ethnic Muslim populations in this region of Russia and of the former Soviet Union, including Uzbekistan, Kyrgystan and into China’s Xinjiang Province, have been the target of various US and NATO intelligence operations since the Cold War era ended in 1990. Washington sees manipulation of Muslim groups as the vehicle to bring uncontrollable chaos to Russia and Central Asia. It’s being carried out by some of the same organizations engaged in creating chaos and destruction inside Syria against the government of Bashar Al-Assad. In a real sense, as Russian security services clearly understand, if they don’t succeed in stopping the Jihadists insurgency in Syria, it will come home to them via the Caucasus.

The latest Salafist murders of Sufi and other moderate Muslim leaders in the Caucasus are apparently part of what is becoming ever clearer as perhaps the most dangerous US intelligence operation ever—playing globally with Muslim fundamentalism.

Previously US and allied intelligence services had played fast and loose with religious organizations or beliefs in one or another country. What makes the present situation particularly dangerous—notably since the decision in Washington to unleash the misnamed Arab Spring upheavals that began in Tunisia late 2010, spreading like a brushfire across the entire Islamic world from Afghanistan across Central Asia to Morocco—is the incalculable wave upon wave of killing, hatreds, destruction of entire cultures that Washington has unleashed in the name of that elusive dream named “democracy.” They do this using alleged Al-Qaeda groups, Saudi Salafists or Wahhabites, or using disciples of Turkey’s Fethullah Gülen Movement to ignite fires of religious hatred within Islam and against other faiths that could take decades to extinguish. It could easily spill over into a new World War.

Fundamentalism comes to Caucasus

Following the dissolution of the USSR, radical Afghanistani Mujahadeen, Islamists from Saudi Arabia, from Turkey, Pakistan and other Islamic countries flooded into the Muslim regions of the former USSR. One of the best-organized of these was the Gülen Movement of Fethullah Gülen, leader of a global network of Islamic schools and reported to be the major policy influence on Turkey’s Erdogan AKP party.

Gülen was quick to establish The International Dagestani-Turkish College in Dagestan. During the chaotic days after the Soviet collapse, the Ministry of Justice of the Russian Federation officially registered and permitted unfettered activity for a variety of Islamic foundations and organizations. These included the League of the Islamic World, the World Muslim Youth Assembly, the reportedly Al-Qaeda friendly Saudi foundation ‘Ibrahim ben Abd al-Aziz al-Ibrahim.’ The blacklist also included Al-Haramein a Saudi foundation reported tied to Al-Qaeda, and IHH, [2] a Turkish organization banned in Germany, that allegedly raised funds for jihadi fighters in Bosnia, Chechnya, and Afghanistan, and was charged by French intelligence of ties to Al Qaeda.[3] Many of these charities were covers for fundamentalist Salafists with their own special agenda.

As many of the foreign Islamists in Chechnya and Dagestan were found involved in fomenting the regional unrest and civil war, Russian authorities withdrew permission of most to run schools and institutions. Throughout the North Caucasus at the time of the Chechyn war in the late 1990’s, there were more than two dozen Islamic institutes, some 200 madrassas and numerous maktabas (Koranic study schools) present at almost all mosques.

The International Dagestani-Turkish College was one that was forced to close its doors in Dagestan. The College was run by the Fethullah Gülen organization.[4]

At the point of the Russian crackdown on the spread of Salafist teaching inside Russia at the end of the 1990’s, there was an exodus of hundreds of young Dagestani and Chechyn Muslim students to Turkey, Saudi Arabia, Pakistan and other places in The Middle east, reportedly to receive training with the Gülen movement and various Saudi-financed organizations, including Salafists. [5] It is believed in Russia that the students trained by Gülen supporters or Saudi and other Salafist fundamentalist centers then were sent back to Dagestan and the North Caucasus to spread their radical strain of Islam.

By 2005 the situation in the Caucasus was so influenced by this Salafist intervention that the Chechen Salafist, Doku Umarov, cited by the UN Security Council for links to Al-Qaeda,[6] unilaterally declared creation of what he called the Caucasus Emirate, announcing he planned to establish an Islamic state under Sharia law encompassing the entire North Caucasus region including Dagestan. He modestly proclaimed himself Emir of the Caucasus Emirate. [7]

*  *  *

WWIII Scenario

*  *  *

 

Part II: Salafism at war with Sufi tradition

Salafism, known in Saudi Arabia as Wahhabism, is a fundamentalist strain of Islam which drew world attention and became notorious in March 2001 just weeks before the attacks of September 11. That was when the Salafist Taliban government in Afghanistan willfully dynamited and destroyed the historic gigantic Buddhas of Bamiyan on the ancient Silk Road, religious statues dating from the 6th Century. The Taliban Salafist leaders also banned as “un-islamic” all forms of imagery, music and sports, including television, in accordance with what they considered a strict interpretation of Sharia.

Afghani sources reported that the order to destroy the Buddhas was made by Saudi-born jihadist Wahhabite, Osama bin Laden, who ultimately convinced Mullah Omar, Taliban supreme leader at the time to execute the act.[8]

Before and…After Salafist Taliban …

While Sufis incorporate the worship of saints and theatrical ceremonial prayers into their practice, Salafis condemn as idolatry any non-traditional forms of worship. They also call for the establishment of Islamic political rule and strict Sharia law. Sufism is home to the great spiritual and musical heritage of Islam, said by Islamic scholars to be the inner, mystical, or psycho-spiritual dimension of Islam, going back centuries.

As one Sufi scholar described the core of Sufism, “While all Muslims believe that they are on the pathway to God and will become close to God in Paradise–after death and the ‘Final Judgment’– Sufis believe as well that it is possible to become close to God and to experience this closeness–while one is alive. Furthermore, the attainment of the knowledge that comes with such intimacy with God, Sufis assert, is the very purpose of the creation. Here they mention the hadith qudsi in which God states, ‘I was a hidden treasure and I loved that I be known, so I created the creation in order to be known.’ Hence for the Sufis there is already a momentum, a continuous attraction on their hearts exerted by God, pulling them, in love, towards God.” [9]

The mystical Islamic current of Sufism and its striving to become close to or one with God is in stark contrast to the Jihadist Salafi or Wahhabi current that is armed with deadly weapons, preaches a false doctrine of jihad, and a perverse sense of martyrdom, committing countless acts of violence. Little wonder that the victims of Salafist Jihads are mostly other pacific forms of Islam including most especially Sufis.

The respected seventy-five year old Afandi had publicly denounced Salafist Islamic fundamentalism. His murder followed a July 19 coordinated attack on two high-ranking muftis in the Russian Volga Republic of Tatarstan. Both victims were state-approved religious leaders who had attacked radical Islam. This latest round of murders opens a new front in the Salafist war against Russia, namely attacks on moderate Sufi Muslim leaders.

Whether or not Dagestan now descends into internal religious civil war that then spreads across the geopolitically sensitive Russian Caucasus is not yet certain. What is almost certain is that the same circles who have been feeding violence and terror inside Syria against the regime of Alawite President Bashar al-Assad are behind the killing of Sheikh Afandi as well as sparking related acts of terror or unrest across Russia’s Muslim-populated Caucasus. In a very real sense it represents Russia’s nightmare scenario of “Syria coming to Russia.” It demonstrates dramatically why Putin has made such a determined effort to stop a descent into a murderous hell in Syria.

Salafism and the CIA

The existence of the so-called jihadist Salafi brand of Islam in Dagestan is quite recent. It has also been deliberately imported. Salafism is sometimes also called the name of the older Saudi-centered Wahhabism. Wahhabism is a minority originally-Bedouin form of the faith originating within Islam, dominant in Saudi Arabia since the 1700’s.

Irfan Al-Alawi and Stephen Schwartz of the Centre for Islamic Pluralism give the following description of Saudi conditions under the rigid Wahhabi brand of Islam:

Women living under Saudi rule must wear the abaya, or total body cloak, and niqab, the face veil; they have limited opportunities for schooling and careers; they are prohibited from driving vehicles; are banned from social contact with men not relatives, and all personal activity must be supervised including opening bank accounts, by a male family member or “guardian.” These Wahhabi rules are enforced by a mutawiyin, or morals militia, also known as “the religious police,” officially designated the Commission for the Promotion of Virtue and Prevention of Vice (CPVPV) who patrol Saudi cities, armed with leather-covered sticks which they freely used against those they considered wayward. They raid homes looking for alcohol and drugs, and harassed non-Wahhabi Muslims as well as believers in other faiths.” [10]

It’s widely reported that the obscenely opulent and morally-perhaps-not-entirely-of- the-highest-standards Saudi Royal Family made a Faustian deal with Wahhabite leaders. The deal supposedly, was that the Wahhabists are free to export their fanatical brand of Islam around to the Islamic populations of the world in return for agreeing to leave the Saudi Royals alone.[11] There are, however, other dark and dirty spoons stirring the Wahhabite-Salafist Saudi stew.

Little known is the fact that the present form of aggressive Saudi Wahhabism, in reality a kind of fusion between imported jihadi Salafists from Egypt’s Muslim Brotherhood and the fundamentalist Saudi Wahhabites. Leading Salafist members of the Egyptian Muslim Brotherhood were introduced into the Saudi Kingdom in the 1950’s by the CIA in a complex series of events, when Nasser cracked down on the Muslim Brotherhood following an assassination attempt. By the 1960’s an influx of Egyptian members of the Muslim Brotherhood in Saudi Arabia fleeing Nasserite repression, had filled many of the leading teaching posts in Saudi religious schools. One student there was a young well-to-do Saudi, Osama bin Laden.  [12]

During the Third Reich, Hitler Germany had supported the Muslim Brotherhood as a weapon against the British in Egypt and elsewhere in the Middle East. Marc Erikson describes the Nazi roots of the Egyptian Muslim Brotherhood thus:

…as Italian and German fascism sought greater stakes in the Middle East in the 1930s and ’40s to counter British and French controlling power, close collaboration between fascist agents and Islamist leaders ensued. During the 1936-39 Arab Revolt, Admiral Wilhelm Canaris, head of German military intelligence, sent agents and money to support the Palestine uprising against the British, as did Muslim Brotherhood founder and “supreme guide” Hassan al-Banna. A key individual in the fascist-Islamist nexus and go-between for the Nazis and al-Banna became the Grand Mufti of Jerusalem, Haj Amin el-Husseini.[13]

After the defeat of Germany, British Intelligence moved in to take over control of the Muslim Brotherhood. Ultimately, for financial and other reasons, the British decided to hand their assets within the Muslim Brotherhood over to their CIA colleagues in the 1950s. [14]

According to former US Justice Department Nazi researcher John Loftus,  “during the 1950s, the CIA evacuated the Nazis of the Muslim Brotherhood to Saudi Arabia. Now, when they arrived in Saudi Arabia, some of the leading lights of the Muslim Brotherhood, like Dr Abdullah Azzam, became the teachers in the madrassas, the religious schools. And there they combined the doctrines of Nazism with this weird Islamic cult, Wahhabism.” [15]

“Everyone thinks that Islam is this fanatical religion, but it is not,” Loftus continues. “They think that Islam–the Saudi version of Islam–is typical, but it’s not. The Wahhabi cult has been condemned as a heresy more than 60 times by the Muslim nations. But when the Saudis got wealthy, they bought a lot of silence. This is a very harsh cult. Wahhabism was only practised by the Taliban and in Saudi Arabia–that’s how extreme it is. It really has nothing to do with Islam. Islam is a very peaceful and tolerant religion. It always had good relationships with the Jews for the first thousand years of its existence.” [16]

Loftus identified the significance of what today is emerging from the shadows to take over Egypt under Muslim Brotherhood President Morsi, and the so-called Syrian National Council, dominated in reality by the Muslim Brotherhood and publicly led by the more “politically correct” or presentable likes of Bassma Kodmani. Kodmani, foreign affairs spokesman for the SNC was twice an invited guest at the Bilderberg elite gathering, latest in Chantilly, Virginia earlier this year.[17]

The most bizarre and alarming feature of the US-financed  regime changes set into motion in 2010, which have led to the destruction of the secular Arab regime of Hosni Mubarak in Egypt and Muhammar Qaddafi in Libya, and the secular regime of President Ben Ali in Tunisia, and which have wreaked savage destruction across the Middle East, especially in the past eighteen months in Syria, is the pattern of emerging power grabs by representatives of the murky Salafist Muslim Brotherhood.

By informed accounts, a Saudi-financed Sunni Islamic Muslim Brotherhood dominates the members of the exile Syrian National Council that is backed by the US State Department’s Secretary Clinton and by Hollande’s France. The Syrian Muslim Brotherhood is tied, not surprisingly to the Egyptian Muslim Brotherhood of President Mohammed Morsi who recently in a meeting of the Non-Aligned in Iran called openly for the removal of Syria’s Assad, a logical step if his Muslim Brothers in the present Syrian National Council are to take the reins of power. The Saudis are also rumored to have financed the ascent to power in Tunisia of the governing Islamist Ennahda Party,[18] and are documented to be financing the Muslim Brotherhood-dominated Syrian National Council against President Bashar al-Assad. [19]

Part III: Morsi’s Reign of Salafi Terror

Indicative of the true agenda of this Muslim Brotherhood and related jihadists today is the fact that once they have power, they drop the veil of moderation and reconciliation and reveal their violently intolerant roots. This is visible in Egypt today under Muslim Brotherhood President Mohammed Morsi.

Unreported in mainstream Western media to date are alarming direct reports from Christian missionary organizations in Egypt that Morsi’s Muslim Brotherhood has already begun to drop the veil of “moderation and conciliation” and show its brutal totalitarian Salafist colors, much as Khomeini’s radical Sharia forces did in Iran after taking control in 1979-81.

In a letter distributed by the Christian Aid Mission (CAM), a Christian Egyptian missionary wrote that Morsi’s Muslim Brotherhood “announced they would destroy the country if Morsi didn’t win, but they also said they will take revenge from all those who voted for [his opponent Ahmed] Shafiq, especially the Christians as they are sure we did vote for Shafiq. Yesterday they began by killing two believers in el Sharqiya because of this,” the missionary added, speaking on condition of anonymity.[20]

This report came only weeks after Egyptian State TV (under Morsi’s control) showed ghastly video footage of a convert from Islam to Christianity being murdered by Muslims. The footage showed a young man being held down by masked men with a knife to his throat. As one man was heard chanting Muslim prayers in Arabic, mostly condemning Christianity, another man holding the knife to the Christian convert’s throat began to cut, slowly severing the head amid cries of “Allahu Akbar” (“Allah is great”), according to transcripts. In the letter, the Egyptian missionary leader added that, “soon after Morsi won, Christians in upper Egypt were forcibly prevented from going to churches.” Many Muslims, the letter claimed, “also began to speak to women in the streets that they had to wear Islamic clothing including the head covering. They act as if they got the country for their own, it’s theirs now.” [21]

Already in 2011 Morsi’s Salafist followers began attacking and destroying Sufi mosques across Egypt. According to the authoritative newspaper Al-Masry Al-Youm (Today’s Egyptian), 16 historic mosques in Alexandria belonging to Sufi orders have been marked for destruction by so-called ‘Salafis’. Alexandria has 40 mosques associated with Sufis, and is the headquarters for 36 Sufi groups. Half a million Sufis live in the city, out of a municipal total of four million people. Aggression against the Sufis in Egypt has included a raid on Alexandria’s most distinguished mosque, named for, and housing, the tomb of the 13th century Sufi Al-Mursi Abu’l Abbas.[22]

Notably, the so-called “democratically elected” regime in Libya following the toppling of Mohamar Qaddafi by NATO bombs in 2011, has also been zealous in destroying Sufi mosques and places of worhip. In August this year, UNESCO Director General Irina Bokova expressed “grave concern” at the destruction by Islamic Jihadists of Sufi sites in Zliten, Misrata and Tripoli and urged perpetrators to “cease the destruction immediately.” [23] Under behind-the-scenes machinations the Libyan government is dominated by Jihadists and by followers of the Muslim Brotherhood, as in Tunisia and Egypt. [24]

The explosive cocktail of violence inherent in allowing the rise to power of Salafist Islamists across the Middle East was clear to see, symbolically enough on the night of September 11,th when a mob of angry supporters of the fanatical Salafist group, Ansar Al-Sharia, murdered the US Ambassador to Libya and three US diplomats, burning the US Consulate in Bengazi to the ground in protest over a YouTube release of a film by an American filmmaker showing the Prophet Mohammed indulging in multiple sex affairs and casting doubt on his role as God’s messenger. Ironically that US Ambassador had played a key role in toppling Qaddafi and opening the door to the Salafist takeover in Libya. At the same time angry mobs of thousands of Salafists surrounded the US Embassy in Cairo in protest to the US film. [25]

Ansar Al-Sharia (“Partisans of Islamic law” in Arabic) reportedly is a spinoff of Al-Qaeda and claims organizations across the Middle East from Yemen to Tunisia to Iraq, Egypt and Libya. Ansar al-Sharia says it is reproducing the model of Sharia or strict Islamic law espoused by the Taliban in Afghanistan and the Islamic State of Iraq, a militant umbrella group that includes al-Qaeda in Iraq. The core of the group are jihadists who came out of an “Islamic state”, either in Afghanistan in the mid-1990s, or among jihadists in Iraq after the US-led invasion in 2003.[26]

The deliberate detonation now of a new round of Salafist fundamentalist Jihad terror inside Muslim regions of the Russian Caucasus is exquisitely timed politically to put maximum pressure at home on the government of Russia’s Vladimir Putin.

Putin and the Russian Government are the strongest and most essential backer of the current Syrian government of Bashar al-Assad, and for Russia as well the maintenance of Russia’s only Mediterranean naval base at Syria’s Tartus port is vital strategically. At the same time, Obama’s sly message to Medvedev to wait until Obama’s re-election to evaluate US intent towards Russia and Putin’s cryptic recent comment that a compromise with a re-elected President Obama might be possible, but not with a President Romney, [27] indicate that the Washington “stick-and-carrot” or hard cop-soft cop tactics with Moscow might tempt Russia to sacrifice major geopolitical alliances, perhaps even that special close and recent geopolitical alliance with China.[28] Were that to happen, the World might witness a “reset” in US-Russian relations with catastrophic consequences for world peace.

F. William Engdahl*  is the author of Full Spectrum Dominance: Totalitarian Democracy in the New World Order

Notes:

[1] Dan Peleschuk, Sheikh Murdered Over Religious Split Say Analysts, RIA Novosti, August 30, 2012, accessed in

http://en.rian.ru/russia/20120830/175517955.html.

[2] Mairbek  Vatchagaev, The Kremlin’s War on Islamic Education in the North Caucasus, North Caucasus Analysis Volume: 7 Issue: 34, accessed in http://www.jamestown.org/single/?no_cache=1&tx_ttnews[tt_news]=3334

[3] Iason Athanasiadis, Targeted by Israeli raid: Who is the IHH?, The Christian Science Monitor, June 1, 2010, accessed in http://www.csmonitor.com/World/Middle-East/2010/0601/Targeted-by-Israeli-raid-Who-is-the-IHH.

[4] Ibid.

[5] Mairbek Vatchagaev, op. cit.

[6] UN Security Council, QI.U.290.11. DOKU KHAMATOVICH UMAROV, 10 March 2011, accessed in http://www.un.org/sc/committees/1267/NSQI29011E.shtml. The UN statement reads: “Doku Khamatovich Umarov was listed on 10 March 2011 pursuant to paragraph 2 of resolution 1904 (2009) as being associated with Al-Qaida, Usama bin Laden or the Taliban for “participating in the financing, planning, facilitating, preparing, or perpetrating of acts or activities by, in conjunction with, under the name of, on behalf of, or in support of”, “recruiting for”, “supplying, selling or transferring arms and related materiel to” and “otherwise supporting acts or activities of” the Islamic Jihad Group (QE.I.119.05), the Islamic Movement of Uzbekistan (QE.I.10.01), Riyadus-Salikhin Reconnaissance and Sabotage Battalion of Chechen Martyrs (RSRSBCM) (QE.R.100.03) and Emarat Kavkaz (QE.E.131.11).”

[7] Tom Jones, Czech NGO rejects Russian reports of link to alleged Islamist terrorists al-Qaeda, May 10, 2011, accessed in http://www.ceskapozice.cz/en/news/society/czech-ngo-rejects-russian-reports-link-alleged-islamist-terrorists-al-qaeda?utm_source=tw&utm_medium=enprofil&utm_campaign=twennews.

[8] The Times of India, Laden ordered Bamyan Buddha destruction, The Times of India, March 28, 2006.

[9] Dr. Alan Godlas, Sufism — Sufis — Sufi Orders:

[10] Irfan Al-Alawi and Stephen Schwartz, Wahhabi Internal Contradictions as Saudi Arabia Seeks Wider Gulf Leadership, Center for Islamic Pluralism, May 21, 2012, accessed in http://www.islamicpluralism.org/2040/wahhabi-internal-contradictions-as-saudi-arabia

[11] Irfan Al-Alawi and Stephen Schwartz, Wahhabi Internal Contradictions as Saudi Arabia Seeks Wider Gulf Leadership, May 21, 2012, accessed in http://www.islamicpluralism.org/2040/wahhabi-internal-contradictions-as-saudi-arabia.

[12] Robert Duncan, Islamic Terrorisms Links to Nazi Fascism, AINA, July 5, 2007, accessed in http://www.aina.org/news/2007070595517.htm.

[13] Marc Erikson, Islamism, fascism and terrorism (Part 2), AsiaTimes.Online, November 8, 2002, accessed in http://www.atimes.com/atimes/Middle_East/DK08Ak03.html.

[14] Ibid.

[15] John Loftus, The Muslim Brotherhood, Nazis and Al-Qaeda,  Jewish Community News, October 11, 2006, accessed in http://www.canadafreepress.com/2006/loftus101106.htm

[16] Ibid.

[17] Charlie Skelton, The Syrian opposition: who’s doing the talking?: The media have been too passive when it comes to Syrian opposition sources, without scrutinising their backgrounds and their political connections. Time for a closer look …, London Guardian, 12 July 2012, accessed in http://www.guardian.co.uk/commentisfree/2012/jul/12/syrian-opposition-doing-the-talking.

[18] Aidan Lewis, Profile: Tunisia’s Ennahda Party, BBC News, 25 October 2011, accessed in http://www.bbc.co.uk/news/world-africa-15442859.

[19] Hassan Hassan, Syrians are torn between a despotic regime and a stagnant opposition: The Muslim Brotherhood’s perceived monopoly over the Syrian National Council has created an opposition stalemate, The Guardian, UK, 23 August, 2012, accessed in http://www.guardian.co.uk/commentisfree/2012/aug/23/syrians-torn-despotic-regime-stagnant-opposition.

[20] Stefan J. Bos, Egypt Christians Killed After Election of Morsi, Bosnewslife, June 30, 2012, accessed in http://www.bosnewslife.com/22304-egypt-christians-killed-after-election-morsi.

[21] Ibid.

[22] Irfan Al-Alawi, Egyptian Muslim Fundamentalists Attack Sufis, Guardian Online [London],

April 11, 2011, accessed in http://www.islamicpluralism.org/1770/egyptian-Muslim-fundamentalists-attack-sufis

[23] Yafiah Katherine Randall, UNESCO urges Libya to stop destruction of Sufi sites, August 31, 2012, Sufi News and Sufism World Report, accessed in http://sufinews.blogspot.de/.

[24] Jamie Dettmer, Libya elections: Muslim Brotherhood set to lead government, 5 July, 2012, The Telegraph, London, accessed in http://www.telegraph.co.uk/news/worldnews/africaandindianocean/libya/9379022/Libya-elections-Muslim-Brotherhood-set-to-lead-government.html.

[25] Luke Harding, Chris Stephen, Chris Stevens, US ambassador to Libya, killed in Benghazi attack: Ambassador and three other American embassy staff killed after Islamist militants fired rockets at their car, say Libyan officials, London Guardian, 12 September 2012, accessed in http://www.guardian.co.uk/world/2012/sep/12/chris-stevens-us-ambassador-libya-killed.

[26] Murad Batal al-Shishani, Profile: Ansar al-Sharia in Yemen, 8 March 2012, accessed in  http://www.bbc.co.uk/news/world-middle-east-17402856.

[27] David M. Herszenhorn, Putin Says Missile Deal Is More Likely With Obama, The New York Times, September 6, 2012, accessed in http://www.nytimes.com/2012/09/07/world/europe/putin-calls-missile-deal-more-likely-if-obama-wins.html. According to an interview Putin gave on Moscow’s state-owned RT TV, Herszenhorn reports, “Mr. Putin said he believed that if Mr. Obama is re-elected in November, a compromise could be reached on the contentious issue of American plans for a missile defense system in Europe, which Russia has strongly opposed. On the other hand, Mr. Putin said, if Mr. Romney becomes president, Moscow’s fears about the missile system — that it is, despite American assurances, actually directed against Russia — would almost certainly prove true.

“Is it possible to find a solution to the problem, if current President Obama is re-elected for a second term? Theoretically, yes,” Mr. Putin said, according to the official transcript posted on the Kremlin’s Web site. “But this isn’t just about President Obama. “For all I know, his desire to work out a solution is quite sincere,” Mr. Putin continued. “I met him recently on the sidelines of the G-20 summit in Los Cabos, Mexico, where we had a chance to talk. And though we talked mostly about Syria, I could still take stock of my counterpart. My feeling is that he is a very honest man, and that he sincerely wants to make many good changes. But can he do it? Will they let him do it?”

[28] M.K. Bhadrakumar, Calling the China-Russia split isn’t heresy, Asia Times,  September 5, 2012, accessed in http://www.atimes.com/atimes/China/NI05Ad01.html.

 

Click for Latest Global Research News

October 17th, 2013 by Global Research News

Latest Global Research Articles. Subscribe to GR’s RSS Feed

December 30th, 2012 by Global Research News

A deluge of articles have been quickly put into circulation defending France’s military intervention in the African nation of Mali. TIME’s article, “The Crisis in Mali: Will French Intervention Stop the Islamist Advance?” decides that old tricks are the best tricks, and elects the tiresome “War on Terror” narrative.TIME claims the intervention seeks to stop “Islamist” terrorists from overrunning both Africa and all of Europe. Specifically, the article states:

“…there is a (probably well-founded) fear in France that a radical Islamist Mali threatens France most of all, since most of the Islamists are French speakers and many have relatives in France. (Intelligence sources in Paris have told TIME that they’ve identified aspiring jihadis leaving France for northern Mali to train and fight.) Al-Qaeda in Islamic Maghreb (AQIM), one of the three groups that make up the Malian Islamist alliance and which provides much of the leadership, has also designated France — the representative of Western power in the region — as a prime target for attack.”

What TIME elects not to tell readers is that Al-Qaeda in the Islamic Maghreb (AQIM) is closely allied to the Libyan Islamic Fighting Group (LIFG whom France intervened on behalf of during NATO’s 2011 proxy-invasion of Libya – providing weapons, training, special forces and even aircraft to support them in the overthrow of Libya’s government.

As far back as August of 2011, Bruce Riedel out of the corporate-financier funded think-tank, the Brookings Institution, wrote “Algeria will be next to fall,” where he gleefully predicted success in Libya would embolden radical elements in Algeria, in particular AQIM. Between extremist violence and the prospect of French airstrikes, Riedel hoped to see the fall of the Algerian government. Ironically Riedel noted:

Algeria has expressed particular concern that the unrest in Libya could lead to the development of a major safe haven and sanctuary for al-Qaeda and other extremist jihadis.

And thanks to NATO, that is exactly what Libya has become – a Western sponsored sanctuary for Al-Qaeda. AQIM’s headway in northern Mali and now French involvement will see the conflict inevitably spill over into Algeria. It should be noted that Riedel is a co-author of “Which Path to Persia?” which openly conspires to arm yet another US State Department-listed terrorist organization (list as #28), the Mujahedin-e Khalq (MEK) to wreak havoc across Iran and help collapse the government there – illustrating a pattern of using clearly terroristic organizations, even those listed as so by the US State Department, to carry out US foreign policy.Geopolitical analyst Pepe Escobar noted a more direct connection between LIFG and AQIM in an Asia Times piece titled, “How al-Qaeda got to rule in Tripoli:”

“Crucially, still in 2007, then al-Qaeda’s number two, Zawahiri, officially announced the merger between the LIFG and al-Qaeda in the Islamic Mahgreb (AQIM). So, for all practical purposes, since then, LIFG/AQIM have been one and the same – and Belhaj was/is its emir. “

“Belhaj,” referring to Hakim Abdul Belhaj, leader of LIFG in Libya, led with NATO support, arms, funding, and diplomatic recognition, the overthrowing of Muammar Qaddafi and has now plunged the nation into unending racist and tribal, genocidal infighting. This intervention has also seen the rebellion’s epicenter of Benghazi peeling off from Tripoli as a semi-autonomous “Terror-Emirate.” Belhaj’s latest campaign has shifted to Syria where he was admittedly on the Turkish-Syrian border pledging weapons, money, and fighters to the so-called “Free Syrian Army,” again, under the auspices of NATO support.

Image: NATO’s intervention in Libya has resurrected listed-terrorist organization and Al Qaeda affiliate, LIFG. It had previously fought in Iraq and Afghanistan, and now has fighters, cash and weapons, all courtesy of NATO, spreading as far west as Mali, and as far east as Syria. The feared “global Caliphate” Neo-Cons have been scaring Western children with for a decade is now taking shape via US-Saudi, Israeli, and Qatari machinations, not “Islam.” In fact, real Muslims have paid the highest price in fighting this real “war against Western-funded terrorism.”

….

LIFG, which with French arms, cash, and diplomatic support, is now invading northern Syria on behalf of NATO’s attempted regime change there, officially merged with Al Qaeda in 2007 according to the US Army’s West Point Combating Terrorism Center (CTC). According to the CTC, AQIM and LIFG share not only ideological goals, but strategic and even tactical objectives. The weapons LIFG received most certainly made their way into the hands of AQIM on their way through the porous borders of the Sahara Desert and into northern Mali.

In fact, ABC News reported in their article, “Al Qaeda Terror Group: We ‘Benefit From’ Libyan Weapons,” that:

A leading member of an al Qaeda-affiliated terror group indicated the organization may have acquired some of the thousands of powerful weapons that went missing in the chaos of the Libyan uprising, stoking long-held fears of Western officials.”We have been one of the main beneficiaries of the revolutions in the Arab world,” Mokhtar Belmokhtar, a leader of the north Africa-based al Qaeda in the Islamic Maghreb [AQIM], told the Mauritanian news agency ANI Wednesday. “As for our benefiting from the [Libyan] weapons, this is a natural thing in these kinds of circumstances.”

It is no coincidence that as the Libyan conflict was drawing to a conclusion, conflict erupted in northern Mali. It is part of a premeditated geopolitical reordering that began with toppling Libya, and since then, using it as a springboard for invading other targeted nations, including Mali, Algeria, and Syria with heavily armed, NATO-funded and aided terrorists.

French involvement may drive AQIM and its affiliates out of northern Mali, but they are almost sure to end up in Algeria, most likely by design.

Algeria was able to balk subversion during the early phases of the US-engineered “Arab Spring” in 2011, but it surely has not escaped the attention of the West who is in the midst of transforming a region stretching from Africa to Beijing and Moscow’s doorsteps – and in a fit of geopolitical schizophrenia – using terrorists both as a casus belli to invade and as an inexhaustible mercenary force to do it.

Today’s Most Popular Stories

October 15th, 2013 by Global Research News

Click to Get the Latest Global Research Articles

December 23rd, 2013 by Global Research News

Global Research’s Ukraine Report: 100+ articles

April 4th, 2014 by Global Research News

The earth’s climate is changing. Sea levels are rising. We are all at risk. The role of humans in climate change is undeniable. Capitalism is to blame. Governments must fix the problem.

These are the mantras of the environmental movement on display at the People’s Climate March being held on September 21.

The talking points of foundation-funded doomsayers reverberate in unison because their financing is dependent on publicizing a specific message and agenda. The otherwise critical minds supporting what passes for rebelliousness overlook the sponsorship and tacit control wielded by powerful private interests.

https://www.youtube.com/watch?v=0Autx79iHJs

Scratching the surface, one finds that the most salient proponents of the carbon-centric global warming worldview are largely dependent on such funding. For example, Bill McKibben, a principal organizer of the People’s Climate March, has built a career around the false notion that minuscule increases in carbon dioxide are a principal cause of “extreme weather” events.

[Image Credit: baltidome.wordpress.com]

mad_billAs this author has noted,

McKibben’s 350.org project is the public face of his 501(c)(3) 1Sky Education Fund, which between its founding in 2007 and 2009 took in close to $5,000,000 in foundation money and “public contributions.” In 2010 the Rockefeller Brothers Fund gave 1Sky $200,000. The key “scientific” paper McKibben points to as support for his dire warnings on climate change, “Target Atmospheric CO2: Where Should Humanity Aim,” coauthored by NASA scientist James Hansen, was partially funded through Rockefeller Foundation money.[1]

A seemingly radical, anti-establishment veneer is helpful in lending the environmental movement some degree of legitimacy. Canadian journalist and author Naomi Klein is the most recent voice of climate alarmism. Klein’s previous works, No Logo (2000) and The Shock Doctrine (2007), have afforded her with considerable notoriety and some degree of credibility, particularly among those on the progressive-left.

Klein’s most recent book, This Changes Everything: Capitalism vs. The Climate, suggests that drastic measures must be taken to save the environment from destructive human activities. This Changes Everything is published by Simon & Schuster, a subsidiary of the publicly-traded CBS Corporation, which boasted revenues of $15.284 billion in 2013 alone.[2] Like McKibben’s Rockefeller sponsors, Simon & Schuster and CBS are typically uninclined toward promoting genuinely anti-establishment thought and discourse.

Klein is one of the few in the progressive-left cavalcade to recognize that geoengineering and weather manipulation pose extreme threats to the environment. “Well, so, one of the geoengineering methods that gets taken most seriously is called ‘solar radiation management,’” Klein remarks on the foundation-funded Democracy Now! news hour,[3] another promoter of the People’s Climate March.

Solar radiation management, managing the sun. So, what you—so the idea [sic] is that you would spray sulfur aerosols into the stratosphere, then they would reflect some of the sun’s rays back to space and dim the sun and cool the Earth. So, climate change is caused by pollution in the lower atmosphere, and so they’re saying that the solution to that pollution is pollution in the stratosphere. And, you know, it’s really frightening when you look at some of the modeling that is being done about what the possible downsides of this could be [sic].[4]

In fact, there is substantial evidence–patents, government documents, and scientific papers–that such organized contamination projects have been underway since at least the late 1990s and are almost certainly a major factor in the “extreme weather events” pointed to with such alarm by figures like McKibDN_Kleinben.

Yet Klein deceptively suggests that geoengineering is still in the planning stages and has not begun. Indeed, to acknowledge that such plans are well-advanced and now fully operational would call into question the anthropogenic climate change hypothesis she and her adherents proclaim as the rationale for opposing “capitalism.” It would also likely jeopardize a lucrative publishing contract with a global media conglomerate.

[Image Credit: democracynow.org]

Foundation-funded and corporate-promoted environmentalism is notable not only for its hypocrisy, but also for what it leaves obscure to its well-intentioned devotees.

With this in mind, the purpose of such artificial dissent is arguably to repackage the threat of extreme weather that has been manufactured by military and government programs over the years as the basis for strategic socio-political and economic changes to which the public would never freely submit.

To curb humankind’s environmental excesses, today’s state-backed corporatism mistakenly decried as capitalism must further expand into the everyday lives of individuals, where an “internet of things” will inevitably catalog, regulate and control all consumable resources and biological entities.

“A really efficient totalitarian state,” Aldous Huxley once observed, “would be one in which the all-powerful executive of political bosses and their army of managers control a population of slaves who do not have to be coerced, because they love their servitude.”[5]

Along these lines, establishment environmentalism’s continued feigned urgency and spectacle of protest ingeniously disguises the deeper belief that humanity’s salvation lies in its own subservience to technocratic control.

Notes

[1] James F. Tracy, “Chemtrails: The Realities of Geoengineering and Weather Modification,” Global Research, November 8, 2012.

[2] “CBS CORP 2013 Annual Report Form (10-K)” (XBRL). United States Securities and Exchange Commission. February 14, 2014.

[3] James F. Tracy, “Manufactured Dissent: The Financial Bearings of the Progressive-Left Media,” Global Research, August 3, 2012.

[4] Amy Goodman, “Naomi Klein on Motherhood, Geoengineering, Climate Debt & the Fossil Fuel Divestment Movement,” Democracy Now! September 18, 2014.

[5] Aldous Huxley, Brave New World and Brave New World Revisited, Harper Perennial, 2005.

An insider in the U.S. military’s covert drone war has confirmed what critics of the killing program have long-warned: the program is far more “dangerous” than the government admits.

In an op-ed published in Salon on Tuesday, the unnamed former Air Force imagery analyst writes, “I was the only line of defense between keeping someone alive and providing the intelligence for a strike using technology not accurate enough to determine life and death.”

The military veteran—published under the name AFISR Predator (for Air Force Intelligence, Surveillance, and Reconnaissance)—goes on to describe how a drone pilot’s success was partly determined by the number of “enemy kills.” The analysts were encouraged to fly missions “even when there was nothing of consequence to see, no targets to strike and no American ground forces to protect,” wrote the veteran.

Despite calls for greater transparency, President Barack Obama has yet to acknowledge or provide any accounting for the number of civilians killed by the U.S. drone program. The Bureau of Investigative Journalism estimates that in Yemen roughly 135 civilians were killed by either confirmed or possible drone strikes since 2014 and in Pakistan over 950 civilians have been killed by confirmed strikes.

Countering claims made by the CIA director John Brennan that the use of drones will “dramatically reduce,” if not eliminate, the danger to U.S. personnel, AFISR Predator describes the prevalence of spousal, alcohol and drug abuse among his 100-person unit; two members had even taken their lives.

“The psychological pressure of not knowing if strikes were accurate was debilitating at times,” AFISR Predator writes.

“Our team worked between 12- and 14-hour shifts in a Sensitive Compartmented Information Facility, sometimes flying for hours seeing nothing, sometimes seeing unspeakable carnage,” AFISR Predator continues. “Then we returned home to spouses and families, where our security clearances prevented us from sharing our experiences in an effort to decompress from what we had witnessed.”

AFISR Predator concludes by saying that the military must “reconsider” their reliance on killer drones. “They are not as legal, targeted or accurate as the government makes them out to be, and they are not without consequences for our troops.”

A nurse who works at a private hospital in Mersin, a city and province on the Mediterranean coast of Turkey, has told Turkish authorities and Parliament that she is sick and tired of treating members of the terrorist organization the Islamic State in Iraq and the Levant (ISIL), which now calls itself the “Islamic State.”

The nurse, who was identified only by her initials, E.G., in a news story published by the Taraf daily on Wednesday, said of ISIL militants: “We treat them, and they go on to decapitate people. I am sick of treating wounded ISIL militants.” E.G. has also written a letter to Parliament and the National Police Department, saying she and her colleagues are extremely disturbed by the fact that they have to treat people “who chop off heads.”

Taraf reported that other health workers in Mersin and other provinces close to the Syrian border are uneasy about having to help wounded ISIL militants, who are responsible for extreme violence and bloodshed in northern Iraq and Syria.

In the letter she wrote to Parliament and the Police Department, E.G. said she has been employed at a private hospital in Mersin for a long time. She said her hospital has treated many wounded Syrians so far, who have introduced themselves as “opposition members.”

However, she noted that she had found out that most of the Syrians recently admitted to the hospital were ISIL members. “I was extremely distressed about this. I am very sorry about this situation. I am disturbed by the fact that these people are being treated in our hospitals while our people are being held by them,” she wrote, according to Taraf’s report.

ISIL has been holding 46 Turks, and three consulate staff who are not Turkish citizens, as hostages for the past three months.

E.G. further wrote that she was “ashamed” to have played a role in the treatment of the militants. She also stated that the ISIL militants were checked into the hospital under fake names. She said an ISIL commander was treated at the hospital where she works in August.

“The ISIL commander named Muhammet Ali R. who was admitted to our hospital on Aug. 7 was treated at room number 323. Many of his bodyguards kept watch around the hospital. Many other ISIL commanders like him and soldiers have been treated at our hospital, and returned to war after the completion of their treatment. I don’t want to help these people. I want you to inspect these hospitals. And I am referring the owners of the hospital and its management to God.”

The accelerating drive to a new US war in the Middle East, extending from Iraq to Syria and potentially beyond, has laid bare a stark contradiction between President Barack Obama’s public rejection of any US “boots on the ground” and increasingly assertive statements by top generals that such deployments cannot be ruled out.

Underlying this semi-public dispute between the US president—the titular “commander-in-chief”—and the military brass are the realities underlying another war of aggression being launched on the basis of lies for the second time in barely a decade.

It is being foisted on the American public as an extension of the 13-year-old “global war on terror,” with Obama warning this week that the Islamic State of Iraq and Syria (ISIS) “if left unchecked… could pose a growing threat to the United States.”

In reality, the ISIS threat, such as it is, stems entirely from US imperialist interventions that have ravaged first Iraq, through a war and occupation that claimed some one million lives, and then Syria, in a US-backed sectarian war for regime-change—in which ISIS was the beneficiary of arms and aid from the US and its regional allies—that has killed well over 100,000 and turned millions into refugees.

The collapse of Iraq’s security forces in the face of an ISIS offensive that was part of a broader Sunni revolt against Iraq’s US-installed Shi’ite sectarian government is now being used as the justification for a US military intervention aimed at reasserting US military dominance in Iraq, intensifying the war to overthrow the Assad regime in neighboring Syria, and escalating the confrontations with the key allies of Damascus—Iran and Russia.

Such strategic ambitions cannot be achieved with such unreliable proxy forces as the Iraqi military and the so-called Syrian “rebels.” They require the unrestrained use of Washington’s military might. This is why the generals are publicly challenging the blanket commitment made by Obama ruling out any US ground war in Iraq or Syria.

Over the past several days, both White House and Pentagon spokesmen have issued “clarifying” statements in an attempt to smooth over what increasingly suggests something close to insubordination by the top uniformed brass against the president.

The Washington Post pointed to the conflict Friday in a lead article entitled “In military, skepticism of Obama’s plan,” writing, “Flashes of disagreement over how to fight the Islamic State are mounting between President Obama and US military leaders, the latest sign of strain in what often has been an awkward and uneasy relationship.”

The first major public airing of the divisions between the military command and the White House came Tuesday in congressional testimony in which Gen. Martin Dempsey, the chairman of the Joint Chiefs of Staff, stated that circumstances in Iraq and Syria could require the introduction of US ground troops and he would not rule out their deployment. He added that the commander of CENTCOM, which oversees US military operations in the Middle East, had already proposed the intervention of US troops in the campaign to retake the Mosul dam last month, but had been overruled by the White House.

A day later, Obama appeared to rule out such action even more categorically, telling a captive audience of US troops at MacDill Air Force Base Wednesday: “As your commander-in-chief, I will not commit you and the rest of our Armed Forces to fighting another ground war in Iraq.”

This hardly settled the question, however. Speaking on the same day as the president, Gen. Ray Odierno, the Army chief of staff and former top US commander in Iraq, told journalists that air strikes would prove insufficient to achieve Washington’s ostensible goal of destroying ISIS. “You’ve got to have ground forces that are capable of going in and rooting them out,” he said.

Odierno intensified his argument on Friday, telling reporters that air strikes alone would grow increasingly problematic as ISIS forces intermingled with Iraq’s civilian population.

“When you target, you want to make sure you are targeting the right people,” the Army commander said. “The worst thing that can happen for us is if we start killing innocent Iraqis, innocent civilians.” He added that US ground forces would be needed to direct the bombing campaign.

Odierno referred to the 1,600 US troops the Obama administration has already deployed to Iraq as “a good start,” but added that as the US military campaign developed, so too could the demand for further deployments. “Based on that assessment we’ll make further decisions,” he said.

The Army chief warned that the US was embarking on a protracted war in the region. “This is going to go on,” he said.

“This is not a short term—I think the president said three years. I agree with that—three years, maybe longer. And so what we want to do is do this right. Assess it properly, see how it’s going, adjust as we go along, to make sure we can sustain this.”

As to US ground troops entering combat together with Iraqi units, Odierno stated, “I don’t rule anything out. I don’t ever rule anything out, personally.”

Even more blunt was Marine Corps Gen. James Mattis, the former commander of CENTCOM, who retired only last year. Testifying before the House Intelligence Committee, he directly attacked Obama’s public position of “no boots on the ground,” stating, “You just don’t take anything off the table up front, which it appears the administration has tried to do.”

Mattis added:

“If a brigade of our paratroopers or a battalion landing team of our Marines would strengthen our allies at a key juncture and create havoc/humiliation for our adversaries, then we should do what is necessary with our forces that exist for that very purpose.”

Even Obama’s defense secretary, Chuck Hagel, appeared to contradict the president’s assertion about no ground troops, telling the House Armed Services Committee Thursday, “We are at war and everything is on the table.” Hagel also revealed that the 1,600 “trainers” and “advisers” who have been deployed to Iraq are receiving combat pay.

It is apparent that the Obama administration is using a hyper-technical definition of “combat troops” to exclude the military’s special operation units from this category, even if they end up engaged in combat.

The position taken by the generals has found ample political support from the right-wing editorial board of the Wall Street Journal as well as congressional Republicans. The Journal argued in an editorial Friday that Obama’s “promise never to put ground troops into Iraq or Syria is already undermining the campaign before serious fighting begins against the Islamic State. Few believe him, and they shouldn’t if Mr. Obama wants to defeat the jihadists.”

The editorial compared Obama’s denial about “combat troops” to the claims made at the beginning of the Vietnam War that US troops were acting only as “advisers,” warning that the president could face the same fate as Lyndon Johnson, who “gave the impression of looming victory… only to have to escalate again and again.”

Rep. Howard “Buck” McKeon (Republican of California), the chairman of the House Armed Services Committee, told the Washington Post that Obama should “follow the … professional advice of the military” and “not take options off the table.”

The assertiveness of the top military brass in contradicting the White House is fed by the subservience and cowardice of civilian authorities, including the president and Congress. The latter adjourned this week after voting in both the House and Senate for Obama’s plan to shift $500 million in Pentagon funding to the arming and training of so-called “moderate rebels” in Syria. The measure was inserted as an amendment to a continuing resolution to fund the federal government through mid-December.

No serious debate, much less direct vote, was taken on the region-wide war that Washington is launching in the Middle East. The legislators have no inclination to be seen taking a position on this action—much less an interest in exercising their constitutional power—for fear that it will reverberate against them at the polls in November. Any debate has been postponed until Congress reconvenes after the elections and, undoubtedly, after the war is well under way in both Syria and Iraq.

Kagame Started the Genocide in Rwanda, then Congo

September 21st, 2014 by Global Research News

To the City of Atlanta, former Mayor Andrew Young and Bernice King:

Individuals and organizations listed below have come to know that the President of Rwanda, Paul Kagame, is organizing what he calls Rwanda Day, a meeting with the Rwandan Diaspora and the American public in the city of Atlanta.

We, the Congolese and Rwandan Diaspora, indigenous of the Congo and Rwanda, together with friends of these two countries, denounce and strongly condemn the fact that the president of Rwanda is allowed to organize such a meeting on American soil with the blessing of the authorities of the City of Atlanta.

Our condemnation is based on the fact that the people of the African Great Lakes regions have suffered from the abuses committed by Paul Kagame and his government for 24 years now.

We would like to bring the following basic facts about Paul Kagame to the attention of all Americans who are committed to peace and social justice:

  • In 1990, Gen. Paul Kagame invaded Rwanda heading a detachment of the Ugandan army dominated by Rwandan Tutsis like himself. He destabilized the country and committed numerous mass murders in the north of Rwanda.
  • In 1994, when the city of Kigali was surrounded by camps filled with desperate refugees fleeing Kagame’s army in the north, President Kagame pushed the country into a state of panic, terror and genocidal violence by ordering the assassination of the Rwandan and Burundian presidents as they returned from peace talks in Arusha, Tanzania, which were meant to end the conflict.

Rwandans and Congolese joined forces to protest the first Rwanda Day, held in Chicago, Illinois, in 2011, and at each Rwanda Day since.
Image: Rwandans and Congolese joined forces to protest the first Rwanda Day, held in Chicago, Illinois, in 2011, and at each Rwanda Day since.

  • In 1996 and 1998, Gen. Paul Kagame joined Gen. Yoweri Museveni in invading the Democratic Republic of the Congo, creating havoc in the country which resulted in deaths that the International Rescue Committee estimated to be as high as 5.4 million between January 1997 and January 2008. Since at least seven years of war and conflict were not counted in the IRC’s epidemiological study, the death toll is no doubt much higher.
  • Gen. Paul Kagame has never stopped plundering the Democratic Republic of the Congo since his first raids and today Rwanda is a major exporter of coltan (ore used in the manufacture of mobile phones, playstations and military electronics), although Rwanda itself has no coltan reserves.
  • Gen. Paul Kagame has fueled wars in the Democratic Republic of the Congo by creating and supporting proxy militias such as the M23 that have helped him cover up his plundering of the country.
  • Gen. Paul Kagame rules Rwanda with an iron fist. Political space is locked down favor of a minority. Nonviolent political challengers to Kagame, including Victoire Ingabire and Deo Mushayidi are incarcerated.

A protester at Rwanda Day in Boston in 2012 held up a poster calling for the freedom of Rwandan political prisoner and opposition leader Victoire Ingabire Umuhoza.

Image: A protester at Rwanda Day in Boston in 2012 held up a poster calling for the freedom of Rwandan political prisoner and opposition leader Victoire Ingabire Umuhoza.

  • Gen. Paul Kagame does not hesitate to resort to political assassination inside and outside Rwanda’s borders. In 2010, journalist Jean Leonard Rugambage was gunned down in the streets of Kigali, after letting the editor of the publication he wrote for know that he was about to release evidence of Kagame’s complicity in the attempt to assassinate his former general, Kayumba Nyamwasa, in Johannesburg, South Africa. Kagame’s former intelligence chief, Patrick Karegeya, was the last known to pay with his life for becoming a critic of the Kagame regime. Karegeya was found hanging in a Johannesburg hotel on New Year’s Day this year. This case is still under investigation, but Kagame’s response to the murder was to warn Rwandans, in a public speech, that “you can’t betray Rwanda without paying the price.”

All statements mentioned above have been duly documented by various U.N. reports, documented news reports including video footage, and legal judgments:

  • In July 16, 1997, the U.S. House of Representatives hearings before the Committee on International Relations about the Democratic Republic of the Congo revealed that Paul Kagame’s RPF (Rwandan Patriotic Front) had invaded Congo-Zaïre and that it was assassinating Hutu refugees in Eastern Congo-Zaïre. In 2006, President Obama, who was then a senator from Illinois, authored the Congo Relief Security and Democracy Promotion Act. Section 101(5) and (6) of Obama’s 2006 Congo legislation reads:“(5) The most recent war in the Democratic Republic of the Congo, which erupted in 1998, spawned some of the world’s worst human rights atrocities and drew in six neighboring countries.“(6) Despite the conclusion of a peace agreement and subsequent withdrawal of foreign forces in 2003, both the real and perceived presence of armed groups hostile to the Governments of Uganda, Rwanda, and Burundi continue to serve as a major source of regional instability and an apparent pretext for continued interference in the Democratic Republic of the Congo by its neighbors [Uganda, Rwanda and Burundi].”

Rwanda Day protest, London 2012

Image: Rwanda Day protest, London 2012

  • In 2008, The Spanish National Court indicted 40 Rwandan officers on charges of mass murder, crimes against humanity, terrorism, genocide against Rwandans, Congolese and Spanish citizens in the aftermath of the 1994 Rwanda genocide. Judge Fernando Andreu of Spain’s National Court also declared that he had sufficient evidence to implicate current Rwandan President Paul Kagame, but he also added that he could not indict him because of his presidential immunity.
  • The U.N. Office of the High Commissioner for Human Rights (UNOHCHR) issued a report on the Congo called “The United Nations Mapping Exercise Report.” This report affirms that the Rwandan government is responsible for the most serious violations of human rights and international humanitarian law in the Congo. Moreover, the observation of some of the crimes committed in the Democratic Republic of the Congo has led investigators to say that some elements “if proven before a competent court, could be characterized as crimes of genocide.”
  • On April 15, 2013, the Report of Foreign & Commonwealth Office (FCO) expresses concerns about the political space in Rwanda. It observes that there are many political constraints and that freedom of association and expression is not guaranteed. It also raises the question of the imprisonment of opposition leader Madame Victoire Ingabire.
  • In a letter dated Dec. 12, 2013, from the Group of Experts on the Democratic Republic of the Congo addressed to the chair of the Security Council Committee established pursuant to Resolution 1533 (2004) concerning the Democratic Republic of the Congo, the U.N. experts argue that Rwandan Defense Minister James Kabarebe was commanding the M23 militia then terrorizing DR Congo and that Rwanda provided continuous support to M23 from Rwandan territory. The most consistent forms of support were through recruitment and provision of arms and ammunition, particularly during periods of combat. M23 also received troop reinforcements directly from the Rwandan army in August. During the October fighting, Rwandan tanks fired into DRC in support of M23.
  • On Sept. 10, 2014, Magistrate Stanley Mkhari sentenced four men each to eight years in prison in a South African court, saying that they had been proven guilty of a ‘‘politically motivated’’ attempt to assassinate Kayumba Nyamwasa, Paul Kagame’s former defense chief, in June 2010. The plot, the judge wrote, originated in Kigali, the capital of Rwanda.

Kagame Day protest, Toronto 2013

Image: Kagame Day protest, Toronto 2013

The United States, which takes pride in its democratic history, and the City of Atlanta, which played such a proud role in the American Civil Rights Movement led by Dr. Martin Luther King, cannot want to appear to the world as supporters of dictatorship and mass murder, but allowing Paul Kagame to organize “Rwanda Day” in Atlanta tells the world that they are.

The violation of human rights is no more acceptable in Africa than in the United States or anywhere else in the world. We like to believe that human beings, wherever they are, are entitled to justice and that it is a denial of justice to host an event created to let a regime with bloody hands promote itself, while the millions it killed remain compelled to silence in death because we do not have the courage to speak for them and say enough is enough.

A message from a Congolese citizen, Philippe Lomboto Liondjo: “Please do not insult Martin Luther King’s memory and the spirit of the honorable struggle for Civil Rights by allowing a killer such as Gen. Kagame to organize his Rwanda Day in Atlanta.”

Coalition

BK Kumbi, spokesperson, Don’t Be Blind This Time (Switzerland-DRC)
Don’t Be Blind This Time, Swiss citizen movement
Bruce Dixon, Managing Editor, Black Agenda Report (USA)
Glen Ford, Executive Editor, Black Agenda Report
Milton Allimadi, Editor-in-Chief, Black Star News (USA)
Frank LeFever, retired neuroscientist, Pacifica WBAI Local Station Board member (USA)
Ann Garrison, Journalist and Victoire Ingabire Umuhoza Democracy and Peace Prize Winner (USA)
Maurice Carney, Executive Director, Friends of the Congo (USA)
Kambale Musavuli, Student Coordinator and Mining Researcher, Friends of the Congo (USA-DRC)
Kweku Lumumba, Secretary General, World African Diaspora Union, Georgia (USA)
Christopher Black, ICTR Defense Counsel (Canada)
David Peterson, co-author of the upcoming book, “Enduring Lies: The Rwandan Genocide in the Propaganda System, 20 Years Later” (USA)
Claude Gatebuke, Rwandan Genocide survivor, Executive Director, African Great Lakes Action Network
Theophile Murayi, Foundation for Freedom and Democracy in Rwanda
June Terpstra (USA)
Lisanga, Congolese political association (France)
La LUCHA, mouvement citoyen RD Congo
Soledad Mora, Comités Umoya-Madrid (Spain)
Magloire Mpembi, doctor and novelist (Canada-DRC)
Jean-Mobert N’Senga-la, LUCHA, (DRC)
Momi M’Buze Noogwani Ataye Mieko, Congolese writer and activist
Monique Mbeka, Congolese film maker (Belgium-DRC)
Philippe Lomboto Liondjo, Congolese performer, actor and activist (Switzerland-RDC)
Olivier Mukuna, Journalist (Belgium)
Lopango Ya ba Nka, Congolese music band (Germany-RDC)
Willie Ratcliff, Publisher, San Francisco Bay View National Black Newspaper
Mary Ratcliff, Editor, San Francisco Bay View National Black Newspaper
JR Valrey, Producer, Block Report Radio, Associate Editor, SF Bay View (USA)
Anne Onidi, Journalist (Switzerland)
Nicolas-Patience Basabose (RSA)
Elengo (Switzerland-DRC
Victoria Dimandja (GB-DRC)
Youyou Muntu-Mosi (France-DRC)
Nadine Bena (France-DRC)
Jean-Jacques Tadoum (USA)
Leopold Mbala (USA-DRC)
Ekutsu Mambulu (DRC)
N’siala Kiese Patrick (Belgique-Drc)
Meta Nabou Cisse (Belgique)
Derrick Onyeri (Denmark-Uganda)
Nadia Nsayi (Belgiques-DRC)
Jean-Baptiste Paul (France-Haïti)
Rosa Moro, Journalist (Spain)
Flavia Garrigos Cabanero (Spain)
Dina Martinez (Spain)
Damiàn Socías Picornell (Spain)
Pedro Espinosa Bote (Spain)
Ana María Martínez Rodamilans (Spain)
Fuencisla de Andrés (Spain)
Ana Espinosa González (Spain)
Pedro Espinosa (Spain)
Maite Cobas (Spain)
Jaime Lara (Spain)
José Hernández (Spain)
Mingu Haro (Spain),
Marlene Ibarra (Ecuador)
Nella Azana (GB-DRC)
Vincent Conrad Ball (GB)
Kibsoo Diallo (Egypt)
Djallil Saada (Switzerland)
Benjamin Itzkovich (Switzerland)
Dieudonne Aoche (USA-DRC)
Lucie N’goma (France)
Paul Alain (France)
Judith Bass (Switzerland)
Juan Carlos Hernandez (Switzerland)
Mang Holenn Christian (RSA)
Leslie Luboloko Lusinda (RSA)
Patrick Kegbia (RSA)
Billy Lukinu (Angola)
Stacey Koyenyi (GB)
Kitondua Diasivi (France)
Ive Mass (GB-RDC)
Matondo Kapella (RDC)
Gloria Omoyi (France-RDC)
Gugu Ngwenya (RSA-RDC)
Owandji Olenga Lokolo Lopaka (RDC)
Sosthene Banda Badou (Poland-Tchad)
Bebelle Dembo (North Irland)
Anthea Harris (GB)
Claudine Mamona-Cullin (Austria)
Sala Naambwe (Canada)
Demunga Hassani (Canada)
S. Mathieu Gnonhossou (USA-Rwanda)
Philippe Faradja Byaombe , Congolese Student Organisation-Pretoria (RSA)
Aimant Lutonadio (Germany-RDC)
Sophie Teuwen (Senegal)
Ibrahim Touré (Algeria-Mali)
Dadao Mupulu (RDC)
Kalengula Wha Kalengula (USA-RDC)
J.L. Bondoko Ekolonga (RDC)
Motaouakkil Abdellatif (Morocco)
Paul Otshudi Loma (GB)
Dolly Kimpiatu Fofo Lukata (USA-DRC)
Raphaël Berland (France)
Beatrice Léonard Lomami (USA-DRC)
Freddy Aigle (DRC)
Ambrose Nzeyimana (GB-Rwanda)
Dady Dalla (USA-DRC)
Dalila Choukri (France)
Kakiese Nicole (Belgium-DRC)
Dominique Diomi (USA-DRC)
Joachim Mbala (GB-DRC)
Patience Ngoba-Mushidi (Germany-DRC)
Joyce Mbaya (USA-DRC)
Yiokito Ilangwa (RSA-DRC)
Patricia Athena (Sweden
Yaa-Lengi Ngemi, President, Congo Coalition
Nii Akuetteh, Founder, The Democracy & Conflict Research Institute (DCRI)
Ed Herman, co-author of the upcoming book, “Enduring Lies: The Rwandan Genocide in the Propaganda System, 20 Years Later”
Keith Harmon Snow, human rights investigator and war correspondent, Conscious Being Alliance
Robin Philpot, Baraka Books Publisher, author of “Rwanda and the New Scramble for Africa
Kevin Alexander Gray, author of “The Decline of Black Politics: From Malcolm X to Barack Obama,” contributor to Counterpunch and The Progressive
Nita Evele, Congo Coalition – Stop the Genocide in Congo-Zaire
Phil Taylor, Taylor Report Producer and Host, CIUT 89.5 FM, University of Toronto, former defense investigator for the ICTR
Kumbi Bénédicte Ndjoko, historian and activist, Don’t Be Blind This Time
Jean Nepomuscene Manirarora, Secretary-General, Foundation for Freedom and Democracy in Rwanda
Jennifer Fierberg, Contributor, African Global Village

For more information, contact Friends of the Congo, 202-584-6512 or 718-865-6512 and Committee for Unity of Black Immigrants and Americans, 404-401-8817.

Hotel Propaganda: What Really Happened in Rwanda in 1994

September 21st, 2014 by Antony C. Black

On the evening of April 6th 1994 a plane carrying the Hutu leaders of both Rwanda and Burundi was shot down as it approached Kanombe airport[1]. The assassins had little trouble targeting the flight as only one of the two runways was open, the other having been closed two months earlier on the orders of Canadian General Romeo Dallaire. Simultaneous to the shootdown, that is on the eve of April 6th, a 30,000 RPF  (Tutsi) army based in Uganda invaded from the north. At the same time, hundreds of covert armed RPF cells came to life in and around Kigali and began attacking Rwandan government forces (FAR). The population, roughly 85% Hutu, and encompassing at least a million refugees in and around Kigali displaced by previous RPF incursions from Uganda, began to panic.  A genocide was about to begin.
 
But it was a genocide neither against, nor by, the actors cited in the ‘official’ narrative. Indeed, Rwanda circa 1994, is, in all likelihood, if not the, then certainly one of the greatest propaganda swindles of all time. This is the story of that swindle and of the scandalous truth that lies buried beneath it.
 
Historical Context

Prior to the arrival of Europeans, Rwanda was a feudal kingdom ruled by a Tutsi minority over a Hutu majority. Following the Berlin Conference of 1885 Rwanda came under the suzerainty of Germany which was, itself, replaced as colonial overlord following WW1, by Belgium. Rwanda’s feudal order remained intact, however, until 1956 when the Belgians finally organized elections. Then, in November 1959, the Hutu majority overthrew the Tutsi monarchy. Many Tutsis fled, the majority ending up, significantly, in Uganda. It was from this perch in Uganda that the exiled Tutsi aristocracy launched, between 1960 and 1973, a series of violent attacks against the Rwandan regime. These were repulsed and for the next decade and a half Rwanda enjoyed a period of relative peace.

It is worth noting at this juncture that, though much of the Tutsi aristocracy fled in 1960, those Tutsis who remained were well integrated into Rwandan society and body politic. Thus, both the government and army contained significant numbers of Tutsi personnel even through the height of the crisis in April 1994. In fact, the Rwandan Army (FAR) continued as a multi-ethnic organization even as it was forced to retreat into the forests of the Congo in July of 1994; this after having run out of ammunition due to a Western embargo on arms supplies – an embargo not applied to the RPF.

Up until 1990 there was no further interference in Rwanda from Uganda. Nevertheless, by then the Tutsis exiles living there had become one of the main elements of the Ugandan Army. As such, when Museveni came to power – having been handpicked by the US and Britain to oust the socialist, Milton Obote – a third or more of his army consisted of Tutsis. Many of these held high office, including Paul Kagame.

Kagame had been (and remains) an erstwhile client of Washington from well before he claimed to have ‘saved Rwanda from further genocide’ in 1994. Not only had he served as director of Ugandan military intelligence in the 1980s, but he had also received training at Fort Leavenworth, Kansas,[2] and had been the beneficiary of constant US material and diplomatic support from the moment he assumed control of the RPF.

Upon the collapse of the USSR in 1989/90 the US and the UK began a general militarist expansion which included the targeting of Yugoslavia and Rwanda; Yugoslavia as it was the last real bastion of working socialism in Europe, and Rwanda as it was a working model of socialist development in Africa. In addition, the US had turned against Mobutu (of Zaire, now the Democratic Republic of the Congo) as he was beginning to ally himself politically with China.

The Rwandan president, Habyarimana, was subsequently approached by Washington to allow his country to be used as a staging ground for an attack on Zaire (to this day, a cornucopia of precious resources prized by the West). His refusal caused the US to look to other agents in furthering its strategic interests. They found the Tutsis in Uganda, ever thirsting for restoration of their hegemony in Rwanda. Furthermore, Museveni had begun to feel uneasy about the numbers of Tutsis in his ranks and was looking to be rid of them. The opportunity to satisfy these disparate desires soon came.

On October 1, 1990 the self-styled Rwandan Patriotic Front (RPF) launched a surprise attack from Uganda. Though calling themselves a force of ‘liberation’ the offensive was a thinly disguised invasion by Uganda itself. Initially, the justification for the invasion put out by the RPF was that of attaining the right of return of Tutsi refugees. This claim, however, was belied by the fact that Rwanda had, under UN auspices, already agreed a few weeks earlier to the return of all Tutsis who wished to do so. That accord required Tutsi representatives to travel to Kigali to determine both the logistics of that population movement and their subsequent accommodation within Rwanda. The delegation was expected at the end of September, 1990. They never arrived.

The attack killed tens of thousands of Rwandan civilians. These crimes, though well documented, have never been accounted for, nor did the UN or ‘international community’ ever seek to account for them. Indeed, there was not even a shred of condemnation of the Ugandan/RPF  invasion, this despite the clamour raised only two months earlier with regard to the advance of Iraqi forces into Kuwait. In point of fact, the US and its allies supported the aggression against Rwanda and US Special Forces operated alongside the RPF from the beginning. This support notwithstanding, the small Rwandan army (with some help from a Congolese battalion) was eventually able to repel the invading forces.

Following this attempt using a proxy force to overthrow the state, the United States brought political and economic pressure to bear upon Rwanda’s one-party socialist state (MRND). The President, Juvenal Habyarimana, instead of resisting, agreed to alter the constitution and in 1991 Rwanda became a multi-party democracy. Though the Rwandan government effected this as an offer of peace, what followed was anything but peace. Thus, rather than work towards reconciliation, the RPF turned from the tactics of open warfare to those of guerrilla terrorism.

In 1992, and whilst RPF forces were busy planting mines, assassinating politicians and blaming it on the MRND, a coalition government was formed with the front parties of the RPF. These agents, with US backing, quickly seized control of key ministries and succeeded in appointing the Prime Minister. They also gained control of the intelligence services which they then began to dismantle. In essence, the ‘power sharing’ arrangement had largely given over control of the country to the very forces long bent on its destruction.

The RPF itself, meanwhile, engaged in a ‘talk and fight’ strategy; always agreeing to a ceasefire, pressing for more power, then launching new attacks on the civilian population. The most egregious of these assaults was their breaking of the ceasefire and the launching of a major offensive in February of 1993. Seizing the town of Ruhengeri, RPF forces murdered some 40,000, mostly Hutu, civilians. Once again, the ‘international community’ remained dutifully silent.

The Rwandan army, though hamstrung by the civilian ministries, managed to repulse the RPF attack. Finally, in August of 1993, the Arusha Accords were signed under pressure from the United States and its allies, and from which the RPF obtained major concessions. The Accords dictated the formation of a broad-based transition government to be followed by general elections.[3] But for the RPF – as for the United States – there was a fatal fly in the electoral ointment. To wit, the RPF knew that they could not win such elections; this not only because they were unpopular with the majority (85%) Hutu population, but also because they had precious little support amongst many of Rwanda’s internal Tutsis whose lives and businesses they had destroyed. Rather than prepare for elections, the RPF prepared for something different.

UN reports document the massive build-up of men and weapons coming in from Uganda during this period. In fact, the UN force (UNAMIR) supposedly deployed to ensure a peaceful transition acted, instead, as a cover for the US and its allies, i.e. Britain, Belgium, Canada, to assist the illegal build-up. General Romeo Dallaire, the Canadian general in charge of the UN force, hid this build-up not only from the Rwandan Army and the President, but also from his immediate superiors, Jacques-Roger Booh-Booh and UN Secretary General Boutros Ghali. These machinations were accompanied by death threats against Habyarimana, threats made all the more significant by the murder of the first Hutu president of neighbouring Burundi, Melchior Ndadaye, by Tutsi officers in October 1993.[4]

The result of the 1993 RPF offensive was the forced migration of hundreds of thousands of Hutus from northern Rwanda towards Kigali so that by April, 1994 over a million refugees were encamped close to the capital and hundreds of thousands more in camps to the south. The RPF, meanwhile, did all it could to paralyze the functioning of the government, to exacerbate racial tensions, and to prepare for war.

Who Killed Habyarimana

The triggering event in the ‘Rwandan genocide’ of 1994 is generally agreed to be the shooting down, on April 6, 1994, of the plane carrying Juvenal Habyarimana, the Hutu president of Rwanda, and Cyprien Ntaryamira, the Hutu president of Burundi. The official story has it that unidentified ‘Hutu rebels’ were the villains who targeted their own countrymen in some vague attempt to gain power. No evidence was ever adduced in support of this threadbare thesis, but in any case, even if so, the official villains failed spectacularly in their objectives as the country quickly fell to invading Tutsi forces leaving a small minority (Tutsi) population to rise like the Phoenix to its former position of national privilege and oligarchical control. No one in the Western mainstream media has ever commented on the exceeding peculiarity of this bizarre turn of events, never witnessed before, in which the supposed victims of a genocide end up as the victors of the conflict.

The paradox is soon resolved, however, if we countenance the much more likely scenario that the decapitation of the state leadership was the first stage in a final offensive of a war started four years earlier. That the assassination was part of an RPF coup d’etat is given further support by the fact that a 30,000 man RPF force was already marching against Kigali hours before the plane was destroyed, and that RPF forces inside Kigali were attacking government positions within hours of the shootdown. The Western audience, naturally, was, and has never since, been informed of these rather pertinent contextual facts surrounding the events of April 6, 1994. To boot, the official response to Habyarimana’s assassination was and has remained one of determined indifference; a strange thing given that it involved the highest official in the land. Even stranger given that, and according to virtually every independent expert on the subject, the ‘genocide of 1994’ simply would not have happened had Habyarimana not been assassinated. Nevertheless, though all the circumstantial evidence points towards the assassination being part and parcel of a US-backed RPF coup d’etat against the government of Rwanda, it would yet be helpful if there was direct evidence implicating RPF forces in the murder. There is.

As in one of those classic ‘B movie’ plot twists where the bad guys inadvertently hire a good guy who turns the table on his benefactors, so too did the lead official of the International Criminal Tribunal for Rwanda (ICTR) hire an investigator into the crash who turned out to be an honest man. Reporting back to Chief Prosecutor Louise Arbour in 1996/97, Australian lawyer, Michael Hourigan, found evidence directly linking the RPF (and the CIA) to the assassination. Far from pleasing Arbour, however, Hourigan’s diligence was rewarded with censure. According to Hourigan, Arbour became “aggressive” and “hostile” when informed of his findings. What Hourigan didn’t know at the time is that Arbour, after having launched the investigation, had been directed by US Secretary of State Madeleine Albright (who had handpicked her for the job) to quash the inquiry. And so she did. Arbour would later (again under the aegis of Albright) be promoted to Canadian Supreme Court Justice and thence as UN High Commissioner for Human Rights.

Hourigan’s report, though suppressed at the time, would, nevertheless, surface many years later in the hands of one of the defense teams at the ICTR. The report would also have its findings later corroborated by numerous sources. Thus, the French anti-terrorist judge Jean-Louis Bruguiere, having been called in to investigate the deaths of three French nationals who were aboard Habyarimana’s doomed flight, launched an exhaustive eight-year investigation. He concluded that the plane had indeed been destroyed by the RPF and that the assassination was part and parcel of Kagame et al’s plan to take over Rwanda by force. Bruguiere went on to issue nine warrants for the arrest of high-ranking members of the RPF whilst also requesting that the ICTR take up Kagame’s prosecution.

What’s more, not only have other French – and Spanish – legal officials since confirmed Bruguiere’s findings, but many highly placed members of the RPF have stepped forward publicly to implicate Kagame and the RPF in the assassination[5]. All have suffered the same fate of official international silence and suppression, and some of the latter have suffered assassination themselves.[6]

This culture of suppression and official silence has also plagued the ICTR from its inception. In particular, it became the explicit policy of the ICTR to forcibly limit its mandate solely to the investigation of ‘genocidal intent’ by Hutu government figures, i.e. without any reference whatsoever either to the political context of the conflict or to the mounting evidence implicating the RPF as invaders and genocidaires.  In short, the ICTR, much like its sister tribunal, the International Criminal Court for the Former Yugoslavia (ICTY), proved itself from the outset to be little more than a Washington-sponsored kangaroo court.[7]

This transparently politicized policy has continued apace throughout the trials. When, for instance, the more independently-minded Carla Del Ponte replaced the pliable Louise Arbour, she was quickly terminated as Chief Prosecutor after calling for a ‘Special Investigation’ into the actions of the RPF; this despite making a case for such an investigation with then UN Secretary-General Kofi Anan. Of course, Anan’s refusal to look into the crimes of the RPF should come as no surprise as it was he who, a) was head of the peacekeeping operations in 1994, and is thus implicated in the events, and b) was handpicked by the US to replace his predecessor, Boutros-Ghali.

Boutros-Ghali, It might be remembered, had come uncomfortably close to scuttling the entire US/RPF invasion scenario when, in May of 1994, he acceded to a request by the Rwandan government to send 5500 UN troops to Rwanda to reinforce the 2500 already stationed there; this so as to stabilize the country at a time when reports of growing ‘chaos’ were issuing forth daily in the world press. These efforts were, however, categorically thwarted by the Clinton regime which used its influence to remove the proposal from the UN agenda. Instead, the UN troops already stationed there, far from being reinforced, were withdrawn. Later, Boutros-Ghali, in conversation with Rwandan expert Robin Philpot, would expand on these matters declaring that, “The genocide in Rwanda was 100% the responsibility of the Americans!”[8] Hardly any wonder, then, that in 1996 US Ambassador to the UN, the ubiquitous Madeleine Albright, would veto his re-election making Boutros-Ghali the only UN Secretary General in history not to be granted a second term in office.

Inconvenient Truths

On August 26, 2010 the French newspaper Le Monde revealed the existence of a draft UN report detailing the most serious human rights violations in the Democratic Republic of Congo over an eleven year period (1993 – 2003). The report described how, following the RPF’s takeover of Rwanda in 1994, it proceeded to carry out “systematic and widespread attacks” against Hutu refugees who had fled to neighbouring DRC. These attacks it stated, “could be classified as crimes of genocide.”

Save for it having been leaked to Le Monde, it is clear that the report was well on its way to being buried alive, its cover-up a near certainty. But this was hardly the first instance of a cover-up of a UN report vis a vis Rwanda. As early as October 11, 1994, Robert Gersony, an employee of the US Agency for International Development (USAID), then attached to the UN High Commissioner for Refugees, made an oral presentation to the UN Commission of Experts on Rwanda. Gersony had been dispatched to survey the situation inside Rwanda to determine if conditions were right for return of the Hutu refugees who had fled the RPF. Instead, he found that the RPF had been committing massacres of the Hutu population in Rwanda starting in April 1994 through the date of his presentation. On page 4 of the UN record of Gersony’s presentation (a record which surfaced in the defense proceedings at the ICTR), we read,

“Significant areas…have been the scene of systematic and sustained [emphasis added] killing and persecution of the civilian Hutu population by the Rwandan Patriotic Front…..These actions were consistently reported to be conducted in areas where opposition forces of any kind – armed or unarmed, or resistance of any kind….were absent. Large scale indiscriminate killings of men, women and children, including the sick and elderly were consistently reported.”

Now, I remind the reader that the killings detailed here were being perpetrated not, as in the official narrative, i.e. by  Rwandan government troops, but by the supposed saviours of the country, i.e. the RPF.

Though much evidence surfaced early on that the official genocide narrative was in sharp disagreement with reality, all later independent reports have continued to corroborate this finding. In a 2004 paper, for instance (and reinforced in a more recent 2009 report), US academics Christian Davenport and Allan Stam concluded that, of the many hundreds of thousands of deaths (possibly as high as two million)[9] that occurred in Rwanda from April through July of 1994, the “majority of victims [at least two thirds] were likely Hutu and not Tutsi”. Noteworthy is the fact that Davenport and Stam were initially sponsored by the ICTR – that is until their findings contradicted the official narrative whence they were sent packing.

Still, Davenport and Stam have refrained from taking the implication of their own research to its logical conclusion, i.e. that Kagame’s forces were the only agents responsible for committing “systematic” killings in the areas they overran, or that such systemic violence was part of a pre-existing plan by the US-backed RPF to invade and overthrow the legitimate government, the latter in order to install a formerly privileged minority – and Western comprador elite[10] – to power within Rwanda.

If the academics have been content to sit on the fence, not so one of the more famous lay figures of the Rwandan debacle. It is ironic in the extreme that Paul Rusesabagina, the real-life hero of the movie Hotel Rwanda – a film unashamedly promoting the official narrative – has himself, in numerous interviews, completely gainsaid that narrative. He has, thus, repeatedly denounced the RPF as the real genocidaires, and has called a Kagame a “war criminal” and “dictator” who is responsible for mass killings not only during the takeover of Rwanda in July 1994, but ever since both in Rwanda and in his US-backed incursions into the Congo. Indeed, so fervent have the denunciations been that Rusesabagina is now officially listed as a ‘terrorist’ and ‘genocide denier’ (a prisonable offence in Rwanda) by the Kagame regime.

No matter, the movie continues to circulate, sans critique; Rusesabagina’s views and denunciations, do not.[11]

Whose Genocide(s)?
 
It is something of an embarrassment to the US architects of the ICTR that the tribunal, though explicitly tasked with indicting only members of the Hutu government, have failed singularly in successfully prosecuting any of them[12]. Not only have the most senior members of the MRND – through the spirited efforts of the various defense teams – been acquitted, but the mass of evidence so assembled has stood the entire official narrative on its head, and has implicated, au contraire, the RPF – and its foreign accomplices – in the genocide.

There was, however, one highly publicized piece of evidence proffered at the tribunal by prosecutors as they sought to prove a ‘planned genocide’ by the MRND government. This was the so-called ‘genocide fax’ allegedly sent to the New York UN headquarters on the night of January 10th, 1994. That this was the only piece of documentary evidence claiming direct planning of a genocide put forward in the trial is, itself, telling. Had there actually been such a plan (by the MRND), the logistics would have left a paper and/or electronic trail a mile wide. Instead, there are no orders, minutes of meetings, notes, cables, faxes, radio intercepts or any other type of documentation indicating that such a plan ever existed. And then, of course, there are the actual events on the ground which, as we have seen (and shall see further), suggest nothing of the sort. Nonetheless, there is the lone sepulchre of the ‘genocide fax’. What to make of it?[13]

To make a long story short, the fax is a forgery. There was a fax sent to the UN headquarters on January 10th, 1994 (a copy of a cable sent by Romeo Dallaire to another Canadian, General Baril), but this was not the fax that was entered into evidence in the Military II trial (ICTR vs Ndindiliyimana)[14] in October, 2005. Ndindiliyimana’s defense counsel was able to definitively establish that the original fax dealt only with ‘weapons caches and seeking protection for an informant’, whereas the fax subsequently entered as evidence, having first had time stamps, dates and paragraphs altered, had mysteriously sprouted an addendum about government plans to kill Tutsis and Belgian soldiers.[15] Conflicting testimony both between Dallaire’s earlier and later statements, and between statements made by Dallaire and Lt. Col. Claeys (a Belgian officer who claims to be one of the authors of the original cable), further proved the document’s inauthenticity. Such was only reinforced when Dallaire’s immediate superior, Jacques Roger Booh-Booh, stated that he had never seen nor heard of the fax or any of its alleged inflammatory contents. Eventually, the ‘genocide fax’ was simply withdrawn as evidence by the court. Puff! One might wonder, then, why tens of thousands of MRND personnel are today still in prison, this whilst not one RPF figure has even been indicted. But so it is.

If documents supporting a pre-meditated plan by the MRND have failed to materialize, not so it turns out when it comes to the RPF. In the same trial that saw the outing of the fraudulent ‘genocide fax’, evidence was presented suggesting nothing other than a master plan by Kagame and “our Belgian, British and American collaborators” for the taking not only of Rwanda, but of Zaire. In a letter from Kagame to fellow Tutsi, Jean-Baptiste Bagaza of Burundi, dated August 10, 1994, Kagame thanks Bagaza for his help in “taking Kigali”. He then relates his communications with “our big brother Yoweri Museveni” and talks of “some modifications of the plan” noting that:

“We have found that the presence of large numbers of Rwandan refugees at Goma, and the international community, can cause our plan for Zaire [emphasis added] to fail. We cannot occupy ourselves with Zaire until after the return of these Hutus….In any case, our external intelligence services continue to crisscross the east of Zaire, and our Belgian, British and American collaborators [emphasis added] the rest of Zaire. The action reports are expected in the next few days.”

Now, what this letter seems to indicate is that the attack on Rwanda (from 1990 onward) was not the prime objective of Kagame and crew after all, but was, rather, merely the gateway to an attack on Zaire/Congo. The significance of the latter became apparent when, on November 1, 1996, the aforementioned Goma was, in fact, attacked and taken by the RPA (the re-named RPF) along with Burundian and Ugandan forces. This assault was heavily backed by the United States and eyewitness accounts tell of large American cargo planes filled with arms landing in Kigali in the last two weeks of October, 1996. The taking of Goma was, it is pertinent to note, the prelude to the ensuing genocidal carnage that has overtaken the Democratic Republic of the Congo ever since. To properly understand this last statement we need to backtrack a bit to April 6, 1994, and look at the events that unfolded immediately following the assassination of Habyarimana.

Once the plane had been shot down, an RPF army, as noted earlier, invaded from the north whilst armed RPF cells began attacks inside Kigali itself. These cells represented some 15,000 or so troops that the RPF had illegally secreted into Kigali under Dallaire’s watch [As the UNAMIR force commander he was charged with the responsibility of allowing, under the Arusha Accords, no more than 600 RPF into the city]. In the sector of Kigali known as Remera the RPF killed everyone on the night of the 6th and 7th, wiped out the gendarme camp there, wiped out the military police camp at Kami and launched major attacks against Camp Kanombe, Camp Kigali, and the main gendarme camp at Kacyriu.

The Rwanda government and army called for a ceasefire that same night and the next day. The RPF rejected the call. The Rwandan government then asked for UN help to control the situation. Instead, the US arranged that the main UN force be pulled out whilst flying in men and supplies to the RPF using C130 Hercules aircraft. The Rwandan Army, short of ammunition and unable to contain the RPF advances offered an unconditional surrender on April 12th. The RPF rejected this offer and began shelling the Nyacyonga refugee camp, where the one million Hutu refugees were located, so provoking their flight into the capital.

The effect of one million people flooding into a small city that itself was under bombardment caused mayhem and panic. To make matters worse, the RPF used this flood of people to infiltrate its men behind FAR lines. This heightened to fever pitch the panic amongst the Hutu population who then began killing anyone they did not recognize. The late Dr. Alison Des Forges (a noted expert on Rwanda), in her testimony before the Military II trial at the ICTR in 2006 stated that the RPF claim that they attacked to stop a ‘genocide’ was a myth; just propaganda to justify their attempt to seize power by force of arms. She also testified that the Rwandan government did not plan and execute genocide. This accords with the (early) testimony of Romeo Dallaire who confirmed that there was no planned genocide by the MRND. In addition, the deputy head of Belgian Army intelligence, Col. Vincent, similarly testified that the idea of an MRND-backed genocide was a complete fantasy.

The fighting in Kigali was intense. UN officers – confirming testimony made by FAR and RPF officers before the ICTR – state that the RPF was launching hundreds of Katyusha rockets every hour around the clock whilst the Rwandan Army ran out of grenades in the first few days and were reduced to fighting with hand-made explosives. Nevertheless, the siege of Kigali lasted three months and only ended when the Rwandan Army literally ran out of all ammunition and thence ordered a general retreat into the forests of the Congo.

RPF officers testifying before the ICTR have stated that the RPF killed up to two million Hutus in those 12 weeks in a deliberate campaign to eliminate the Hutu population. The Akager River, the length of which was under RPF control throughout, ran red with the blood of Hutu victims massacred on its banks. It is here that Robert Gersony’s report, filed as an exhibit before the ICTR, lends support to this testimony and to the fact of a systematic and planned RPF massacre of the Hutu population.

As the Rwandan Army (including its Tutsi officers) retreated into the Congo forest, the Hutu population, in fear for their lives, fled with them in their millions. Meanwhile, in local villages, Hutu neighbours attacked Tutsis either in revenge for the murder of Hutus or fearing death at their hands. Tutsis also attacked Hutus. It was total war, though a war clearly fuelled and instigated by the US-backed RPF invasion.

The RPF later pursued the Hutus through the Congo forest and, between 1996 and 1998, killed hundreds of thousands and possibly millions. All the while the RPF was assisted by the United States. Thus, the US cynically thwarted plans (in November 1996) devised by the French and the European Union to send a 10,000 man UN force to assist and guarantee the safe return of the refugees; a plan which if it had been effected would likely have forestalled the ensuing multi-million death toll in the Congo. Moreover, the UN Rwanda Emergency office in Nairobi was, in fact, manned by US Army officers and acted as the operational headquarters of the RPF. Finally, not only did US Special Forces fight alongside the RPF during this period, but intercepted radio messages from Kagame to his forces in the field suggest that both Belgian and Canadian forces were involved as well.

Operating, then, under the Orwellian pretext of ‘hunting for genocidaires’, Kagame & Co. conducted a decade long invasion/occupation of Zaire/Congo. The overall strategic thrust of this assault was threefold. First, it was an attack on French interests in Africa, interests that were immediately taken over by the United States. Second, the assault was part and parcel of the overthrow of Mobutu (toppled in May of 1997). Ultimately, however, the capture of the Congo was about booty. As such, this single treasure chest contains not only large deposits of diamonds, gold, copper, uranium and tantalum (used in computers and cell phones), but also much of the world’s reserves of chrome, platinum and cobalt.

To the question then, ‘Whose genocides were they?’, the answer yet resounds through the din of propaganda, ‘They were ours’.

Shaking Hands With The Devil

In assessing responsibility for the tragedy of Rwanda – and the ensuing events in Zaire/Congo – we must not stop at those already indicted in this essay. For none of this could have happened without the overt complicity of numerous ‘humanitarian’ NGOs including especially, Human Rights Watch, which, in the early days prior to the RPF’s final solution, headed up a totally bogus, unsubstantiated report (issued March 6, 1993) condemning (and so de-legitimizing in advance) the Rwandan government for a ‘genocide’ that, in fact, had yet to take place – and which would, in the event, be committed by the very agents it conspired to defend, i.e. the RPF. And, naturally, none of this could have happened without the willing complicity of the Western mass media who swallowed hook, line and sinker every piece of propaganda issued by the Clinton Administration[16].

As Canadians we are more than ordinarily complicit as it was the Canadian government (under Jean Chretien) that worked hand-in-glove with the Americans throughout this period. In particular, of course, three Canadians, Louise Arbour, General Maurice Baril and General Romeo Dallaire played leading roles in the ‘affair’. For services rendered they were, all three, handsomely rewarded: Arbour, as already mentioned, with promotion as Supreme Court Justice and thence as UN High Commissioner for Human Rights; Baril with promotion to Chief of Staff of the Canadian Armed Forces (in Sept. 1997), and Dallaire with appointment as Canadian Senator for life.

Of the three, however, Dallaire’s role is particularly noteworthy, for it is he who has, ever since, been portrayed, and portrayed himself, as a hero in the Rwandan tragedy; and who has, as such, been pre-eminently involved in spreading and maintaining the Big Lie with respect to it. Dallaire’s 2003 epic, Shake Hands With the Devil,[17] an ironically named Faustian tract, fails spectacularly to elucidate the author’s otherwise well documented actions during the events.

It is well established, for instance, that Dallaire knew of – and, effectively, facilitated – the build-up of RPF forces inside Kigali prior to Habyarimana’s assassination. It is well established that Dallaire, rather than reporting to and receiving orders from the UN, as was his mandate, was, instead, reporting and receiving instructions from American military commanders. It is also a fact that Dallaire, only two months prior to the assassination of Habyarimana, closed down one of the only two runways[18] into Kigali airport – upon request of the RPF. It is also the case that Dallaire covered up the massacre by the RPF of MRND people elected in by-elections in the north of Rwanda in November, 1993. Evidence presented at the ICTR further implicates Dallaire in supplying intelligence to Kagame and the RPF forces throughout the period leading up to April 6, 1994.

Whenever Dallaire has faced formal questioning regarding his actions in Rwanda his testimony has been strictly managed and censored. Attempts by independent journalists and investigators to interview and question him have met with refusal and/or silence. And those questions are many and serious. Apart from the items already listed, they include:

How did the lady prime minister, Agathe Uwilingiyimana, come to be murdered at the UN development compound (the morning after Habyarimana had been assassinated) just a short time after he, Dallaire, arrived there? Why did he do nothing to save the lives of the Belgian UN soldiers – suspected of being the team that shot down Habyarimana’s plane – who were subsequently killed at Camp Kigali? Why, and under whose command, did Belgian army units in certain strategic positions in Kigali abandon them and all their weapons to the RPF? Why did UN army units attack MRND army units, but never the RPF? Why did he fail to report that US forces, using Hercules C-130 aircraft, were supplying men and weapons to the RPF? Why, when Dallaire had his headquarters at Amahoro stadium in Kigali after April 6 through the rest of the month, did he allow RPF forces to enter and subsequently murder Hutu refugees who had fled there for safety? And, of course, why did he lie about the ‘genocide fax’ of January 11, 1994?

Still, all in all, Dallaire was merely a bit player in a much larger drama, a drama written and produced in Washington, D.C.

Of Credibility and Credulity

In the two decades that have elapsed since the overthrow of the Rwandan government – and the subsequent killing of millions of it’s peoples, and those millions more killed in the Congo – the Big Lie has flourished virtually unabated. Though the likes of Robin Philpot (‘Rwanda and the New Scramble for Africa’), and Ed Herman and David Peters (‘The Politics of Genocide’) have, of late, lent this revised narrative a slightly higher profile, more generally – and notably amongst the Left – the ‘official’ narrative of Rwanda circa 1994 continues to hold sway. So much so that Rwanda has become, in Philpot’s resonant phrasing, “a useful imperial fiction”, i.e. a shining example of the ‘need for intervention’ that is deployed whenever and wherever ‘humanitarian imperialism’ seeks to invade and destroy nations opposed to it.

It need not be so. At the very least amongst the Left, it should never have been so. In the early days of the Rwandan debacle, one anomalous event stands out like the proverbial sore thumb transparently pointing the way to what was really ‘going down’ in the beleaguered nation. That event was the majority withdrawal in May of 1994 of the UN troops stationed in Rwanda, i.e. essentially clearing the way for the unobstructed overthrow of the government. This one item alone, irrespective of the fact that the corporate media habitually lies about virtually all matters of significant political import, should have tipped off observers of the Great Game to the idea that something rotten was taking place in the state of Rwanda. But it didn’t. And that, given what subsequently transpired in Yugoslavia and later Libya – where again, significant sectors of the Left bought into the official narrative – and given what is today transpiring in Syria and Ukraine, is problematic.

If there is one lesson, then, that we can take from the tragic events adumbrated herein – and, though hardly new, is a notion that bears vigorously reinforcing – it is that whatever information is fed us by the state and by the corporate mass media with regard to fundamental global strategic happenings, the only historically consistent and logical stance to take is to assume that the truth lies 180 degrees in the opposite direction. This should be our default position, until proof is rendered otherwise, in every instance.

In the meantime, to bear witness to the truth of what really happened in Rwanda falls to you. As Noam Chomsky once wrote with regard to an earlier suite of imperial crimes, ‘For yours is an historic mission, and one you should not soon forget.’

Notes:

[1] Servicing the capital city of Rwanda, Kigali.
 
[2] The US Army’s elite, commander general staff college devoted to the high-level planning of invasion scenarios.
 
[3] This despite Museveni never having held an election from the time he shot his way into power in the mid 80s up to the present day.
 
[4] Ndadaye had won the country’s first free elections, and in the aftermath of his murder, 250,000 Hutus were massacred by the Tutsi army of Burundi, and hundreds of thousands fled to Rwanda.
 
[5] One of these is Abdul Ruzibiza, former comrade-in-arms of Kagame and lieutenant in the RPF. After defecting he published a book in French (2005) accusing the RPF of having committed systematic massacres. In addition, defections from the present regime include, amongst many former high-level government figures, two former Prime Ministers, Faustin Twagiramungu and Pierre Celestin Rwigema.
 
[6] Assassinations by RPF agents of opponents to the regime have been many. Of note, however, two priests from Quebec, Claude Simard and Guy Pinard, were murdered Oct. 94 and Feb. 97 respectively. In addition, and rather chillingly, it is a matter of public record that a very long ‘hit list’ targeting opponents is, to this very day, sponsored by the Kagame regime.
 
[7] Unlike the famous Nuremberg tribunal, the ICTR omits any reference to wars of aggression or foreign intervention (the ‘supreme international crime’ according to Nuremberg), and so, effectively, condones them. Moreover, the refusal to consider who instigated the war essentially runs cover for the instigators.
 
[8] More fully, “The genocide in Rwanda was 100% the responsibility of the Americans….The United States, with the energetic support of Great Britain, did everything they could to prevent the UN from sending troops to Rwanda to stop the fighting. And they succeeded”.
 
[9] The exact numbers have never been definitively established. Initial reports claiming 800,000 were mostly pulled out of a hat. Still, later research (including testimony before the ICTR from former RPF officers themselves) seem to indicate that in the months following Habyarimana’s assassination, the numbers were, at the least, in the many hundreds of thousands, and possibly as high as two million. Hundreds of thousands of Hutus were also forced back to Rwanda at gunpoint starting in November of 1996, and hundreds of thousands more (possibly more than a million) were subsequently pursued and killed in the forests of the Congo. The Congolese themselves, of course, have suffered many millions (i.e. 5 to 10) killed in the US-backed RPF/Ugandan invasion and plundering of the east of the country since 1996.
 
[10] Evidence of this can be witnessed in the bilateral agreement that Rwanda, under Kagame, signed with the United States in 2003, giving each other immunity from prosecution; the former before the ICTR, and the latter before the International Criminal Court. Rwanda was also the only African country to back the US invasion of Iraq that same year. Moreover, much of the plunder of the Congo has since been funneled to the West through Kigali.
 
[11] For an interview of Rusesabagina (by Keith Harmon Snow) go to: http://www.allthingspass.com/uploads/html-191The%20Grinding%20Machine%20interview%20with%20Paul%20Rusesabagina%20FINAL.htm
 
[12] That is, no government minister or military officer has, of the time of writing, been convicted of conspiracy to commit genocide. Of the 60 or so high-ranking members of the government that have been indicted, roughly a dozen have been acquitted, whilst the rest remain – twenty years after the event – on trial. Ordinary Hutu prisoners have been, through various legally illegitimate means, i.e. duress, threat, deception etc, induced to plead guilty. But again, no convictions bearing on the crime of ‘genocide’ has ever taken place. Moreover, the full extent of the criminality of the court setup and proceedings at the ICTR (even to the extent of assassinations of witnesses under UN custody) is worthy of an essay in and of itself. Indeed, the latter can be had (by contacting the author) vis a vis a paper, currently in manuscript, by ICTR defense lawyer Christopher C. Black  (the ‘Rhodes Address’), and soon to be delivered in Rhodes, Greece.
 
[13] The case of the ‘genocide fax’ occupies a particularly important place in the ‘official’ narrative in as much as this was the only purported document, skimpy as it was, testifying to some measure of MRND conspiracy to a planned genocide. So important to the official storyline, in fact, that the ‘fax’ continues – despite having been exposed as a forgery before the ICTR – to be trotted out and adduced as ‘evidence’ to this very day.
 
[14] Specifically, ‘The ICTR vs General Augustin Ndindiliyimana’. Christopher C. Black was the lead defense counsel for Ndindiliyimana, the latter, having occupied the role of Chief of Staff of the Rwandan Gendamerie during the period in question. Ndindiliyimana was, just recently, acquitted of all charges at the ICTR.
 
[15] It was proved that this fake fax was put in UN files (to replace the original fax) by British Army Colonel, R.M. Connaughton, on November 28, 1995.
 
[16] Though special ‘commendation’ should go to Philip Gourevitch of the New Yorker, who was instrumental in propagandizing on behalf of the Clinton Administration and the RPF. Gourevitch was also the brother-in-law of Jamie Rubin, the right-hand man of, then, US Secretary of State, Madeleine Albright.
 
[17] Dallaire published his book three years after another Canadian author, Carol Off, published her hagiography (‘The Lion, The Fox and The Eagle’) on Dallaire, Arbour and Lewis Mackenzie. Both Dallaire and Off, it turns out, relied on the same ghostwriter / researcher, Sian Cansfield, whence the existence of passages of the first volume lifted straight into the second. Both belong on the fiction list.
 
[18] More accurately, one of the two axes of the one runway was closed.

Polish President Bronislaw Komorowski announced on Friday the official formation of a joint military unit that will include Ukrainian and Lithuanian armed forces. Known as the Lithuania-Poland-Ukraine Brigade (LITPOLUKRBRIG), the new unit of approximately 4,500 soldiers will be based near the Ukrainian border in Lublin, Poland. The unit is scheduled to begin its first exercises sometime in the next year.

The formation of the LITPOLUKRBRIG was initially agreed to in late 2009, but the plans were scuttled after the election of Victor Yanukovych in Ukraine in February 2010. Yanukovych, who was more closely aligned with Russia, was ousted in a right-wing coup in February of this year after he refused to sign an association agreement with the European Union.

The formation of the unit was announced in the wake of Ukrainian President Petro Poroshenko’s bellicose speech before a joint session of the US Congress and the ratification of the Association Agreement by the European and Ukrainian parliaments.

After the deal was officially inked by the three countries’ defense ministers, Komorowski said that the tripartite unit was “part of a wider plan to support Ukraine, among others, in the area of modernization.”

A spokesman for the Polish Defense Ministry also told reporters that while the unit would initially function as a peacekeeping force, it could serve as the nucleus for the development of a NATO battle group at some point in the future.

The right-wing, pro-Western government that has been established in Ukraine, under the leadership of Poroshenko, has been pressing for closer military ties with the United States and other NATO member states in Eastern Europe.

Lithuania became a full member of NATO in 2004. Under Article Five of the NATO treaty, which stipulates that an attack on one member is an attack on all, the United States and all other NATO states are committed to defending the Baltic States, including Lithuania, if they come under attack.

This creates the conditions where, if the newly formed unit comes under attack as part of operations in Ukraine, it could be used to trigger an Article Five response from the US and other NATO countries in Western Europe against Russia.

Last month Lithuanian President Dalia Grybauskaite stated that as a result of its alleged intervention in Ukraine in support of the separatists, Russia was “in a state of war against Europe.”

Fighting in Ukraine between Kiev-backed forces and pro-Russian separatists in the east is being used to justify an increased militarization of NATO countries in Eastern Europe as well as a campaign of economic sanctions against Russia. The official formation of the new unit is just one part of this reckless campaign being carried out by the US, European Union and NATO which threatens the possibility of war with Russia.

At the NATO summit in Wales earlier this month, alliance members agreed on plans to create a new rapid response force of approximately 4,000 soldiers that would be stationed on a rotating basis in member states that border Russia. US President Barack Obama gave an inflammatory speech in Estonia on September 3 in which he pledged America’s “eternal assistance” to the Baltic States.

On Friday, NATO also began military exercises off the coast of Romania in the Black Sea. Canada’s HMCS Toronto and Spain’s ESPS Almirante Juan de Borbón will be participating in the NATO exercise and will be stationed in the port at Varna, Bulgaria until Monday.

The Rapid Trident military exercises led by the Ukrainian armed forces and involving the US and other NATO member states are also ongoing in western Ukraine and are scheduled to conclude on September 26.

While NATO is increasing its military activities in Eastern Europe, the Contact Group on the Crisis in Ukraine—composed of representatives of Ukraine, Russia, pro-Russian separatists and the Organization for Security and Cooperation in Europe (OSCE)—met again in Minsk, Belarus. The parties are working to implement a peace deal and maintain a fragile cease fire that was implemented on September 5.

Former Ukrainian President Leonid Kuchma, representing Kiev, said that he expected “some movement forward from this meeting.” Russia’s Ambassador to Ukraine, Mikhail Zurabov, stated that “some important decisions could be adopted, which could make previous agreements more viable.”

In addition to the Contact Group meeting in Minsk, three-way talks between Ukraine, Russia, and the EU aimed at resolving an ongoing gas pricing dispute are scheduled to begin next Friday. The Russian energy company Gazprom halted deliveries of natural gas to Ukraine in June after talks over Kiev’s debt to the company collapsed and the regime refused to agree to pay immediately for new gas deliveries.

Russian Energy Minister Alexander Novak told reporters that Ukraine would not have to pay its $5.3 billion gas debt all at once. He also made clear that Russia was prepared to lower the price of natural gas from $485 to $385 per 1,000 cubic meters.

While the situation in eastern Ukraine was relatively calmer on Friday, several weeks of intermittent artillery shelling in and around the city of Donetsk have threatened to break the ceasefire. The Donetsk City Council reported one civilian death, and the Ukrainian military reported that two of its soldiers had been killed.

Since the implementation of the ceasefire, dozens of civilians have been killed or wounded by indiscriminate artillery fire. According to the United Nations, at least 2,900 people have lost their lives since Kiev began its crackdown on pro-Russian separatists in April. The UN also estimates that as many as 1 million people have been displaced by fighting in the Donbass region.

Yesterday, Israel’s Supreme Court dismissed a petition by Adalah: The Legal Center for Arab Minority Rights in Israel effectually facilitating the Judaization of more Palestinian owned land inside Israel. According to Adalah, the court’s decision holding up Israel’s Admissions Committees Law, “entrenches racial segregation; 434 small communities in Israel, or 43% of all residential areas, will be allowed to close their doors to Palestinian Arab citizens of the state.” Much of the land in question was originally confiscated from Palestinian refugees, and the court’s decision will result in the continued concentration and containment of the Palestinian population in Israel.

In March 2011, the Knesset passed two racist laws, the “Nakba Law” and the “Admissions Committees Law”, the latter granting legal legitimacy to “admission committees” in small towns, many agricultural, with fewer than 400 families in the Naqab and the Galilee to “have the full discretion to accept or reject individuals who wish to live in these towns.” The committees consisting of town residents include a member of the Jewish Agency, the World Zionist Organization, or other “quasi” government representative are able, in practice, to “filter out Arab Palestinian applicants and others from marginalized groups,“.

On March 30, 2011 Adalah filed a petition to the Supreme court of Israel demanding the cancellation of the racist law arguing:

The petitioners argued that the law allows admission committees to reject any person on the basis of his or her national belonging, sexual preference, and even on health grounds. It would also allow an admission committee to reject an Arab applicant because his or her culture different from that of the majority of persons living in a community town.

The Admission Committees Law violates Israeli domestic law and international law, which prohibit discrimination against any person who does not belong to the dominant group in society, by legitimizing the exclusion of entire groups on the basis that he or she is not suited to the “social/cultural fabric” of a community town. Specifically, the law is contrary to the Israeli Basic Law: Human Dignity and Freedom and violates basic constitutional rights, as well as the rights to privacy and to freedom to choose one’s place of residence without arbitrary restriction.

Following the court’s decision upholding the law, Suhab Bishara, the attorney for the petitioners and director of the Land and Planning Unit at Adalah issued a statement through the Institute for Middle East Understanding (IMEU) saying, “The Court’s recent decisions confirm that Palestinian citizens of Israel have no constitutional guarantees or protections of their housing rights. The Court has approved the policy of Israeli  government institutions to exclude Arabs from Jewish-only communities that are built on state land or to evict them in order to establish new Jewish communities in their place. The state claims that the communities are for the ‘general public,’ but it is clear in both policy and law that Arab citizens of Israel are not included in that definition.”

When the law was first passed in 2011 Human Rights Watch Middle East Director Sarah Leah Whitson stated the Admissions Committees Law “sanctioned discrimination”, essentially authorizing Jewish-majority communities to reject Palestinian citizens of Israel applicants for residency status, and chastised Israeli politicians “Israeli parliamentarians should be working hard to end glaring inequality, not pushing through discriminatory laws to control who can live where”.  Whitson echoed that harsh response in a comment on the court’s dismissal of Adalah’s petition: “Israel’s Supreme Court today missed a chance to overturn a law whose sponsors sought to enable Jewish communities to prevent Palestinian-Israeli citizens from living among them. The majority said it needed to wait for the law to be implemented, but a law aimed at facilitating ethnic discrimination should be treated as unlawful on its face.”

Here’s yesterday’s press release from Adalah:

(Haifa, Israel) Today, 17 September 2014, in a 5 to 4 decision, an expanded panel of the Israeli Supreme Court decided to dismiss a petition brought by Adalah three years ago against the “Admissions Committees Law”. The law allows for hundreds of Israeli Jewish communities in the Naqab (Negev) in the south and in the Galilee in the north to reject applicants for housing based on the criteria of “social suitability” and the “social and cultural fabric” of the town.

The law allows the possibility of rejecting applicants who are Palestinian Arab citizens of Israel, as well as other marginalized groups, solely on the basis of their race, ethnicity, religion, or other identity. The court’s decision effectively legalizes the principle of segregation in housing between Arab and Jewish citizens, and permits the practice of racism against Arab citizens in about 434 communities, or 43% of all towns in Israel. The Association for Civil Rights in Israel (ACRI) also filed a petition against this law.

In response, Adalah stated that the Court’s decision, “gives the green light for 434 communities to exist based on the principle of segregated housing. This law is one of the most racist pieces of legislation enacted in recent years, the primary objective of which is to marginalize Arab citizens and prevent them from accessing housing on ‘state land’ in many communities. The court’s decision upholds one of the most dangerous laws in Israel.”

Adalah Attorney Suhad Bishara, who filed the petition, added that: “The court’s decision seriously undermines its landmark decision in 1999 in the Ka’adan case. That case allowed an Arab family to move to the town of Katzir despite their rejection by the town’s admissions committee. This latest court decision illustrates the continued deterioration of the constitutional rights and legal protection of Palestinian citizens of Israel.” Attorney Bishara further stated that the new decision, “allows the principle of separation in residency based on national identity, and as such, 434 communities will be allowed to close their doors to Arab citizens.”

The Admissions Committees Law, enacted by the Knesset in 2011, gives “admissions committees” – bodies that select applicants for housing units and plots of land – almost full discretion to accept or reject individuals from living in these towns. The committees include a representative from the Jewish Agency or the World Zionist Organization, quasi-governmental entities. The Committees, in practice, filter out Arab Palestinian applicants and others from marginalized groups. While one of the provisions of the law states a duty to respect the right to equality and prevent discrimination, the law allows these committees to reject applicants deemed “unsuitable to the social life of the community…or the social and cultural fabric of the town,” thereby legitimizing the exclusion of entire groups. The law also authorizes admissions committees to adopt criteria determined by individual community towns themselves based on their “special characteristics”, including those community towns that have defined themselves as having a “Zionist vision.”

In the last hearing on the case before the Supreme Court on 4 December 2012, Attorney Bishara argued that, “the law marginalizes certain groups, creating a legal, constitutional, and legitimate basis for discrimination. The law allows for division of state land based on vague cultural and social standards – and not even the state can explain which criteria admissions committees could use to accept or reject candidates. The law will open the door to arbitrary decisions based on prejudices and personal grudges.”

Attorney Bishara added after that hearing that, “The law is functioning the same way it did previously as a policy, deterring many segments of the population, especially Palestinian Arab citizens of the state, from applying for housing in these towns for fear of rejection. The law has serious implications now and has had for many years, so it is not possible to say that it is not ripe for judicial ruling.”

This statement by Yousef Munayyer, Executive Director of the Jerusalem Fund and the Palestine Center in Washington, DC, and Palestinian citizen of Israel, perfectly reflects why Israel, a state that gives legal preference to one ethnicity under the law, does not share U.S. values:

“The upholding of this law means that the Israeli court system, along with the state, supports the practice of segregation within Israel and against Israeli citizens of Palestinian origin. For state-sanctioned and partially controlled committees to be able to deny residence within communities to certain citizens effectively based on their religion, race or ethnic origin is unthinkable in the United States – such a racist law would be shot down by the US Supreme Court because of constitutional guarantees against discrimination. But it has now been approved by the highest court in Israel. The talk of ‘shared values’ grows more farcical and the mask covering the face of an Apartheid system falls further by the day, making the ugly reality easier for the world to see.”

For more history on the Israeli legislation and court decisions precipitating today’s court decision see this Mondoweiss post, The historical context of the Israeli land and planning law regime:

Only 2.5% of land in Israel is under the control of a Palestinian controlled planning authority. [31] Moreover, in spite of a sixteen-fold increase in the built-up areas of Palestinian communities since the British Mandate, the average area of jurisdiction of Palestinian cities and local councils has, in that time, decreased by 45%. [32] Therefore, as Bimkom has stated, most Arab localities are dependent on decisions made by planning commissions which are, for the most part, devoid of Palestinian representation. [33]

Note: This report was originally published in 2010. It is of utmost relevance to the ongoing debate on climate change. .

Link to Complete 321-Page PDF Special Report

More than 1,000 dissenting scientists (updates previous 700 scientist report) from around the globe have now challenged man-made global warming claims made by the United Nations Intergovernmental Panel on Climate Change (IPCC) and former Vice President Al Gore. This new 2010 321-page Climate Depot Special Report — updated from the 2007 groundbreaking U.S. Senate Report of over 400 scientists who voiced skepticism about the so-called global warming “consensus” — features the skeptical voices of over 1,000 international scientists, including many current and former UN IPCC scientists, who have now turned against the UN IPCC. This updated 2010 report includes a dramatic increase of over 300 additional (and growing) scientists and climate researchers since the last update in March 2009. This report’s release coincides with the 2010 UN global warming summit in being held in Cancun.

The more than 300 additional scientists added to this report since March 2009 (21 months ago), represents an average of nearly four skeptical scientists a week speaking out publicly. The well over 1,000 dissenting scientists are almost 20 times the number of UN scientists (52) who authored the media-hyped IPCC 2007 Summary for Policymakers.

The chorus of skeptical scientific voices grew louder in 2010 as the Climategate scandal — which involved the upper echelon of UN IPCC scientists — detonated upon on the international climate movement. “I view Climategate as science fraud, pure and simple,” said noted Princeton Physicist Dr. Robert Austin shortly after the scandal broke. Climategate prompted UN IPCC scientists to turn on each other. UN IPCC scientist Eduardo Zorita publicly declared that his Climategate colleagues Michael Mann and Phil Jones “should be barred from the IPCC process…They are not credible anymore.”

Zorita also noted how insular the IPCC science had become. “By writing these lines I will just probably achieve that a few of my future studies will, again, not see the light of publication,” Zorita wrote. A UN lead author Richard Tol grew disillusioned with the IPCC and lamented that it had been “captured” and demanded that “the Chair of IPCC and the Chairs of the IPCC Working Groups should be removed.” Tol also publicly called for the “suspension” of IPCC Process in 2010 after being invited by the UN to participate as lead author again in the next IPCC Report. [Note: Zorita and Tol are not included in the count of dissenting scientists in this report.]

Other UN scientists were more blunt. A South African UN scientist declared the UN IPCC a “worthless carcass” and noted IPCC chair Pachauri is in “disgrace”. He also explained that the “fraudulent science continues to be exposed.” Alexander, a former member of the UN Scientific and Technical Committee on Natural Disasters harshly critiqued the UN. “‘I was subjected to vilification tactics at the time. I persisted. Now, at long last, my persistence has been rewarded…There is no believable evidence to support [the IPCC] claims. I rest my case!” See: S. African UN Scientist Calls it! ‘Climate change – RIP: Cause of Death: No scientifically believable evidence…Deliberate manipulation to suit political objectives’ [Also see: New Report: UN Scientists Speak Out On Global Warming -- As Skeptics!] Geologist Dr. Don Easterbrook, a professor of geology at Western Washington University, summed up the scandal on December 3, 2010: “The corruption within the IPCC revealed by the Climategate scandal, the doctoring of data and the refusal to admit mistakes have so severely tainted the IPCC that it is no longer a credible agency.”

Selected Highlights of the Updated 2010 Report featuring over 1,000 international scientists dissenting from man-made climate fears:

“We’re not scientifically there yet. Despite what you may have heard in the media, there is nothing like a consensus of scientific opinion that this is a problem. Because there is natural variability in the weather, you cannot statistically know for another 150 years.”

— UN IPCC’s Tom Tripp, a member of the UN IPCC since 2004 and listed as one of the lead authors and serves as the Director of Technical Services & Development for U.S. Magnesium.

“Any reasonable scientific analysis must conclude the basic theory wrong!!” — NASA Scientist Dr. Leonard Weinstein who worked 35 years at the NASA Langley Research Center and finished his career there as a Senior Research Scientist. Weinstein is presently a Senior Research Fellow at the National Institute of Aerospace.

“Please remain calm: The Earth will heal itself — Climate is beyond our power to control…Earth doesn’t care about governments or their legislation. You can’t find much actual global warming in present-day weather observations. Climate change is a matter of geologic time, something that the earth routinely does on its own without asking anyone’s permission or explaining itself.”

— Nobel Prize-Winning Stanford University Physicist Dr. Robert B. Laughlin, who won the Nobel Prize for physics in 1998, and was formerly a research scientist at Lawrence Livermore National Laboratory.

“In essence, the jig is up. The whole thing is a fraud. And even the fraudsters that fudged data are admitting to temperature history that they used to say didn’t happen…Perhaps what has doomed the Climategate fraudsters the most was their brazenness in fudging the data”

— Dr. Christopher J. Kobus, Associate Professor of Mechanical Engineering at Oakland University, specializes in alternative energy, thermal transport phenomena, two-phase flow and fluid and thermal energy systems.

“The energy mankind generates is so small compared to that overall energy budget that it simply cannot affect the climate…The planet’s climate is doing its own thing, but we cannot pinpoint significant trends in changes to it because it dates back millions of years while the study of it began only recently. We are children of the Sun; we simply lack data to draw the proper conclusions.”

— Russian Scientist Dr. Anatoly Levitin, the head of geomagnetic variations laboratory at the Institute of Terrestrial Magnetism, Ionosphere and Radiowave Propagation of the Russian Academy of Sciences.

“Hundreds of billion dollars have been wasted with the attempt of imposing a Anthropogenic Global Warming (AGW) theory that is not supported by physical world evidences…AGW has been forcefully imposed by means of a barrage of scare stories and indoctrination that begins in the elementary school textbooks.”

— Brazilian Geologist Geraldo Luís Lino, who authored the 2009 book “The Global Warming Fraud: How a Natural Phenomenon Was Converted into a False World Emergency.”

“I am an environmentalist,” but “I must disagree with Mr. Gore” — Chemistry Professor Dr. Mary Mumper, the chair of the Chemistry Department at Frostburg State University in Maryland, during her presentation titled “Anthropogenic Carbon Dioxide and Global Warming, the Skeptic’s View.”

“I am ashamed of what climate science has become today.” The science “community is relying on an inadequate model to blame CO2 and innocent citizens for global warming in order to generate funding and to gain attention. If this is what ‘science’ has become today, I, as a scientist, am ashamed.”

— Research Chemist William C. Gilbert published a study in August 2010 in the journal Energy & Environment titled “The thermodynamic relationship between surface temperature and water vapor concentration in the troposphere” and he published a paper in August 2009 titled “Atmospheric Temperature Distribution in a Gravitational Field.” [Update December 9, 2010]

“The dysfunctional nature of the climate sciences is nothing short of a scandal. Science is too important for our society to be misused in the way it has been done within the Climate Science Community.” The global warming establishment “has actively suppressed research results presented by researchers that do not comply with the dogma of the IPCC.”

— Swedish Climatologist Dr. Hans Jelbring, of the Paleogeophysics & Geodynamics Unit at Stockholm University. [Updated December 9, 2010. Corrects Jelbring's quote.]

“Those who call themselves ‘Green planet advocates’ should be arguing for a CO2- fertilized atmosphere, not a CO2-starved atmosphere…Diversity increases when the planet was warm AND had high CO2 atmospheric content…Al Gore’s personal behavior supports a green planet – his enormous energy use with his 4 homes and his bizjet, does indeed help make the planet greener. Kudos, Al for doing your part to save the planet.”

— Renowned engineer and aviation/space pioneer Burt Rutan, who was named “100 most influential people in the world, 2004″ by Time Magazine and Newsweek called him “the man responsible for more innovations in modern aviation than any living engineer.”

“Global warming is the central tenet of this new belief system in much the same way that the Resurrection is the central tenet of Christianity. Al Gore has taken a role corresponding to that of St Paul in proselytizing the new faith…My skepticism about AGW arises from the fact that as a physicist who has worked in closely related areas, I know how poor the underlying science is. In effect the scientific method has been abandoned in this field.”

— Atmospheric Physicist Dr. John Reid, who worked with Australia’s CSIRO’s (Commonwealth Scientific and Industrial Research Organization) Division of Oceanography and worked in surface gravity waves (ocean waves) research.

“We maintain there is no reason whatsoever to worry about man-made climate change, because there is no evidence whatsoever that such a thing is happening.” — Greek Earth scientists Antonis Christofides and Nikos Mamassis of the National Technical University of Athens’ Department of Water Resources and Environmental Engineering.

“There are clear cycles during which both temperature and salinity rise and fall. These cycles are related to solar activity…In my opinion and that of our institute, the problems connected to the current stage of warming are being exaggerated. What we are dealing with is not a global warming of the atmosphere or of the oceans.”

— Biologist Pavel Makarevich of the Biological Institute of the Russian Academy of Sciences.

“Because the greenhouse effect is temporary rather than permanent, predictions of significant global warming in the 21st century by IPCC are not supported by the data.” — Hebrew University Professor Dr. Michael Beenstock an honorary fellow with Institute for Economic Affairs who published a study challenging man-made global warming claims titled “Polynomial Cointegration Tests of the Anthropogenic Theory of Global Warming.”

“The whole idea of anthropogenic global warming is completely unfounded. There appears to have been money gained by Michael Mann, Al Gore and UN IPCC’s Rajendra Pachauri as a consequence of this deception, so it’s fraud.” — South African astrophysicist Hilton Ratcliffe, a member of the Astronomical Society of Southern Africa (ASSA) and the Astronomical Society of the Pacific and a Fellow of the British Institute of Physics.

End of Selected Excerpts

#

The rapidity of the global warming establishment’s collapse would have been unheard of just two years ago. Prominent physicist Hal Lewis resigned from American Physical Society, calling “Global warming the greatest and most successful pseudoscientific fraud I have seen in my long life.” UK astrophysicist Piers Corbyn was blunt about what Climategate revealed: “The case for climate fears is blown to smithereens…the whole theory should be destroyed and discarded and UN conference should be closed.”

Even the usually reliable news media has started questioning the global warming claims. Newsweek Magazine wrote in May 2010 about the “uncertain science” and how “climate researchers have lost the public’s trust” from a “cascade of scandals” from the UN IPCC. Newsweek compared the leaders of the climate science community to “used-car salesmen. “Once celebrated climate researchers are feeling like the used-car salesmen” and the magazine noted that “some of IPCC’s most-quoted data and recommendations were taken straight out of unchecked activist brochures, newspaper articles…Just as damaging, many climate scientists have responded to critiques by questioning the integrity of their critics, rather than by supplying data and reasoned arguments.” For full list of Climategate related scandals See: Climate Scandals: List Of 94 Climate-Gates — 94 climate-gates total — 28 new gates — 145 links to reports with details

As the global warming edifice crumbled in 2010, the movement lost one of its leading lights due to the Climategate revelations. Dr. Judith Curry, the chair of Earth & Atmospheric Sciences at GA Institute of Tech, explained her defection from the global warming activist movement. “There is ‘a lack of willingness in the climate change community to steer away from groupthink…’ They are setting themselves up as second-rate scientists by not engaging,” Curry wrote in 2010. Curry critiqued the UN IPCC for promoting “dogma” and clinging to the “religious importance” of the IPCC’s claims. “They will tolerate no dissent and seek to trample anyone who challenges them,” Curry lamented. “The IPCC assessment process had a substantial element of schoolyard bullies, trying to insulate their shoddy science from outside scrutiny and attacks by skeptics…the IPCC and its conclusions were set on a track to become a self fulfilling prophecy,” Curry wrote. Curry called the Climategate fallout nothing short of a “rather spectacular unraveling of the climate change juggernaut…I immediately realized that [Climategate] could bring down the IPCC…I became concerned about the integrity of our entire field…While my colleagues seemed focused on protecting the reputations of the scientists involved and assuring people that the ‘science hadn’t changed.” [Note: Curry is not included in the count of dissenting scientists in this report.] Also see: ‘High Priestess of Global Warming’ No More! Former Warmist Judith Curry Admits To Being ‘Duped Into Supporting IPCC’ – ‘If the IPCC is dogma, then count me in as a heretic’] [Note: There were many Cilmategate inquiries that sought to downplay Climategate, but they fell short of their goal and were labeled as nothing more than the "global warming establishment exonerating the global warming establishment." See here, here, and here. The InterAcademy Council (IAC) was the most competent of the inquires.]

As new data and science continued to call into question man-made global warming claims, one of the movements leading fear promoters shocked the world by beginning to retreat from his dire predictions. Green guru James Lovelock warned in 2007 that, “Before this century is over, billions of us will die and the few breeding pairs of people that survive will be in the Arctic.” Lovelock illustrates how the climate of the climate change movement has been transformed in the last year. In May 2010, Lovelock shocked the world by announcing: “Everybody might be wrong. Climate change may not happen as fast as we thought, and we may have 1,000 years to sort it out.” Lovelock went even father by noting how the science of global warming is in its infancy and “we haven’t got the physics worked out yet.” “The great climate science centers around the world are more than well aware how weak their science is. If you talk to them privately they’re scared stiff of the fact that they don’t really know what the clouds and the aerosols are doing. They could be absolutely running the show. We haven’t got the physics worked out yet,” Lovelock explained. Lovelock now openly praises skeptics and worries that climate fear promotion is akin to religion. In March of 2010, Lovelock said: “The skeptics have kept us sane…They have kept us from regarding climate science as a religion. It had gone too far that way.” [Note: Lovelock is not included in the count of dissenting scientists in this report.] [Note: Even the UN has grown more uncertain about the science. See: UN Fears (More) Global Cooling Commeth! IPCC Scientist Warns UN: We may be about to enter 'one or even 2 decades during which temps cool' -- Admits 'Jury is still out' on ocean cycle's temp impact!]

More woes for the movement were felt when left-leaning environmental activists began jumping ship. See: Left-wing Env. Scientist Denis Rancourt Bails Out Of Global Warming Movement: Declares it a ‘corrupt social phenomenon…strictly an imaginary problem of the 1st World middleclass’ & Meet the green who doubts ‘The Science’: Environmentalist Peter Taylor ‘explains why he’s skeptical about manmade global warming — and why greens are so intolerant’ & Activists at green festivals expressing doubts over man-made climate fears. “One college professor, confided to me in private conversation that, ‘I’m not sure climate change is real,’” according to a report from the New York Green Festival.

2010 saw the once vaunted UN IPCC now become the object of ridicule and scrutiny. In June 2010, Climate Scientist Mike Hulme took apart a key claim. Hulme noted that claims such as “2,500 of the world’s leading scientists have reached a consensus that human activities are having a significant influence on the climate” are disingenuous. Hulme noted that the key scientific case for Co2 driving global warming was reached by a very small gaggle of people. “That particular consensus judgment, as are many others in the IPCC reports, is reached by only a few dozen experts in the specific field of detection and attribution studies; other IPCC authors are experts in other fields.” [Note: Hulme is not included in the count of dissenting scientists in this report.]

In another blow to the UN IPCC’s carefully crafted image, was Scientist Dr. William Schlesinger admission in that only 20% of UN IPCC scientists deal with climate. Schlesinger said, “Something on the order of 20 percent [of UN scientists] have had some dealing with climate.” By Schlesinger’s own admission, 80% of the UN IPCC membership has no dealing with the climate as part of their academic studies. Also note, that climate requires a wide range of disciplines: See: ‘There are more than 100 expert sub disciplines involved in climate change studies’ & Science magazine confused about who is a ‘prominent climate scientist’ — ‘there is no specific climate discipline’ & Claims of ‘overwhelming majority’ of scientists exposed as laughable! ‘There are just 94 authors responsible for compiling the report in which…the [UN IPCC's] modeling case for alarm rests’

The notion of climate “tipping points”, popularized by former Vice President Al Gore and NASA Scientist James Hansen, became the object of derision as well in 2010. See: 190-year climate ‘tipping point’ issued — Despite fact that UN began 10-Year ‘Climate Tipping Point’ in 1989! Climate Depot Factsheet on Inconvenient History of Global Warming ‘Tipping Points’ — Hours, Days, Months, Years, Millennium — Earth ‘Serially Doomed’

Once respected global warming stalwarts like NASA’s James Hansen descended into political and ideological activism by being arrested multiple times protesting coal use. Hansen also endorsed a book which calls for ‘”ridding the world of Industrial Civilization”. Hansen declared the author “has it right…the system is the problem.” Hansen did this despite the fact that the book proposes ‘”razing cities to the ground, blowing up dams and switching off the greenhouse gas emissions machine.” The Grist eco-magazine writer David Roberts noted in August 2010: “‘I know I’m not supposed to say this, but James Hansen managed his transition from scientist to activist terribly. All influence lost.”

Energy Sec. Chu came under fire for claiming science told him what the world was going to be like 100 years from now. See: Obama’s ‘Climate Astrologer’: Energy Sec. Chu claims he knows ‘what the future will be 100 years from now’

Obama Science Advisor John Holdren found his knowledge of the science of climate change come under scrutiny after he issued a bizarre warning about the possible loss of WINTER sea ice in the arctic. See: Obama science advisor: John Holdren ridiculed for claiming Arctic could be ICE FREE IN WINTER!

The U.S. Congressional cap-and-trade bill collapse and the UN climate treaty failure has left disillusioned within the global warming movement. Gore has admitted to feeling “a little depressed.” And it has left a spectacle of world leaders promising verbal non-binding agreements to limit the earth’s temp have left modern society attempting to ape primitive cultures efforts to control the climate. See: Blaming all recent weather events on man-made global warming is akin to astrology & Climate Astrology — ‘It Has Been Foretold’ of Extreme Weather: ‘UN IPCC science has a status similar to interpretations of Nostradamus and the Mayan calendars’

In addition, the scientific underpinnings and the public support around the globe has dropped so significantly that there is now open talk of moving on to the “next eco-scare” Demoted: UN officially throws global warming under the bus: UN now says case for saving species ‘more powerful than climate change’ – May 21, 2010 & Time for next eco-scare already?! As Global Warming Movement Collapses, Activists Already ‘Test-Marketing’ the Next Eco-Fear! ‘Laughing Gas’ Crisis? Oxygen Crisis? Plastics?

The carefully crafted “consensus” of man-made global warming has unraveled. See:

Prominent Geologist Dr. Easterbrook Slams Geological Society of America’s climate statement ‘as easily refuted by data that clearly shows no correlation between CO2 and global climate change’ & American Meteorological Society Members Reject Man-made Climate Claims: 75% Do Not Agree With UN IPCC Claims — 29% Agree ‘Global Warming is a Scam’ & Meteorologists Reject U.N.’s Global Warming Claims: Only 1 in 4 American Meteorological Society broadcast meteorologists agree with UN

In 2009, the world’s largest science group, the American Chemical Society (ACS) was “startled” by an outpouring of scientists rejecting man-made climate fears, with many calling for the removal of the ACS’s climate activist editor.

A 2010 Open Letter signed by more than 130 German scientists urging German Chancellor to “reconsider” her climate views. See: ‘Consensus’ Takes Another Hit! More than 130 German Scientists Dissent Over Global Warming Claims! Call Climate Fears ‘Pseudo ‘Religion’; Urge Chancellor to ‘reconsider’ views – August 4, 2009 More than 100 international scientists challenged President Obama’s climate claims, calling them “simply incorrect.” In December 8 2009, 166 scientists from around the world wrote an Open Letter to the UN Secretary-General rebuking the UN and declaring that “the science is NOT settled.” On May 1, 2009, the American Physical Society (APS) Council decided to review its current climate statement via a high-level subcommittee of respected senior scientists. The decision was prompted after a group of over 80 prominent physicists petitioned the APS revise its global warming position and more than 250 scientists urged a change in the group’s climate statement in 2010. The physicists wrote to APS governing board: “Measured or reconstructed temperature records indicate that 20th – 21st century changes are neither exceptional nor persistent, and the historical and geological records show many periods warmer than today.” An American Physical Society editor conceded that a “considerable presence” of scientific skeptics exists.

Russian scientists “rejected the very idea that carbon dioxide may be responsible for global warming”. India Issued a report challenging global warming fears. International Scientists demanded the UN IPCC “be called to account and cease its deceptive practices,” and a 2008 canvass of more than 51,000 Canadian scientists revealed 68% disagree that global warming science is “settled.”

Scientific meetings are being dominated by a growing number of skeptical scientists. The prestigious International Geological Congress, dubbed the geologists’ equivalent of the Olympic Games, was held in Norway in August 2008 and prominently featured the voices of scientists skeptical of man-made global warming fears. [See: Skeptical scientists overwhelm conference: '2/3 of presenters and question-askers were hostile to, even dismissive of, the UN IPCC' & see full reports here & here - Also see: UN IPCC's William Schlesinger admits in 2009 that only 20% of IPCC scientists deal with climate ]

Despite these developments, global warming promoters have sought to cite a survey alleging 97% of climatologists agree with the “consensus” view. But the survey does not hold up to scrutiny. See: ‘Consensus’ claims challenged: Only 77 scientists were interviewed to get 97.4% agreement — ‘It would be interesting to learn who these individuals are’ & Climate Con: 97% ‘Consensus’ Claim is only 76 Anonymous Self-Selected Climatologists

#

This Climate Depot Special Report is not a “list” of scientists, but a report that includes full biographies of each scientist and their quotes, papers and links for further reading. The scientists featured in the report express their views in their own words, complete with their intended subtleties and caveats. This report features the names, biographies, academic/institutional affiliation, and quotes of literally hundreds of additional international scientists who publicly dissented from man-made climate fears. This report lists the scientists by name, country of residence, and academic/institutional affiliation. It also features their own words, biographies, and web links to their peer reviewed studies, scientific analyses and original source materials as gathered from directly from the scientists or from public statements, news outlets, and websites in 2007 and 2008.

The distinguished scientists featured in this new report are experts in diverse fields, including: climatology; geology; biology; glaciology; biogeography; meteorology; oceanography; economics; chemistry; mathematics; environmental sciences; astrophysics, engineering; physics and paleoclimatology. Some of those profiled have won Nobel Prizes for their outstanding contribution to their field of expertise and many shared a portion of the UN IPCC Nobel Peace Prize with Vice President Gore. Additionally, these scientists hail from prestigious institutions worldwide, including: Harvard University; NASA; National Oceanic and Atmospheric Administration (NOAA) and the National Center for Atmospheric Research (NCAR); Massachusetts Institute of Technology; the UN IPCC; the Danish National Space Center; U.S. Department of Energy; Princeton University; the Environmental Protection Agency; University of Pennsylvania; Hebrew University of Jerusalem; the International Arctic Research Centre; the Pasteur Institute in Paris; Royal Netherlands Meteorological Institute; the University of Helsinki; the National Academy of Sciences of the U.S., France, and Russia; the University of Pretoria; University of Notre Dame; Abo Akademi University in Finland; University of La Plata in Argentina; Stockholm University; Punjab University in India; University of Melbourne; Columbia University; the World Federation of Scientists; and the University of London.

Background: Only 52 Scientists Participated in UN IPCC Summary

The notion of “hundreds” or “thousands” of UN scientists agreeing to a scientific statement does not hold up to scrutiny. (See report debunking “consensus” LINK) Recent research by Australian climate data analyst John McLean revealed that the IPCC’s peer-review process for the Summary for Policymakers leaves much to be desired. (LINK) (LINK) (LINK) & (LINK) (Note: The 52 scientists who participated in the 2007 IPCC Summary for Policymakers had to adhere to the wishes of the UN political leaders and delegates in a process described as more closely resembling a political party’s convention platform battle, not a scientific process – LINK)

Proponents of man-made global warming like to note how the National Academy of Sciences (NAS) and the American Meteorological Society (AMS) have issued statements endorsing the so-called “consensus” view that man is driving global warming. But both the NAS and AMS never allowed member scientists to directly vote on these climate statements. Essentially, only two dozen or so members on the governing boards of these institutions produced the “consensus” statements. This report gives a voice to the rank-and-file scientists who were shut out of the process. (LINK)

The NAS has come under fire for its lobbying practices. See: NAS Pres. Ralph Cicerone Turns Science Org. into political advocacy group: $6 million NAS study is used to lobby for global warming bill & Cicerone’s Shame: NAS Urges Carbon Tax, Becomes Advocacy Group — ‘political appointees heading politicized scientific institutions that are virtually 100% dependent on gov’t funding’ MIT’s Richard Lindzen harshly rebuked NAS president Cicerone in his Congressional testimony in November 2010. Lindzen testified: “Cicerone [of NAS] is saying that regardless of evidence the answer is predetermined. If government wants carbon control, that is the answer that the Academies will provide.” [ Also See: MIT Climate Scientist Exposes 'Corrupted Science' in Devastating Critique – November 29, 2008 ]

While the scientists contained in this report hold a diverse range of views, they generally rally around several key points. 1) The Earth is currently well within natural climate variability. 2) Almost all climate fear is generated by unproven computer model predictions. 3) An abundance of peer-reviewed studies continue to debunk rising CO2 fears and, 4) “Consensus” has been manufactured for political, not scientific purposes.

Scientists caution that the key to remember is “climate change is governed by hundreds of factors, or variables,” not just CO2. UK Professor Emeritus of Biogeography Philip Stott of the University of London decried the notion that CO2 is the main climate driver. “As I have said, over and over again, the fundamental point has always been this: climate change is governed by hundreds of factors, or variables, and the very idea that we can manage climate change predictably by understanding and manipulating at the margins one politically-selected factor is as misguided as it gets,” Stott wrote in 2008. Even the climate activists at RealClimate.org let this fact slip out in a September 20, 2008 article. “The actual temperature rise is an emergent property resulting from interactions among hundreds of factors,” RealClimate.org admitted in a rare moment of candor.]

# #

Read Full Report: Link to Complete 321-Page PDF Special Report:

Copyright Climate Depot 2014

This is an excellent detailed analysis of the MH17 tragedy by the Russian Union of Engineers which quite frankly illustrates how heavily censored the Dutch “report” is.

We will let you digest this report and come to your own conclusion, which in all likelihood will explain the infamous high velocity projectiles whitewash pumped out by the western “press”.

This review was undertaken by experts who not only know the subject matter but have objectively presented evidence that must be considered with the legitimacy that is inherent to it. Here is the overall description of the “Analytical Group” from the report:

A group of experts from the Russian Union of engineers was convened to analyze the situation, including reserve officers with experience in the use of anti-aircraft missile systems, as well as pilots having experience with aircraft weapons.This problem was also discussed at a meeting of the Academy of Geopolitical Problems, where many variants were tested and discussed again. In the course of their analysis the experts used materials derived from public sources, found in the media. The situation was also analyzed using a computer simulation of the Su-25.

You can download the English version of the report here.

The original Russian version of the report is here.

Official statement by the Russian Union of Engineers:
(please press on the ‘cc’ button to see the English subtitles)

Special mention, thanks and much gratitude goes to Alice, Gideon & Katya for their wonderful effort at such short notice.
 
Disclaimer:

We have translated the text to the best of our abilities and where unsure have included the original Russian. Additionally, the original Russian report is available for download for your reference. Please distribute freely with acknowledgement.

Copyright the Saker 2014

Europe’s nations should be guided towards the super-state without their people understanding what is happening. This can be accomplished by successive steps, each disguised as having an economic purpose, but which will eventually and irreversibly lead to federation. Jean Monnet (One of the Founders of the EU in a letter to a colleague on April 30th, 1952)

It is more evident that Scotland’s referendum on independence has been “rigged.” Observers from Russia say there was evidence of election fraud according to RIA Novosti based in Moscow.

“According to what our observers at the polling offices tell us, there were more Yes votes during the vote count. Scotland found itself under immense pressure… Those on the UK side campaigning for a No vote resorted to every violation imaginable,” Georgy Fyodorov, the head of the Association for the protection of electoral rights “Civil control.”

Washington and London have a vested interest on Scotland. Elections results were going to be tampered with. The Anglo-American military alliance would prevent any possibility of Scottish Independence under their watch. Scotland is a strategic military location. The British government will call it ‘Democracy in action” and that the Scotland wants to remain united with the crown. “Igor Morozov, a member of the Council of the Federation Committee for Foreign Affairs, said that the results were influenced by “Westminster propaganda” according to the report, “We can see that, with the exception of Glasgow, those supporting independence failed to register a majority. I think that Westminster propaganda played a great part in that.” The London-based Telegraph reported in 2013 that British Prime Minister David Cameron had begun a propaganda war against Scottish Independence when he publically made his case on the history both countries share:

Our nations share a proud and emotional history. Over three centuries we have built world-renowned institutions like the NHS and BBC, fought for freedom and democracy in two World Wars, and pioneered and traded around the world. Our ancestors explored the world together and our grandfathers went into battle together as do our kith and kin today – and this leaves deep, unbreakable bonds between the peoples of these islands.

Scotland lost its bid for independence, even though it was a fraudulent election. The mainstream media especially the BBC will bury it. They will produce stories about the growing threat of ISIS in the Middle East or on the personal life of Prince Harry. After the final tally in Scotland’s referendum vote, 55 percent voted ‘No’ to remain in the union with Great Britain and 45 percent who voted for independence. U.S. President Barack H. Obama said “We have no closer ally than the United Kingdom, and we look forward to continuing our strong and special relationship with all the people of Great Britain and Northern Ireland as we address the challenges facing the world today.”

Scotland’s historic vote after 307 years of British rule has inspired people across Europe and the World. Scotland’s unprecedented vote has inspired other succession movements including Catalonia and Basque country in Spain to Veneto, South Tyrol, and the island of Sardinia in Italy to Flanders in Belgium which concerns the bureaucrats at the European Union’s headquarters in Brussels. Before the elections took place, American politicians such as Hillary Clinton did not support the idea of an independent Scotland when she was quoted in a BBC interview as saying “I would hate to have you lose Scotland. I hope it doesn’t happen, but again I don’t have a vote in Scotland, but I would hope it doesn’t happen.”

Her husband and former US president Bill said “Unity with maximum self-determination sends a powerful message to a world torn by identity conflicts that it is possible to respect our differences while living and working together” he said. “This is the great challenge of our time. The Scots can show us how to meet it.”

Queen Elizabeth also urged the Scottish people to” think very carefully about the future” since it would have political repercussions in the British Empire. After all, the British Empire was never dismantled; it is now behind the scenes.

Make no mistake; Great Britain is still an influential empire. Just like its counterpart in Washington with Puerto Rico and Guam as its territories, it too has colonial possessions although they call it ‘British Overseas territories’ in the Caribbean, South and North Atlantic ocean and elsewhere. It is closely associated with Washington’s global Hegemony or what Dr. Henry Kissinger would call the ‘New World Order.’ Major Powers’ have collaborated with each other on global issues since World War I with the United States, Great Britain, France and the mini-empire of Israel leading the way to a unipolar world ruled by an elite oligarchy.

Empires of the past and present have caused great harm to humanity. Wars, economic exploitation, political control and other destructive devices have brought misery, pain and suffering to every region of the world. The entire continent of Africa is a perfect example which has been ruled by a number of Western empires throughout its history. Scotland is another country that has been colonized by the British for centuries. Mel Gibson’s academy award winning film ‘Braveheart’ depicted the wars fought between England and its vast army and the people of Scotland who were slaves to the English Monarchy in the 12th century.

Why an Independent Scotland is Inconvenient for NATO and American Foreign Policy

What an Independent Scotland would mean for the United States and Great Britain? First, Britain’s nuclear arsenal would no longer be deployed at Faslane, in the west coastline of Scotland were British nuclear-armed submarines are stationed which would weaken NATO’s position in the North Sea and Arctic regions as it would also limit the usage of Scotland’s ports for U.S. submarine fleets. Scotland has been a staging ground for NATO’s defenses including “early warning stations” to supposedly counter a Russian attack. The Scottish National Party (SNP) had rejected the idea that Scotland would serve as a nuclear deterrence by banning nuclear weapons. Scotland would not be able to participate in NATO’s defense by contributing just 2 percent of its GDP to join the organization; NATO would refuse its entry on economic grounds. Scotland would establish its own defense at a cost of £2.5 billion. According to an article by the Telegraph titled ‘Scotland will be powerless to defend itself’ which was written by John McAnally, a former Commandant of the Royal College of Defence Studies. He described Scotland’s military plans if independence were to become a reality:

If the SNP wins independence, it plans to establish a new defence force of some 15,000 regulars and 5,000 reserves. The naval base at Faslane would become the joint headquarters. The Scottish army would include restored infantry regiments, army vehicles, artillery and air defence systems. The air force would have fighter jets, maritime patrols, transport aircraft and helicopters. The navy would include frigates, conventional submarines and marines. There would also be some special forces, and provision for intelligence, counter-terrorism and cyber-security. All this is to be achieved within an annual budget of about £2.5 billion – a fraction of the MoD’s current spending of £34 billion.

Mr. McAnally also explained it would cost the British government billions to rebuild the necessary infrastructure needed to house its nuclear arsenal. He says it would be difficult to find an alternative to Faslane naval base which would also become costly just to relocate:

It is also difficult to envisage a workable alternative to the Faslane naval base, currently home to Britain’s nuclear deterrent and the Navy’s hunter-killer submarines. It would cost many billions to relocate the infrastructure built up over decades, such as the Coulport Naval Armament Depot, which stores our torpedoes, missiles and nuclear warheads. If Britain were expelled from Faslane, there is every possibility that it could be forced into unilateral nuclear disarmament.

Why is Britain worried about Scotland’s defense and from whom? Who would attack Scotland? The Western funded ‘ISIS’ terrorist organization? Or from Russia who is threatened by NATO’s expansion close to its borders? I believe Scotland wants peace, not war. They will be diplomatic in every sense when it comes to foreign policy. Great Britain’s history has only shown to be a force for war and occupation.

As we have seen in the past, countries that don’t want to operate under the ‘New World Order’ apparatus would be considered enemies of Democracy.” Russia is an example. So is China, Ecuador, Cuba, Bolivia, Nicaragua, Venezuela, Zimbabwe, Syria and Iran are also enemies of Democracy according to the Anglo-American empire, because the “enemies of Democracy” want their nations to remain a “Sovereign entity”. Not under an “international Order controlled by the West. Over the years, political and financial elites from the U.S. and Europe had planned a single global power to control every nation on earth. In the last century, the establishment has called for a single power of authority that can dominate the financial, political and social landscapes of every nation. In 1992, President Clinton’s Deputy Secretary of State, Strobe Talbot was quoted in Time magazine and said “in the next century, nations as we know it will be obsolete; all states will recognize a single, global authority. National sovereignty wasn’t such a great idea after all.” Well not according to the Scottish people. Although they lost the ‘Yes’ vote, freedom and independence from British rule can still become a reality in the future.

The reason Western powers oppose Independence for Scotland or any other nation that seeks sovereignty is that they would lose the power of control, a power that seeks to undermine sovereignty. The only time the west supports Independence of any nation if they benefit from natural resources as in the case of the South Sudan’s independence in 2011. Professor Carroll Quigley of Georgetown University wrote in his book ‘Tragedy and Hope’ what was the purpose of establishing the Council of Foreign Relations (CFR) in New York City, an influential institution for Washington’s and its allies concerning foreign policy. He wrote “The Council on Foreign Relations (CFR) is the American Branch of a society which originated in England … (and) … believes national boundaries should be obliterated and one-world rule established.” It’s not over for Scottish Independence. It is just the beginning and the Scots proved it by voting in an unprecedented fashion. What will happen next, a recount? How about a call for a new referendum that will be monitored by the international community? That might work.

As the US and Europe prepare another round of sanctions against Russia over the ongoing Ukrainian conflict, the third round of such sanctions since the conflict began shortly after the Euromaidan unrest resulted in the installation of a NATO-backed regime in Kiev, a curious and inexplicable oversight appears to have been made.

While wild accusations have been leveled against Russia over its involvement over the violence in Ukraine, claims ranging from covert support up to and including unsubstantiated claims of a “full scale invasion,” prominent media organizations across the Western World have for years reported a flow of cash, weapons, equipment and fighters from America’s allies in the Persian Gulf as well as from nations like NATO member Turkey, and into the conflict raging within Syria’s borders.

While baseless claims leveled against Russia have served as ample justification for the West to continue leveling sanctions against Moscow, no sanctions have as of yet been leveled against the overt sponsors of militancy and, in fact, terrorism in Syria. So widespread has state-sponsored terrorism become in the Middle East that what began as a limited proxy war against Syria has transformed into an immense regional army with tens of thousands of paid soldiers requiring millions of dollars a day to operate across multiple borders and confounding the forces of Iraq, Syria, and Lebanon combined.

ISIS is State-Sponsored, So Why Aren’t These States Being Sanctioned? 

Clearly, the Islamic State in Iraq and Syria also known as ISIS or ISIL, are the benefactors of vast state-sponsorship and yet the West has not identified nor condemned these sponsors, let alone move toward leveling sanctions similar to what it is seeking to impose upon Moscow.

News articles by prominent British and American news outlets like the Daily Beast’s “America’s Allies Are Funding ISIS,” the London Telegraph’s “How Isil is funded, trained and operating in Iraq and Syria,” and the Daily Mail’s “Cameron tells European leaders to ‘be good to their word’ and stop funding ISIS with ransom payments,” give explanations ranging from outright admissions that Saudi Arabia, Qatar, Jordan, and Turkey are directly arming, funding, aiding and abetting ISIS, to descriptions that read like an immense money laundering operation, to ridiculous claims including “ransom payments” and “robbed banks” have been behind ISIS’ regional rise to menace.

At one point in the Daily Beast’s article it claims, “the U.S. has made the case as strongly as they can to regional countries, including Kuwait. But ultimately when you take a hands off, leading from behind approach to things, people don’t take you seriously and they take matters into their own hands.” If ever there was a case to use sanctions to be “taken seriously,” it would appear to be in this case, yet sure enough, no sanctions appear to be on the table.

Systematic Hypocrisy Undermines Legitimacy 

American and European hypocrisy so stark undermines the legitimacy of both their governments and institutions as well as their agenda domestically and abroad. Condemning and leveling sanctions against Russia for allegedly doing in Ukraine what the West is openly doing in Syria and Iraq with its own immense proxy army leaves the global audience to decide between Russia managing a crisis on its borders and a West meddling thousands of miles from its borders.

Beyond sanctions, the West’s presence across the Middle East has had a negative impact on public perception both across the region and back home. This is owed to a larger pattern of hypocrisy, deceit, and meddling that has been done under various pretenses but for obvious self-serving interests.

What West’s Missing Sanctions Tell Us About Its “War” on ISIS 

Versus Russia, the United States and Europe have used every means at their disposal to support their regime of choice in Ukraine as well as undermine both eastern Ukrainians and Russia who has emerged as their champion upon the international stage. From multiple rounds of sanctions, to threats of direct military force, and an overall strategy of geopolitical and military encirclement of Russian territory has been pursued to exact from Moscow concessions regarding Western designs in Ukraine.

Why hasn’t a similar full-spectrum commitment been used to render from Persian Gulf monarchies the same desired capitulation to Western desires in the Middle East and more specifically, in regards to ISIS? The answer is simple, the West does not desire an end to the massive state-sponsorship of ISIS via its own allies, namely Saudi Arabia, Qatar, Turkey, Jordan, and others.

It appears instead that the West and its partners are pursuing a dual-track strategy of inflaming the region with barbarism and violence so appalling, global public opinion will desperately beg for military intervention by the United States and its allies it has been so far utterly unsuccessful selling to the public under any other pretense.

The lack of biting sanctions against state-sponsors of terrorism aiding and abetting ISIS in both Iraq and Syria is an indictment of the West’s lack of sincerity in its “war” on ISIS. Short of a signed confession, no other indicator could be more telling of yet another war being sold within a pack of lies than a West eager to sanction every nation on Earth to the point of isolating itself to exact global obedience, but absent of sanctions amid overt support for terrorists it believes are so dangerous it must militarily intervene in Iraq and Syria.

Ulson Gunnar, a New York-based geopolitical analyst and writer especially for the online magazine “New Eastern Outlook”.

House Bans War Powers Resolution Actions

September 20th, 2014 by David Swanson

The U.S. House of Representatives has not just left town, but prior to leaving passed a rule preventing any member from using the War Powers Resolution to force Congress to return and vote on war.

Here’s a video of Congressman Jim McGovern denouncing the rule (or read the transcript here):

If you watch the video, following Rep. McGovern’s remarks two of his colleagues run their mouths. The first is Congressman Pete Sessions nonsensically replying to McGovern. The second is Congresswoman Virginia Foxx on an unrelated topic. If you jump ahead to 10:25 McGovern replies to Sessions. It’s well worth watching.

In addition, Congressman McGovern and five other Democrats and six Republicans have asked Speaker John Boehner and Minority Leader Nancy Pelosi to hold a vote on war. Here’s their letter: PDF.

US Lays New Chemical Weapon Allegations Against Syria

September 20th, 2014 by Peter Symonds

US Secretary of State John Kerry yesterday laid fresh allegations of chemical weapons use against Syrian President Bashar al-Assad, thereby establishing another pretext for turning the imminent US air war in Syria against the regime in Damascus.

A year ago, the Obama administration exploited the now discredited claims that the Syrian military had carried out a gas attack on the Damascus suburb of Ghouta, in order to prepare a devastating aerial assault on the country’s armed forces, infrastructure and industry. While the attacks were called off at the last minute, the US has never relinquished its aim of regime-change and has seized on Islamic State of Iraq and Syria (ISIS) atrocities to justify a new, illegal war of aggression.

Speaking in the House Foreign Affairs Committee, Kerry renewed the claim that the Syrian military was using chemical weapons in the country’s civil war. “We believe there is evidence of Assad’s use of chlorine, which when you use it—despite it not being on the list—it is prohibited under the Chemical Weapons Convention,” he said.

Last September, the Syrian government agreed to the destruction of its stockpiles of chemical weapons and the facilities used to manufacture and store them. The Organisation for the Prohibition of Chemical Weapons (OPCW) announced last month that it had completed the task of supervising the destruction of the materials and facilities. Yet, at the time, Kerry continued to press the issue, claiming that “much more work must be done” to deal with “discrepancies and omissions” in Syria’s chemical weapons’ declaration last year.

Now, as the US is about to launch air strikes on ISIS militias in Syria, Kerry has publicly revived the issue. Chlorine was never part of last year’s agreement because it is a basic chemical with many industrial applications. As such it also provides a convenient device for making further lurid allegations against the Assad regime.

Claims that the Syrian military used chlorine against opposition-held villages can be traced to an “independent investigation” carried out by the right-wing British newspaper, the Telegraph, in April. The Telegraph, which has links to the British military and intelligence establishment, passed on soil samples from the villages to the OPCW, which issued a report last week confirming strong traces of chlorine and ammonia. The UN body could not and did not, however, determine who used the gas.

Just as the US exploited the Ghouta gas attack last year as a casus belli for war on Syria, so Kerry used the latest chemical weapons claims to make clear that the US is still gunning for Assad. He declared that there was no “long-term future” for Assad in power, adding: “The Syrian opposition is not going to stop fighting Assad. We recognise that reality.”

Kerry’s comments underline the real purpose of Washington’s plans to train and arm at least 5,000 “moderate” Syrian opposition fighters. While nominally aimed against ISIS, these militias would form the core of armed forces to oust Assad and establish a pro-Western regime in Damascus. Yesterday the US Senate, following a vote in the House of Representatives on Wednesday, overwhelmingly approved—78 to 22—the Obama administration’s plan to build up anti-Assad forces in Syria.

US Defence Secretary Chuck Hagel told the House Armed Services Committee that he and Joint Chiefs of Staff chairman Martin Dempsey had signed off on detailed plans for air strikes on ISIS targets inside Syria. Referring to the US Central Command, Hagel said: “CENTCOM’s plan includes targeted actions against ISIL [ISIS] safe havens in Syria, including its command and control, logistics capabilities and infrastructure.” He added: “Our actions will not be restrained by a border that exists in name only.” All that is now required is Obama’s approval.

According to a SyriaDeeply report this week, civilians in the Syrian city of Raqqa, currently held by ISIS, are already fleeing. Abu Ahmad, who left with his family, said: “We will not stay in our homes waiting for death to find us because of some targeting error.” A shop keeper inside Raqqa told the Guardian: “I believe most of the casualties will be civilian. The majority will be from Raqqa and very few from ISIS.”

The timing of the stepped-up war inside Iraq and air strikes in Syria is likely to be determined during next week’s UN General Assembly meeting. The Australian Financial Review reported today: “The final plans to wage war against Islamic State will be co-ordinated in private meetings between world leaders in New York… clearing the way for action to start.” Obama is due to address the General Assembly and chair a meeting of the UN Security Council.

The Obama administration is still trying to consolidate its “coalition of the willing” to wage war in the Middle East. President Francois Hollande announced yesterday that France was prepared to carry out air strikes in Iraq, but not in Syria, citing concerns that extending the air war would strengthen the Assad regime. The British government has held off making detailed commitments until the results of the Scottish referendum are finalised.

Kerry declared on Wednesday that some Arab countries were committed to military action, saying: “We have significant levels of support to conduct military operations.” He did not name specific nations, however. Turkey has refused to allow US war planes to operate from its military bases but this week revived plans to establish a buffer zone along its border with Syria as a possible staging area for pro-Western, anti-Assad militias.

Obama has repeatedly declared that the US will not commit ground troops to combat in Iraq and Syria. Australian Prime Minister Tony Abbott, who has sent war planes and 600 military personnel to Iraq, including 150 SAS special forces, repeats the same mantra.

The worthlessness of such statements was underscored by an Australian “retired senior defence insider” who commented in yesterday’s Sydney Morning Herald: “You don’t send in the SAS to run seminars and give white-board presentations back at headquarters. These guys are our most highly trained killers, and that’s what they will be doing.”

The determination of the US and its allies to play down their involvement in a war in the Middle East stems from real fears of the emergence of anti-war opposition on a scale beyond that which erupted against the criminal US-led invasion on Iraq in 2003.

The Ebola Crisis: Profiting from the Pandemic Outbreak

September 20th, 2014 by Michael Welch

The 2014 Ebola outbreak in West Africa is being declared the deadliest on record, and certainly the first of its kind in the region.

A recent report from the World Health Organization, a UN agency, found that there had been 2630 confirmed deaths directly attributable to the latest strain with 5,357 cases having been diagnosed. The disease is widespread and transmitting intensely throughout Guinea, Liberia and Sierra Leone, with additional cases emerging in Nigeria and Senegal.

The Global Research News Hour takes a closer look at the background of this developing situation with two observers with dissident takes on this new Clear and Present danger.

LISTEN TO THE SHOW 

Play

Length (58:07)
Click to download the audio (MP3 format)

Aggressive measures are being taken.

US President Barrack Obama stated on Tuesday September 16 that his administration would be committing 3000 military personnel to help contain the spread of the epidemic in the region.

The World Bank is committing $200 million in assistance to the three hardest hit African countries.

And the micro-biologist who first identified the Ebola virus in 1976 is urging UK Prime Minister Cameron to take “quasi-military” measures to address the threat.

Authorities are preparing to fast-track the use 10,000 doses of an experimental, as yet untested Ebola vaccine for use in West Africa.

As of this writing, the President of the besieged State of Sierra Leone has ordered the residents of Freetown, its capital city, off the streets and into their homes, arguing  ”extraordinary times require extraordinary measures.”

The Global Research News Hour takes a closer look at the background of this developing situation with two observers with dissident takes on this new Clear and Present danger.

Jon Rappoport is the author of the blog NoMoreFakeNews.com. He has 30 years of experience as an investigative reporter and has authored three books including  The Matrix Revealed and  Exit from the Matrix. He believes the World Health Organization, the Centres for Disease Control and other bodies are exaggerating the role of the Ebola virus in the death counts.  and speculates on how this new plague may be helping to advance a more cynical agenda.

Dr. Leonard Horowitz is a Harvard-trained investigator and public health educator. He has authored more than ten books including the 1996 best-seller Emerging Viruses: Aids & Ebola, Nature, Accident or Intentional. Dr. Horowitz has argued for years that both Ebola and AIDS were bio-engineered in a laboratory. In this GR News Hour interview, he shares evidence of how the new outbreak constitutes commercial and scientific fraud, he talks about how his information is being suppressed by YouTube, Wikipedia and, of course, the corporate press, and he outlines what he believes is the real agenda behind this new War On Germs.

 

LISTEN TO THE SHOW 

Play

Length (58:07)
Click to download the audio (MP3 format)

 

The Global Research News Hour airs every Friday at 1pm CT on CKUW 95.9FM in Winnipeg. The programme is also podcast at globalresearch.ca .

The show can be heard on the Progressive Radio Network at prn.fm. Listen in every Monday at 3pm ET.

Community Radio Stations carrying the Global Research News Hour:

CHLY 101.7fm in Nanaimo, B.C – Thursdays at 1pm PT

Boston College Radio WZBC 90.3FM NEWTONS  during the Truth and Justice Radio Programming slot -Sundays at 7am ET.

Port Perry Radio in Port Perry, Ontario – Thursdays at 1pm ET

Burnaby Radio Station CJSF out of Simon Fraser University. 90.1FM to most of Greater Vancouver, from Langley to Point Grey and from the North Shore to the US Border. It is also available on 93.9 FM cable in the communities of SFU, Burnaby, New Westminister, Coquitlam, Port Coquitlam, Port Moody, Surrey and Delta, in British Columbia Canada. – Tune in every Saturday at 6am.

CFRU 93.3FM in Guelph, Ontario. Tune in Wednesdays from 12am to 1am.

 

Was voter fraud committed during the Scottish Independence referendum?

It has been confirmed that the names of 10 people were already crossed off a voter list prior them voting inside a polling station.

According to reports, the Glasgow City Council confirmed that there were ten cases of suspected electoral fraud occurring at polling stations following the Scottish referendum vote on the 18th. As authorities have been investigating thousands have gathered outside in George Square, Glasgow, which has been dubbed “Independence Square,” in the time leading up to the vote.

Scotland on Sunday published a piece in early September suggesting the integrity of the electoral register was called into question a month prior to the historic vote:

“With less than two weeks to go before the independence vote on 18 September, Scotland on Sunday has learned that a formal complaint is to be made by Labour to the returning officer at East Ayrshire Council after activists discovered that at least four children in the area aged between three and 11 have received polling cards.”

Continuing, the recent polling concerns were put into context:

“The revelation has echoes of the problems which beset the 1979 devolution referendum, in which some dead people were given the vote, undermining public confidence in the result which did not meet the threshold set by the Callaghan government for creating a Scottish Parliament.”

What would be the motive for keeping Scotland in the UK?

The Washington post reports:

“The impact of North Sea oil is an important factor in Scotland’s independence and will certainly continue to be if it goes it alone.”

“An independent Scotland would probably get rights to the majority of the oil and gas off the coast of the United Kingdom: Despite the British government’s investment in the area, natural resources like this are generally divided up by geography alone. One study found that as much as 90 percent of oil revenue may go to an independent Scotland.”

Gaining 90 percent of oil revenues would seem to be a pretty weighty motive to derail the much sought after referendum.

There were other anomalies, as pointed out by independent investigator Aangirfan, illustrates the hypocrisy of the recent referendum vote:

“The turnout in the strong YES area of Glasgow was 75%, which is lower than the 85% turnout in Scotland as a whole.

The county known as Clackmannanshire was expected to vote YES.

But it was announced that NO had got 54% of the vote in Clackmannanshire.Scottish independence: Yes County votes NoIn Scotland as a whole, NO got more votes than the polls had predicted.”

Its important to note that Clackmannanshire had an 88.6 percent turnout. 

IMAGE: ‘Rigging the plot’ – police on the scene in Glasgow following allegations of voter fraud (Photo dailymail.co.uk)


IMAGE: ‘Calling it quits’ – Scotland’s first minister Alec Salmound resigns following results of the Scottish referendum (Photo rt.com)

Here’s a clip of spokesman Colin Edgar regarding the serious allegations of voter fraud occurring in Glasgow…

Watch this independent YouTube analysis of alleged fraudulent activities during the Scottish referendum as captured by Sky News cameras…

RT’s news release below…

1-Scottish-Independence

Salmond resigns after losing Scottish independence referendum

RT


Scotland’s First Minister and leader of the Scottish National Party (SNP) is resigning from office after losing Thursday’s independence referendum.

Scots voted to stay in the UK following an intense campaign. The‘No’ campaign rallied 55 percent of votes against 45 percent ‘Yes’ votes.

“We lost the referendum vote but Scotland can still carry the political initiative,” he told journalists and supporters.

“For me as leader my time is nearly over but for Scotland the campaign continues and the dream shall never die.”


IMAGE: ‘The fire inside’ – independence supporters in Glasgow’s George Square (Photo dailymail.co.uk)

In terms of who will replace him, Salmond says there are a “number of eminently qualified and very suitable candidates for leader.”

When asked what his reasons were for resigning, Salmond said “I had to make a judgement as to whether I’m best placed to take that opportunity forward – and I think others are.”

Deputy First Minister and Deputy SNP leader, Nicola Sturgeon, is the overwhelming favourite to replace Salmond as party leader.

Salmond expressed his pride in the historic 85 percent turnout in Thursday’s referendum and the manner in which Scots conducted themselves.

“We now have the opportunity to hold Westminster’s feet to the fire on the “vow” that they have made to devolve further meaningful power to Scotland. This places Scotland in a very strong position,” he said.

The First Minister spoke to Prime Minister David Cameron on Friday. He said the PM would not commit to a second reading vote by March 27 on a devolved powers ‘Scotland Bill’, which had been promised by former-PM and ‘No’ campaigner Gordon Brown during the campaign.

“I suspect he cannot guarantee the support of his party,” Salmond said, referring to the backbench Tory rebellion against new powers to Scotland.

“But today the point is this. The real guardians of progress are not the politicians at Westminster, or even at Holyrood, but the energised activism of tens of thousands of people who I predict will refuse meekly to go back into the political shadows.”

Leadership nominations will open at the SNP’s Annual Conference in Perth, November 13-15, said Salmond.

“After the membership ballot I will stand down as First Minister to allow the new leader to be elected by due Parliamentary process.

“Until then I will continue to serve as First Minister. After that I will continue to offer to serve as Member of the Scottish Parliament for Aberdeenshire East.”

Salmond said it had been “the privilege of my life” to serve as First Minister.

Imperial Conquest: America’s Long War Against Humanity

September 20th, 2014 by Prof Michel Chossudovsky

Worldwide militarization is also part of a global economic agenda, namely the application of the neoliberal economic policy model which has led to the impoverishment of large sectors of the World population.

The world is at the crossroads of the most serious crisis in modern history. The US has embarked on a military adventure, “a long war”, which threatens the future of humanity.

This “war without borders” is being carried out at the crossroads of the most serious economic crisis in World history, which has been conducive to the impoverishment of large sectors of the World population.

The Pentagon’s global military design is one of world conquest. The military deployment of US-NATO forces is occurring in several regions of the world simultaneously.

The concept of the “Long War” has characterized US military doctrine since the end of World War II. Worldwide militarization is part of a global economic agenda.

Video of Michel Chossudovsky’s presentation to The Rosa Luxemburg conference.

The event was organized by the German daily “junge Welt”. This year, the Rosa Luxemburg Conference marked the commemoration of the 100th anniversary of the First World War.

for the full text including detailed analysis: Imperial Conquest: America’s “Long War” against Humanity, Global Research, January 2014

I’ve never been to a protest march that advertised in the New York City subway. That spent $220,000 on posters inviting Wall Street bankers to join a march to save the planet, according to one source. That claims you can change world history in an afternoon after walking the dog and eating brunch.

Welcome to the “People’s Climate March” set for Sunday, Sept. 21 in New York City. It’s timed to take place before world leaders hold a Climate Summit at the United Nations two days later. Organizers are billing it as the “biggest climate change demonstration ever” with similar marches around the world. The Nation describes the pre-organizing as following “a participatory, open-source model that recalls the Occupy Wall Street protests.” A leader of 350.org, one of the main organizing groups, explained, “Anyone can contribute, and many of our online organizing ‘hubs’ are led by volunteers who are often coordinating hundreds of other volunteers.”

I will join the march, as well as the Climate Convergence starting Friday, and most important the “Flood Wall Street” direct action on Monday, Sept. 22. I’ve had conversations with more than a dozen organizers including senior staff at the organizing groups. Many people are genuinely excited about the Sunday demonstration. The movement is radicalizing thousands of youth. Endorsers include some labor unions and many people-of-color community organizations that normally sit out environmental activism because the mainstream green movement has often done a poor job of talking about the impact on or solutions for workers and the Global South.

Nonetheless, to quote Han Solo, “I’ve got a bad feeling about this.”

Environmental activist Anne Petermann and writer Quincy Saul describe how the People’s Climate March has no demands, no targets,and no enemy. Organizers admitted encouraging bankers to march was like saying Blackwater mercenaries should join an antiwar protest. There is no unity other than money. One veteran activist who was involved in Occupy Wall Street said it was made known there was plenty of money to hire her and others. There is no sense of history: decades of climate-justice activism are being erased by the incessant invocation of the “biggest climate change demonstration ever.” Investigative reporter Cory Morningstar has connected the dots between the organizing groups, 350.org and Avaaz, the global online activist outfit modeled on MoveOn, and institutions like the World Bank and Clinton Global Initiative. Morningstar claims the secret of Avaaz’s success is its “expertise in behavioral change.”

That is what I find most troubling. Having worked on Madison Avenue for nearly a decade, I can smell a P.R. and marketing campaign a mile away. That’s what the People’s Climate March looks to be. According to inside sources a push early on for a Seattle-style event—organizing thousands of people to nonviolently shut down the area around the United Nations—was thwarted by paid staff with the organizing groups.

One participant in the organizing meetings said, “In the beginning people were saying, ‘This is our Seattle,’” referring to the 1999 World Trade Organization ministerial that was derailed by direct action. But the paid staff got the politics-free Climate March. Another source said, “You wouldn’t see Avaaz promoting an occupy-style action. The strategic decision was made to have a big march and get as many mainstream groups on board as possible.”

Nothing wrong with that. Not every tactic should be based on Occupy. But in an email about climate change that Avaaz sent out last December, which apparently raked in millions of dollars, it wrote, “It’s time for powerful, direct, non-violent action, to capture imagination, convey moral urgency, and inspire people to act. Think Occupy.”

Here’s what seems to be going on. Avaaz found a lucrative revenue stream by warning about climate catastrophe that can be solved with the click of a donate button. To convince people to donate it says we need Occupy-style actions. When the moment comes for such a protest, Avaaz and 350.orgblocked it and then when it did get organized, they pushed it out of sight. If you go to People’s Climate March, you won’t find any mention of the Flood Wall Street action, which I fully support, but fear is being organized with too little time and resources. Nor have I seen it in an Avaaz email, nor has anyone else I’ve talked to. Bill McKibben of 350.org began promoting it this week, but that may be because there is discontent in the activist ranks about the march, which includes lots of Occupy Wall Street activists. One inside source said, “It’s a branding decision not to promote the Flood Wall Street action. These are not radical organizations.”

Branding. That’s how the climate crisis is going to be solved. We are in an era or postmodern social movements.

The image (not ideology) comes first and shapes the reality. The P.R. and marketing determines the tactics, the messaging, the organizing, and the strategy. Whether this can have a positive effect is a different question, and it’s why I encourage everyone to participate. The future is unknowable. But left to their own devices the organizers will lead the movement into the graveyard of the Democratic Party, just as happened with the movement against the Iraq War a decade ago. You remember that historic worldwide movement, right? It was so profound the New York Times dubbed global public opinion, “the second superpower.” Now Obama has launched an eighth war and there is no antiwar movement to speak of.

Sources say Avaaz and 350.org is footing most of the bill for the People’s Climate March with millions of dollars spent. Avaaz is said to have committed a dozen full-time staff, and hired dozens of other canvassers to collect petition signatures and hand out flyers. Nearly all of 350.org’s staff is working on climate marches around the country and there is an office in New York with thirty full-time workers organizing the march. That takes a lot of cheddar. While the grassroots are being mobilized, this is not a grassroots movement. That’s why it’s a mistake to condemn it. People are joining out of genuine concern and passion and hope for an equitable, sustainable world, but the control is top down and behind closed doors. Everyone I talked to described an undemocratic process. Even staffers were not sure who was making the decisions other than to tell me to follow the money. It’s also facile to say all groups are alike. Avaaz is more cautious than 350.org, and apparently the New York chapter of 350.org, which is more radical, is at odds with the national.

But when the overriding demand is for numbers, which is about visuals, which is about P.R. and marketing, everything becomes lowest common denominator. The lack of politics is a political decision. One insider admitted despite all the overheated rhetoric about the future is on the line, “I don’t expect much out of this U.N. process.” The source added this is “a media moment, a mobilizing moment.” The goal is to have visuals of a diverse crowd, hence the old saw about a “family-friendly” march. Family friendly comes at a high cost, however. Everything is decided by the need for visuals, which means organizers will capitulate to anything the NYPD demands for fear of violence. The march is on a Sunday morning when the city is in hangover mode. The world leaders will not even be at the United Nations, and they are just the hired guns of the real climate criminals on Wall Street. The closest the march comes to the United Nations is almost a mile away. The march winds up on Eleventh Avenue, a no-man’s land far from subways. There is no closing rally or speakers.

An insider says the real goal was to create space for politicians: “If you can frame it as grandma and kids and immigrants and labor you could make it safer for politicians to come out and support. It’s all very liberal. I don’t have much faith in it.”

When I asked what the metrics for success for, the insider told me media coverage and long-term polling about public opinion. I was dumbfounded. That’s the exact same tools we would use in huge marketing campaigns. First we would estimate and tally media “impressions” across all digital, print, outdoor, and so on. Then a few months down the road we would conduct surveys to see if we changed the consumer’s opinion of the brand, their favorability, the qualities they associated with it, the likelihood they would try. That’s the same tools Avaaz is allegedly using.

Avaaz has pioneered clickbait activism. It gets people to sign petitions about dramatic but ultimately minor issues like, “Prevent the flogging of 15 year old rape victim in Maldives.” The operating method of Avaaz, which was established in 2007, is to create “actions” like these that generate emails for its fundraising operation. In other words, it’s a corporation with a business model to create products (the actions), that help it increase market share (emails), and ultimately revenue. The actions that get the most attention are ones that get the most petition signers, the most media coverage, and which help generate revenue.

Avaaz has turned social justice into a product to enhance the liberal do-gooding lifestyle, and it’s set its sights on the climate justice movement.

The more dramatic the emails the better the response. It’s like the supermarket. The bags and boxes don’t say, “Not bad,” or “kinda tasty.” They say “the cheesiest,” “the most delicious,” “an avalanche of flavor,” “utterly irresistible.” That’s why climate change polls so well for Avaaz. It’s really fucking dramatic. But it’s still not dramatic enough for marketing purposes.

One source said the December 2013 email from Avaaz Executive Director Ricken Patel about climate change was a goldmine. It was headlined, “24 Months to Save the World.” It begins, “This may be the most important email I’ve ever written to you,” and then says the climate crisis is “beyond our worst expectations” with storms and temperatures “off the charts.” Then comes the hook from Patel,

“We CAN stop this, if we act very fast, and all together. And out of this extinction nightmare, we can pull one of the most inspiring futures for our children and grandchildren. A clean, green future in balance with the earth that gave birth to us.”

Telling people there is 24 months to save the world is odious, as is implying an online donation to Avaaz can save the planet.

The same overblown rhetoric is being used for the People’s Climate March: It’s the biggest ever. There is “unprecedented collaboration” with more than 1,400 “partner” groups in New York City. Everything comes down to this one day with the “future on the line and the whole world watching, we’ll take a stand to bend the course of history.”

Presumably the orderly marchers behind NYPD barricades will convince the governments of the world that will meet for the Climate Summit that won’t even meet for another two days that they need to pass UN Secretary­ General Ban Ki-­moon’s “ambitious global agreement to dramatically reduce global warming pollution.”

Moon is now joining the march. But it’s hard to find details, including on the Climate Summit website, as to what will actually be discussed there. The best account I could find is by Canadian journalist Nick Fillmore. He claims the main point will be a carbon pricing scheme. This is one of those corporate-designed scams that in the past has rewarded the worst polluters with the most credits to sell and creates perverse incentives to pollute, because then they can earn money to cut those emissions.

So we have a corporate-designed protest march to support a corporate-dominated world body to implement a corporate policy to counter climate change caused by the corporations of the world, which are located just a few miles away but which will never feel the wrath of the People’s Climate March.

Rather than moaning on the sidelines and venting on Facebook, radicals need to be in the streets. Join the marches and more important the direct actions. Radicals need to ask the difficult questions as to why for the second time in fifteen years has a militant uprising, first Seattle and then Occupy, given way to liberal cooptation. What good is your radical analysis if the NGO sector and Democratic Party fronts kept out-organizing you?

Naomi Klein says we need to end business as usual because climate change is going to change everything. She’s right. Unfortunately the organizers of the People’s Climate March didn’t get the memo. Because they are continuing on with business as usual that won’t change anything.

One prominent environmental organizer says that after the march ends, “The U.N. leaders are going to be in there Monday and Tuesday and do whatever the fuck they want. And everyone will go back to their lives, walking the dog and eating brunch.”

The future is unwritten. It’s not about what happens on Sunday. It’s what happens after that.

Arun Gupta contributes to outlets including Al Jazeera America, Vice, The Progressive, The Guardian, and In These Times.

At the beginning of August 2014 Bloomberg published an article about the “promising hopes” tobacco plants offer “for developing an effective treatment for the deadly Ebola virus”:

Tobacco plant-derived medicines, which are also being developed by a company whose investors include Philip Morris International Inc., are part of a handful of cutting edge plant-based treatments that are in the works for everything from pandemic flu to rabies using plants such as lettuce, carrots and even duckweed…

Another tobacco giant-backed company working on biotech drugs grown in tobacco plants is Medicago Inc. in Quebec City, which is owned by Mitsubishi Tanabe Pharma Corp. and Philip Morris.

Medicago is working on testing a vaccine for pandemic influenza and has a production greenhouse facility in North Carolina, said Jean-Luc Martre, senior director for government affairs at Medicago. Medicago is planning a final stage trial of the pandemic flu vaccine for next year, he said in a telephone interview…

Medicago ‘‘is currently closely working with partners for the production of an Ebola antibody as well as other antibodies that are of interest for bio-defense,” he said in an e-mail. He would not disclose who the partners were. (Ebola Tobacco Drug Joins Duckweed in Plant War on Disease, Bloomberg, August 6, 2014)

Could one of these partners be the Pentagon?

In 2009, the Defense Advanced Research Projects Agency (DARPA), part of the U.S. Department of Defense, launched a program called Blue Angel, which some have described as “DARPA’s vaccine manufacturing challenge”.

DARPA issued a press release in late July 2012 announcing they had “produced 10 million doses of an influenza vaccine in only one month’s time.”

In a press release out of the agency’s office this week, scientists with DARPA say they’ve reach an important step in being able to combat a flu pandemic that might someday decimate the Earth’s population. By working with the Medicago Inc. vaccine company, the Pentagon’s cutting edge research lab says that they’ve used a massive harvest of tobacco plants to help produce a plethora of flu-fighting vaccines.

Testing confirmed that a single dose of the H1N1 VLP influenza vaccine candidate induced protective levels of hemagglutinin antibodies in an animal model when combined with a standard aluminum adjuvant,” the agency writes, while still noting, though, that “The equivalent dose required to protect humans from natural disease can only be determined by future, prospective clinical trials.”

Vaccinating susceptible populations during the initial stage of a pandemic is critical to containment,”Dr. Alan Magill, DARPA program manager, says in an official statement. “We’re looking at plant-based solutions to vaccine production as a more rapid and efficient alternative to the standard egg-based technologies, and the research is very promising.” (DARPA’s Blue Angel – Pentagon Prepares Millions of Vaccines Against Future Global Flu, RT, July 28, 2012)

This link between the U.S. military and pharmaceutical companies in the production of flu vaccines raises serious questions, especially since the H1N1 pandemic has been exposed as a multibillion dollar fraud instigated by BigPharma and the World Health Organization (WHO).

A stunning new report reveals that top scientists who convinced the World Health Organization (WHO) to declare H1N1 a global pandemic held close financial ties to the drug companies that profited from the sale of those vaccines. This report, published in the British Medical Journal, exposes the hidden ties that drove WHO to declare a pandemic, resulting in billions of dollars in profits for vaccine manufacturers. (Mike Adams: WHO Scandal Exposed: Advisors Received Kickbacks From H1N1 Vaccine Manufacturers, Natural News, June 7, 2010)

In 2012, it was reported that Medicago “was funded through a $21 million Technology Investment Agreement with DARPA.” (RT, op. cit.)

After investing in medical research to manufacture vaccines, the U.S Department of Defense is now sending troops to deal with a pandemic in Africa. Is the military slowly replacing health authorities? If so, we can ask ourselves why. What is the real goal of this “humanitarian intervention”? Maybe the answer lies in the goal of DARPA’s Blue Angel program?

In an interview last February, Blue Angel’s programme manager Dr. John Julias said:

The Blue Angel programme was launched by the US Defense Advanced Research Projects Agency (DARPA) in 2009 as a direct response to the swine flu pandemic. The project’s goal is to improve the US’s response to pandemic influenza through accelerated vaccine production

The Blue Angel programme was built around the concept that the Department of Defense requires a capability to rapidly respond to any pandemic or biological threat that jeopardises warfighter readiness. (Chris Lo, Blue Angel: DARPA’s vaccine manufacturing challenge, pharmaceutical-technology.com, February 10, 2014)

So the goal is “to improve the US’s response to pandemic influenza” but it is built on a concept which aims to protect “warfighters” from “any pandemic or biological threat”, not the population in general.

Is this concept in any way related to the fact that “warfighters” instead of “health workers” are now being sent into areas affected by the Ebola pandemic? To test a vaccine against a “biological threat that jeopardises warfighter readiness”? Are these 3000 troops Obama is sending to Liberia being used as guinea pigs? There are precedent in this regard. This  would not be the first time.

Last February RT reported:

A federal judge has ruled the United States Army must quickly inform veterans of any potentially harmful health effects stemming from the secret medical and drug experiments conducted on them during the Cold War.

According to a report by Courthouse News wire service, the ruling comes in favor of 7,800 soldiers claiming to have been involved in the experiments. After recruiting Nazi scientists to help through a program called “Project Paperclip,” the Army and CIA administered between 250 and 400 kinds of drugs to the soldiers in an attempt to advance US ability to wage war. (Judge sides with US servicemen used as guinea pigs in terrifying Cold War experiment, RT, Frebruary 7, 2014)

During the Persian Gulf War (1990-1991) experimental vaccines were also given to soldiers and several studies have concluded that the Gulf-War Syndrome was linked to vaccinations:

Gulf-War Syndrome (GWS) refers to a collection of symptoms in soldiers who served in the Persian Gulf War (1990-1991), or Gulf War 1. These symptoms include rash, severe fatigue, muscle and joint pain, headache, irritability, depression, unrefreshing sleep, gastrointestinal and respiratory disorders and neurological cognitive defects.

Apart from being exposed to a wide range of environmental hazards and toxic chemicals, US and UK Gulf War I veterans (GW1Vs) were also given large numbers of vaccines. In total, the US GW1Vs received, at least, 17 different vaccines [1] including live vaccines (polio and yellow fever as well as experimental vaccines that had not been approved (anthrax, botulinum toxoid) and were of doubtful efficacy [2]. In the UK, the Ministry of Defence (MoD) has declared only 10 vaccines given, but records exist to show that some troops received a greater number [3]. Among them were two experimental vaccines, anthrax with pertussis as an adjuvant (shown in 1990 to cause serious deconditioning in mice) [4], and plague, given to UK but not USA troops [1]. The manufacturers of pertussis were not advised of the unlicensed use on GW1Vs [1,4].

Vaccine overload was identified as a significant factor in GWS…

These findings are consistent with those from other studies. A link between vaccinations and illness has been found among GW1Vs from UK and Canada [6]. (Dr. Mae-Wan Ho and Prof. Malcolm Hooper Vaccines, Gulf-War Syndrome & Bio-defence)

The stated goal enunciated by Obama of the U.S. soldiers’ mission in Liberia is to build medical centers and train health workers to operate them.

The National Institutes of Health, an agency of the U.S. Department of Health and Human Services, has already developed an Ebola vaccine. In early September GlaxoSmithKline said it planned to begin manufacturing up to 10,000 doses of it, even though scientists had not yet decided if “the initial vaccine was promising enough” and ”safety studies cannot guarantee that experimental vaccines really work in an outbreak.” (Associated Press, Ebola vaccine research moving fast, CBSNews, September 8, 2014)

It is worth noting in this regard that several health hazards were in fact caused by the H1N1 vaccine. GlaxoSmithKline also recently pleaded guilty and paid “$3 billion to resolve fraud allegations and failure to report safety data”. (GlaxoSmithKline to Plead Guilty and Pay $3 Billion to Resolve Fraud Allegations and Failure to Report Safety Data, Department of Justice, July 2, 2014)

The leader of the Ukrainian separatists says that their efforts to get Russia’s President Vladimir Putin to accept their territory as being a part of Russia have been firmly rejected by Putin’s Government; and, so, “We will build our own country.” (This important statement from the rebel leader Andrei Purgin on Wednesday, September 17th, was inconspicuously buried halfway through an AP news story that focused instead on “East Ukraine Casualties.” It’s common for propagandistic news reports, such as characterize the U.S. media, to bury what’s important in the news story, and not even to headline that crucial information, when that information violates the regime’s propaganda. So: this information was buried, and was not headlined.)

Russia’s Government has thus made clear that it is not seeking to add to its territory. While Russia has accepted the approximately million refugees who have fled to Russia from Ukraine’s civil war, Russia does not want any part of Ukraine’s territory. Crimea was traditionally part of Russia, throughout the period 1783-1954, until the leader of the Soviet Union gifted Crimea to Ukraine (the nation that was called the Ukrainian Soviet Socialist Republic) in 1954, but the residents of Crimea never accepted that, and they overwhelmingly considered themselves still to be Russians. Furthermore, the Russian Navy’s lease on the Crimean port of Sebastopol for its Black Sea Fleet extended till 2042, and the February 2014 coup-installed Ukrainian Government wanted to cancel it, which threatened crucial Russian national defense. Furthermore, many of those new Ukrainian leaders wanted a nuclear war against Russia. So, Putin accepted Crimea back into Russia, but he will not admit more than that as being added to Russian territory.

Crimea is viewed as not being an addition to Russia, but instead as voluntarily rejoining Russia, irrespective of the new Ukrainian Government’s campaign to eliminate ethnic Russians from Ukraine’s southeast. No other part of post-1954 Ukraine had previously been part of Russia, and this includes the southeastern portion of Ukraine, whose residents ethnically descended from Russian immigrants who had settled there.

Consequently, the ethnic-cleansing campaign that has been going on by the new, Obama-installed, Ukrainian Government, against the residents in Ukraine’s southeast, will continue, at least until the surviving residents there become a small enough proportion of the Ukrainian national electorate so that a nationwide Ukrainian election — which hasn’t been held in Ukraine since the February 2014 coup — will choose leaders who are acceptable to the U.S. Government, which planned and financed that February coup. Only by killing and driving out enough of those people — the ones in the areas that overwhelmingly voted for the man whom Obama overthrew — will become possible a democratic Ukraine that allies itself with the U.S.

President Putin and President Obama have regularly been in direct contact with one-another ever since Obama’s coup occurred in February. Perhaps Putin’s declining to accept Ukrainian territory into Russia is part of an agreement between the two leaders in which Obama is, for his part, declining the urgings from congressional Republicans and conservative Democrats for the U.S. to provide weapons to the Ukrainian military to expedite their ethnic cleansing campaign. 

Investigative historian Eric Zuesse is the author, most recently, of  They’re Not Even Close: The Democratic vs. Republican Economic Records, 1910-2010,  and of  CHRIST’S VENTRILOQUISTS: The Event that Created Christianity.

Did that just happen?

The world was still up at 3am British time on Friday morning to catch the first returns from Scotland’s historic Independence Vote. Everyone wanted to know.

The Indy bug is a global one for sure, and there is no bigger trend right now than the trend toward autonomy. It will break down hundreds of redundant imperial borders and will be the source of endless strife as the world tries to let go of 19th and 20th century constructs. The world was definitely watching Scotland.

From a global perspective, it seemed like 100% of the world was pulling for a Scottish ‘YES’ even if just less than half of Scots were.

In the end the ‘NO’ campaign took the ‘YES’ by a 10 point margin (we are told), 55% to 45%.

For the ‘NO’ crowd it was a real kitchen sink moment. They were backed by the political establishment in Westminster, the City of London and the mainstream media (led by the BBC). Expectedly, PM Cameron came out swinging, as did Tony Blair’s former sidekick and banker puppet, Gordon Brown, became the tip of the spear of the ‘NO’ campaign. Captains of industry, celebrities and every conceivable pundit you can image was wheeled out two weeks before the vote on every TV and radio program.

It was also hard not to notice the multi-million pound PR campaign behind it. They managed to rebrand the word ‘NO’, to “Better Together”. They laid out a full range of slogans from the polite “No Thanks”, to the quintessentially cautious, “Vote NO, it’s not worth the risk”.

The Queen tried to weigh-in, but didn’t really. All she could manage was her hope that, “an enduring love of Scotland” will unite Britons’. US President Barack Obama couldn’t resist either, welcoming the Scots’ decision to stay in the UK (and NATO).

The desperation on the part of London’s establishment was pretty visible, as fear-based scenarios were deployed in ways not seen before. Deterrents ranged from the reserved, “It’s probably not a good idea”, to a more abrasive, “Pensioners will lose their pots, and the country will be plunged into debt”, or “Banks, profits and jobs will flee south!”, and rounded off by outright scare mongering by British PM David Cameron who ranted that a ‘YES’ vote would attract a wave of violent Islamic terror north of Hadrian’s Wall.

Not surprisingly, there were numerous reports of election and voter fraud, which is par for the course in western democracies these days. Sadly, not much will come of these reports other than further denting public confidence in our famous ‘democratic values’ in the west.

The story is far from over. Aside from a potential British Constitutional meltdown, ‘Devo Max’, full fiscal autonomy for Scotland – is still very much alive and well, and might further fuel a Constitutional crisis for Great Britain. The experts are saying that it will create uncertainty for business, and the ripple effects could be very significant.

SNP leader Alex Salmond and future leader Nicola Sturgeon.

Meanwhile, the head of the Scottish National Party who drove the campaign for Independence, Alex Salmond, resigned from his leadership position of 20 years today. This was a dramatic move for sure, and one that will leave experts scratching their heads about what backroom deal has been done. Favoured to replace him is SNP Deputy First Minister Nicola Sturgeon.

Before the vote there, everyone was speculating about everything. The Telegraph’s Peter Oborne summarised a few of the empire’s lingering concerns:

“National partitions – think of Ireland in 1922, India in 1947, Southern Sudan more recently or the birth-pangs of a Kurdish state today – are always bitter affairs. This is because two sides are arguing over the spoils. Who owns what? To whom do the armed forces give allegiance? Who inherits the debt? Who keeps the currency? There is already evidence of sectarian hatred, both north and south (where there are signs of a malevolent new English identity) of the border.

All of these issues will have to be dealt with by a set of politicians reeling with shock at the collapse of many of the landmarks that have given meaning to their lives…”

Shares on the London stock market rose on today and The Pound is up. Happy days, right?

Now let’s look at a few of the winners and losers from Thursday’s vote…

Winners:

The Scottish People – The cat is already out of the bag. As far as national identities go, Scotland’s stock is up. As a concept of a nation state, it’s already pre-qualified, better in fact than any other aspiring nation state, and can field as strong a case as France even. Voter turnouts of 80-90% are unheard of in modern European times so something was awakened over this issue. This renewed sense of identity cannot be a negative thing for your average Scot. The Aye’s may have lost this round, but the idea will continue to endure.

David Cameron – Imagine going down in history as the Prime Minister who presided over the break-up of the UK. David Cameron avoided such a fate, and power has remained consolidated in London. There were strong hints that if Scotland went off the reservation then Wales would next to secede, but that didn’t happen this time around. Bankers are happy. Sorted Dave. On to the next crisis.

NATO – Keeping the UK together means there will be no interruption in Britain’s NATO status and aspirations of ruling the world through the UN security council. An Independent Scotland would have meant that Trident nuclear submarines might have been moved or a contingency plan implemented. Without nukes, Britain cannot rightly serve on the UN Security Council thus losing its seat at the round table of world power, and severely clipping its NATO wings, bringing it down to the level of Spain.


Catalonia – Among the teams of international election observers in Scotland this week were a team of Catalans. They watch and learned, and will no doubt be applying their knowledge back in Spain during the run-up to their own independence vote this November. Despite the NO result in Scotland, the whole exercise will only embolden the Catalans, as they prepare to lock horns with their masters in Madrid. Many of the same issues facing Scottish Independence – EU membership, currency, and commercial migration – are also front and centre for an independent Catalonia too. Do not underestimate the momentum behind the Catalonia independence movement – it’s massive, but so is the indifference in Madrid.

UKIP – Regardless of the final result, the UK Independence Party (UKIP) has been basking in the festivities, and observing with great interest the many cracks forming as a result of the Indy drive. Even if you think that the Scotland Indy campaign was an EU trojan horse, the overall public sentiment was about independence and all its trappings. Scotland’s desire to devolve has elevated UKIP’s agenda south of the border.

The Royals – To be sure, the biggest worry for the Windsors was the prospect of having the vacate their beloved Balmoral Castle in Scotland. Besides having to clear out all those party favours from the basement, it would have been a scheduling nightmare for the royal household and would have ended up costing the British taxpayer even more than they are already shelling out for their German royal family. The status quo has been preserved.

Losers:

Scotland’s Labour Party – The split within the Labour Party over the Indy vote was pronounced. Gordon Brown’s cheer leading section saw his performance as proof that he should be back in frontline politics, but numbers were an internal massacre for Labour – nearly half of Labour voted for Scottish Independence.

BBC – No demon reared its ugly head as much as the BBC in this drama. They may have succeeded in swinging the NO vote, but the BBC has managed to alienate and further disconnect itself from half of the Scottish population who are accusing it of extreme bias. The even came out to protest outside BBC headquarters. From the onset, the public was treated to yet another reason to withhold their license fee, as the BBC took a clear side in the debate – defending the City of London and Westminster’s desires for Scotland to stay in the United Kingdom by blatantly shilling for the ‘NO’ campaign. It was embarrassing to watch, but it showed that even during the most pivotal moments facing society - the BBC plays the role of propaganda arm for the establishment, effectively working against the people.

EU – Brussels has a big problem now: monkey see, monkey do. As we mentioned before, even if you think the Scotland ‘YES’ drive was an EU/Eurozone trojan horse, Scotland’s exercise in people power has sent shock waves through the European Union’s bureaucratic gravy train. The whole concept of the referendum is something that Brussels technocrats would prefer be left in the theoretical realm, and not something that people can actually do. If the EU actually allowed its members to engage in real democratic activities (like holding referendums), it would lead to a shrinking of the Union and Eurozone.

Scotland is settled for now, but what Britain is left with is its biggest Constitutional crisis in 300 years. There is a lot happening in, and out of Westminster and unfortunately most of it is happening completely outside of the democratic process. Even though it came down as a NO vote, David Cameron is still talking about a”settlement for Scotland” and other “settlements”, but what he’s really talking about is restructuring government as we know.

Pundits have listed a number of possible scenarios we could have expect from either a ‘YES’ or a ‘NO’ result in Scotland, and either way you cut it, almost every turn will eventually result in a full-blown constitutional crisis. The future of the EU has no room for nation states or national Constitutions. Nation states will be replaced by regions and feudal city states and these will require a hardened fascist framework to hold it together. Is this the “settlement that David Cameron is referring to? It’s all in the EU’s own forward planning documents.

The ground is shifting beneath our feet and a surprisingly few are taking any notice.

But you won’t read about that in The Times or hear it on the BBC…

Westminster in Panic: In the Wake of The Scottish Referendum

September 20th, 2014 by Binoy Kampmark

They won’t be going anywhere.  The Scottish “No” vote may well have had their day on Friday, but the genie of Britannic rejection is definitely out of its confined bottle. The United Kingdom is feeling the strain and stretch of secession sentiment, and those in London are scurrying about in a panic.
 
The figures are not entirely comforting for the unionists.  Of 3,619,915 votes cast, 2,001,926 went for negative; with 1,617,989 for secession.  The Yes vote may well have come second in the count, but there is a feeling that those attempting to quash the matter had to start that rather unimaginative trick called fear.  The question most popularly thrown at the electorate was: “What if?”  Leaving can be such a terrible business, and at a certain point, there was a sense that the Prime Minister was evoking the calamity of Nora walking out of Ibsen’s A Doll’s House.  Do you really want to go on a voyage of self-discovery and leave husband and children behind?

Much of the campaign for the union ranged between disingenuousness to plain old sentimentality at a comfortably tired marriage that needed to persist in the usual, none too exciting conjugal rituals.  There was nothing in the No campaign to suggest that they had found the spice – only the terror that rejection might well follow.

That fear was also saddled with the idea of terrible inconvenience. European Commission President José Manuel Barroso decided to abandon all pretence of being neutral, making it clear that an impetuous Scotland would have to go to the end of the European Union admission queue if it was to attain independence.  Barroso saw the result as “good for a united, open, and stronger Europe, for which the Commission stands”, making the almost daft suggestion that an independent Scotland was inconsistent with a unified Europe to begin with.

Caught with its pants down, the campaign for the union fought for the most part with an enthusiasm that comes with status quo indifference.  But then, the emotive side got worked up with speculations about the UK’s physical being.  Scotland leaving would be like one’s leg sauntering off into the distance, or an arm going on permanent holiday.

This image tended to play out in a structural sense on such forums as NATO and the United Nations Security Council.  Exeunt Scotland, exeunt British presence and pro-US compliance.  Even the US President, Barack Obama, was hoping via unholy social media that five million Scots would not be forming their own country, if only because he might have to do the work of subordinating another state.  (Aircraft Carrier Britain sounds better than frigate Scotland.)  NATO Secretary General Anders Fogh Rasmussen would second that: “I respect the choice of the Scottish people, I welcome the statement by Prime Minister Cameron that the UK will go ahead as a united country.”

Prime Minister David Cameron could only fall back on grand statements about how the question had been settled.  “The debate has been settled for a generation … and there can be no disputes, no re-runs, we have heard the settled will of the Scottish people.”

Then came the oil and gas industry front men cooing at the result, the sort of thing that should make people break down parliament’s doors.  Scottish oil services tycoon Sir Ian Wood and Shell CEO Ben van Beurden, hardly the doyens of democracy, were content that the issue had been postponed.  Wood was “pleased the Scottish people had chosen the best of both worlds” which for such a figure tends to mean neither.[1] Wood could not wait to emphasise the recommendations made by his own “Maximising Economic Recovery Review”, which relegated Scotland to a natural resource salvager for cash-strapped Britain.  The oil and gas industry, he warned, had been depleted “in the medium term and certainly areas like the North East of Scotland must begin to take this seriously”.

The effects of the vote have spilled off in numerous directions.  There is the effect in the UK itself.
Devolution has been asymmetrical in effect – what the Scottish vote has also illuminated are issues of governance for the rest of the Union.  There is already talk about England being for England, which goes to show that a vote about Scotland invariably becomes a debate about what the English themselves are going to do.

Even Cameron had to admit that, “Just as Scotland will vote separately in the Scottish parliament on their issues of tax, spending and welfare, so too England, as well as Wales and Northern Ireland should be able to vote on these issues.”

Any sort of nationalism, even the good natured fluffy sort, is bound to get ugly, the sort of playground cowardice that passes for genuine debate, but there is only one issue on the cards here: self-governance.  Cameron will have to cough up more, giving Scotland autonomy over everything short – and only just short – of foreign affairs and defence.  And nothing he does will convince the voters in general that London is more distant than ever.

Then came the European spill off, frothing its way into other countries with that old secession bug. The Catalonian regional parliament did not waste time, passing a vote (106-28) that would authorise the region to hold non-binding consultations regarding independence in November.  Catalonia’s regional president, Artur Mas, was cheery.  “What happened in Scotland and the United Kingdom is not a setback for us – because what we really want in Catalonia is to have the chance to vote, the same possibility.”[2]  The Spanish Prime Minister, Mariano Rajoy, has preferred to get the legal briefs together and challenge the move in Spain’s Constitutional Court.

European separatists have certainly warmed to the result, despite it going against the Scottish nationalists.  The recipe here is spiced by a confident assertion of greater autonomy.  The central power is bound to be running scared – regional authorities are getting tetchy.

The New Flemish Alliance (N-VA) led by Bart De Wever and South Tyrolean separatists comprised of the South Tyrolean Freedom (STF) party, for instance, have taken heart, suggesting that Europe may have to head to more regionalist forms of government, something like continental devolution.  The tremors of succession, in other words, are very much on the wall – and that wall is hardly going to be washed anytime too soon.
 
Dr. Binoy Kampmark was a Commonwealth Scholar at Selwyn College, Cambridge.  He lectures at RMIT University, Melbourne.  Email: [email protected]

Notes:

First published in 2008

The sugar coated bullets of the “free market” are killing our children. The act to kill is unpremeditated. It is instrumented in a detached fashion through computer program trading on the New York and Chicago mercantile exchanges, where the global prices of rice, wheat and corn are decided upon. 

Poverty is not solely the result of policy failures at a national level. People in different countries are being impoverished simultaneously as a result of a global market mechanism. A small number of  financial institutions and global corporations have the ability to determine, through market manipulation, the standard of living of millions of people around the World.

We are at the crossroads of the most serious economic and social crisis in modern history. The process of global impoverishment unleashed at the outset of the 1980s debt crisis has reached a major turning point, leading to the simultaneous outbreak of famines in all major regions of the developing World.

There are many complex features underlying the global economic crisis pertaining to financial markets, the decline in production, the collapse of State institutions and the rapid development of a profit-driven war economy. What is rarely mentioned in this analysis, is how this global economic restructuring forcibly impinges on three fundamental necessities of life: food, water and fuel.

The provision of food, water and fuel is a precondition of civilized society: they are necessary factors for the survival of the human species. In recent years, the prices of these three variables has increased dramatically at the global level, with devastating economic and social consequences.

These three essential goods or commodities, which in a real sense determine the reproduction of economic and social life on planet earth, are under the control of a small number of global corporations and financial institutions.

Both the State as well as the gamut of international organizations –often referred to as the “international community”– serve the unfettered interests of global capitalism. The main intergovernmental bodies including the United Nations, the Bretton Woods institutions and the World Trade Organizations (WTO) have endorsed the New World Order on behalf of their corporate sponsors.  Governments in both developed and developing countries have abandoned their historical  role of regulating key economic variables as well as ensuring a minimum livelihood for their people.

Protest movements directed against the hikes in the prices of food and gasoline have erupted simultaneously in different regions of the World. The conditions are particularly critical in Haiti, Nicaragua, Guatemala, India, Bangladesh. Spiraling food and fuel prices in Somalia have precipitated the entire country into a situation of mass starvation, coupled with severe water shortages. A similar and equally serious situation prevails in Ethiopia.

Other countries affected by spiraling food prices include Indonesia, the Philippines, Liberia, Egypt, Sudan, Mozambique, Zimbabwe, Kenya, Eritrea, a long list of impoverished countries…, not to mention those under foreign military occupation including Iraq, Afghanistan and Palestine.

Famine in Ethiopia, June 2008

Most of these labourers in Kurigram go hungry in these three months because of sheer unemployment and a rise in the price of essentials

Deregulation 

The provision of food, water and fuel are no longer the object of governmental or intergovernmental regulation or intervention, with a view to alleviating poverty or averting the outbreak of famines.

The fate of millions of human beings is managed behind closed doors in the corporate boardrooms as part of a profit driven agenda.

And because these powerful economic actors operate through a seemingly neutral and “invisible” market mechanism, the devastating social impacts of engineered hikes in the prices of food, fuel and water are casually dismissed as the result of supply and demand considerations.

Nature of the Global Economic and Social Crisis

Largely obfuscated by official and media reports, both the ” food crisis” and the ” oil crisis” are the result of the speculative manipulation of market values by powerful economic actors.

We are not dealing with distinct and separate food,  fuel  and water “crises” but with a global process of economic and social restructuring.

The dramatic price hikes of these three essential commodities is not haphazard. All three variables, including the prices of basic food staples, water for production and consumption and fuel are the object of a process of deliberate and simultaneous market manipulation.

At the heart of the food crisis is the rising price of food staples coupled with a dramatic increase in the price of fuel.

Concurrently, the price of water which is an essential input into agricultural and industrial production, social infrastructure, public sanitation and household consumption has increased abruptly as a result of a Worldwide movement to privatize water resources.

We are dealing with a major economic and social upheaval, an unprecedented  global crisis, characterized by the triangular relationship between water, food and fuel: three fundamental variables, which together affect the very means of human survival.

In very concrete terms, these price hikes impoverish and destroy peoples lives. Moreover, the Worldwide collapse in living standards is occurring at a time of war. It is intimately related to the military agenda. The war in the Middle East bears a direct relationship to the control over oil and water reserves.

While water is not at present an internationally trade commodity in the same way as oil and food staples, it is also the object of market manipulation through the privatization of water.

The economic and financial actors operating behind closed doors, are:

- the major Wall Street banks and financial houses, including the institutional speculators which play a direct role in commodity markets including the oil and food markets

-The Anglo-American oil giants, including British Petroleum (BP), ExxonMobil, Chevron-Texaco, Royal Dutch Shell

-The biotech-agribusiness conglomerates, which own the intellectual property rights on seeds and farm inputs. The biotech companies are also major actors on the NY and Chicago mercantile exchanges.

-The water giants including Suez, Veolia and Bechtel-United Utilities, involved in the extensive privatization of the World’s water resources.

-The Anglo-American military-industrial complex which includes the big five US defense contractors (Lockheed Martin, Raytheon, Northrop Grunman, Boeing and General Dynamics) in alliance with British Aerospace Systems Corporation (BAES) constitutes a powerful overlapping force, closely aligned with Wall Street, the oil giants and the agribusiness-biotech conglomerates.

The Oil Price Bubble 

The movement in global prices on the New York and Chicago mercantile exchanges bears no relationship to the costs of producing oil. The spiraling price of crude oil is not the result of a shortage of oil. It is estimated that the cost of a barrel of oil in the Middle East does not exceed 15 dollars. The costs of a barrel of oil extracted from the tar sands of Alberta, Canada, is of the order of $30 (Antoine Ayoub, Radio Canada, May 2008)

The price of crude oil is currently in excess of $120 a barrel. This market price is largely the result of the speculative onslaught.


Source: NYMEX

Fuel enters into the production of virtually all areas of manufacturing, agriculture and the services economy.  The hikes in fuel prices have contributed, in all major regions of the World, to precipitating tens of thousands of small and medium sized businesses into bankruptcy as well as undermining and potentially paralyzing the channels of domestic and international trade.

The increased cost of gasoline at the retail level is leading to the demise of local level economies, increased industrial concentration and a massive centralization of economic power in the hands of a small number of global corporations. In turn, the hikes in fuel backlash on the urban transit system, schools and hospitals, the trucking industry, intercontinental shipping, airline transportation, tourism, recreation and most public services.

Inflation

The rise in fuel prices unleashes a broader inflationary process which results in a compression of real purchasing power and a consequent Worldwide decline in consumer demand. All major sectors of society, including the middle classes in the developed countries are affected.

These price movements are dictated by the commodity markets. They are the result of speculative trade in index funds, futures and options on major commodity markets including the London ICE, the New York and Chicago mercantile exchanges.

The dramatic price hikes are not the result of a shortage of fuel, food or water.

This upheaval in the global economy is deliberate. The State’s economic and financial policies are controlled by private corporate interests. Speculative trade is not the object of regulatory policies. The economic depression contributes to wealth formation, to enhancing the power of a handful of global corporations

According to William Engdahl;

 ”… At least 60% of the 128 per barrel price of crude oil comes from unregulated futures speculation by hedge funds, banks and financial groups using the London ICE Futures and New York NYMEX futures exchanges and uncontrolled inter-bank or Over-The-Counter trading to avoid scrutiny. US margin rules of the government’s Commodity Futures Trading Commission allow speculators to buy a crude oil futures contract on the Nymex, by having to pay only 6% of the value of the contract. At today’s price of $128 per barrel, that means a futures trader only has to put up about $8 for every barrel. He borrows the other $120. This extreme ‘leverage’ of 16 to 1 helps drive prices to wildly unrealistic levels and offset bank losses in sub-prime and other disasters at the expense of the overall population. (See More on the real reason behind high oil prices, Global Research, May 2008)

Among the main players in the speculative market for crude oil are Goldman Sachs, Morgan Stanley, British Petroleum (BP), the French banking conglomerate Société Générale, Bank of America, the largest Bank in the US, and Switzerland’s Mercuria. (See Miguel Angel Blanco, La Clave, Madrid, June 2008)

British Petroleum controls the London based International Petroleum Exchange (IPE), which is one of the world’s largest energy futures and options exchanges. Among IPE’s major shareholders are Goldman Sachs and Morgan Stanley.

According to Der Spiegel, Morgan Stanley is one of the main institutional actors in the London based speculative oil market (IPE). According to Le Monde, France’s Société Générale together with Bank of America and Deutsche Bank have been involved in spreading rumors with a view to pushing up the price of crude oil. (See Miguel Angel Blanco, La Clave, Madrid, June 2008)

Spiraling Food Prices

The global food crisis, characterized by major hikes in the prices of basic food staples, has spearheaded millions of people around the World into starvation and chronic deprivation.

According to the FAO, the price of grain staples has increased by 88% since March 2007. The price of wheat has increased by 181% over a three year period. The price of rice has increased by 50% over the last three months (See Ian Angus, Food Crisis: “The greatest demonstration of the historical failure of the capitalist model”, Global Research, April 2008):

The price of rice has tripled over a five year period, from approximately 600$ a ton in 2003 to more than 1800$ a ton in May 2008. (see chart below)

“The most popular grade of Thailand rice sold for $198 a ton, five years ago and $323 a ton a year ago. In April 2008, the price hit $1,000. Increases are even greater on local markets — in Haiti, the market price of a 50 kilo bag of rice doubled in one week at the end of March 2008. These increases are catastrophic for the 2.6 billion people around the world who live on less than US$2 a day and spend 60% to 80% of their incomes on food. Hundreds of millions cannot afford to eat” (Ibid)

The main actors in the grain market are Cargill and Archer Daniels Midland (ADM). These two corporate giants control a large share of the global grain market. They are also involved in speculative transactions in futures and options on the NYMEX and the Chicago Board of Trade (CBOT).  In the US, “the world’s largest grower of GM crops, Cargill, ADM and competitor Zen Noh between them control 81 per cent of all maize exports and 65 per cent of all soyabean exports.” ( Greg Muttitt, Control Freaks, Cargill and ADM, The Ecologist, March, 2001)

RICE

WHEAT

CORN

Source: Chicago Board of Trade

Background of Agricultural Reform

Since the early 1980s coinciding with the onslaught of the debt crisis, the gamut of neoliberal macroeconomic policy reforms have largely contributed to undermining local agriculture. Over the last 25 years, food farming in developing countries has been destabilized and destroyed by the imposition of IMF-World Bank reforms.

Commodity dumping of grain surpluses from the US, Canada and the European Union has led to the demise of food self-sufficiency and the destruction of the local peasant economy. In turn, this process has resulted in multibillion dollar profits for Western agribusiness, resulting from import contracts by developing countries, which are no longer able to produce their own food.

These preexisting historical conditions of mass poverty have been exacerbated and aggravated by the recent surge in grain prices, which have led in some cases to the doubling of the retail price of food staples.

The price hikes has also been exacerbated by the use of corn to produce ethanol. In 2007, global production of corn was of the order of 12.32 billion bushels of which 3.2 billion were used for ethanol production. Almost 40 percent of corn production in the US will be channeled towards ethanol

Genetically Modified Seeds

Coinciding with the establishment the World Trade Organization (WTO) in 1995, another important historical change has occurred in the structure of global agriculture.

Under the articles of agreement of the World Trade Organization (WTO)), the food giants have been granted unrestricted freedom to enter the seeds’ markets of developing countries.

The acquisition of exclusive “intellectual property rights” over plant varieties by international agro-industrial interests, also favors the destruction of bio-diversity.

Acting on behalf of a handful of biotech conglomerates  GMO seeds have been imposed on farmers, often in the context of “food aid programs”.  In Ethiopia, for instance, kits of GMO seeds were handed out to impoverished farmers with a view to rehabilitating agricultural production in the wake of a major drought.

The GMO seeds were planted, yielding a harvest. But then the farmer came to realize that the GMO seeds could not be replanted without paying royalties to Monsanto, Arch Daniel Midland et al.

Then, the farmers discovered that the seeds would harvest only if they used the farm inputs including the fertilizer, insecticide and herbicide, produced and distributed by the biotech agribusiness companies. Entire peasant economies were locked into the grip of the agribusiness conglomerates.

The main biotech giants in GMO include Monsanto, Syngenta, Aventis, DuPont, Dow Chemical, Cargill and Arch Daniel Midland.

Breaking The Agricultural Cycle

With the widespread adoption of GMO seeds, a major transition has occurred in the structure and history of settled agriculture since its inception 10,000 years ago.

The reproduction of seeds at the village level in local nurseries has been disrupted by the use of genetically modified seeds.  The agricultural cycle, which enables farmers to store their organic seeds and plant them to reap the next harvest has been broken. This destructive pattern – invariably resulting in famine – is replicated in country after country leading to the Worldwide demise of the peasant economy.

The FAO- World Bank Consensus

At the June 2008 FAO Rome Summit on the food crisis, politicians and economic analysts alike embraced the free market consensus: the outbreak of famines was presented as a result of the usual supply, demand and climatic considerations, beyond the control of policy-makers. “The solution”: channel emergency relief to affected areas under the auspices of the World Food Program (WFP). Do not intervene with the interplay of market forces.

Ironically, these ” expert opinions” are refuted by the data on global grain production: the FAO forecasts for world cereal production point to a record output in 2008.

Contradicting their own textbook explanations, World prices are, according to the World Bank, expected to remain high, despite the forcasted increased supply of food staples.

State regulation of the prices of food staples and gasoline is not considered an option in the corridors of the FAO and the World Bank. And of course that is what is taught in the economics departments of America’s most prestigious universities.

Meanwhile, local level farmgate prices barely cover production costs, spearheading the peasant economy into bankruptcy.

The Privatization of Water 

According to UN sources, which vastly underestimate the seriousness of the water crisis, one billion people worldwide (15% of the World population) have no access to clean water “and 6,000 children die every day because of infections linked to unclean water” (BBC News, 24 March 2004)

A handful of global corporations including Suez, Veolia, Bechtel-United Utilities, Thames Water and Germany’s RWE-AG are acquiring control and ownership over public water utilities and waste management.  Suez and Veolia hold about 70 percent of the privatized water systems Worldwide.

The privatization of water under World Bank auspices feeds on the collapse of the system of public distribution of safe tap drinking water: “The World Bank serves the interests of water companies both through its regular loan programs to governments, which often come with conditions that explicitly require the privatization of water provision…” (Maude Barlow and Tony Clarke, Water Privatization: The World Bank’s Latest Market Fantasy, Polaris Institute, Ottawa, 2004))

 ”The modus operandi [in India] is clear — neglect development of water resources [under World Bank budget austerity measures], claim a “resource crunch” and allow existing systems to deteriorate.” (Ann Ninan, Private Water, Public Misery, India Resource Center April 16, 2003)

Meanwhile, the markets for bottled water have been appropriated by a handful of corporations including Coca-Cola, Danone, Nestlé and PepsiCo. These companies not only work hand in glove with the water utility companies, they are linked up to the agribusiness-biotech companies involved in the food industry. Tap water is purchased by Coca-Cola from a municipal water facility and then resold on a retail basis. It is estimated that in the US, 40 percent of bottled water is tap water. (See, Jared Blumenfeld, Susan Leal The real cost of bottled water, San Francisco Chronicle, February 18, 2007)

In India, Coca-Cola has contributed to the depletion of ground water to the detriment of local communities:

“Communities across India living around Coca-Cola’s bottling plants are experiencing severe water shortages, directly as a result of Coca-Cola’s massive extraction of water from the common groundwater resource. The wells have run dry and the hand water pumps do not work any more. Studies, including one by the Central Ground Water Board in India, have confirmed the significant depletion of the water table.

When the water is extracted from the common groundwater resource by digging deeper, the water smells and tastes strange. Coca-Cola has been indiscriminately discharging its waste water into the fields around its plant and sometimes into rivers, including the Ganges, in the area. The result has been that the groundwater has been polluted as well as the soil. Public health authorities have posted signs around wells and hand pumps advising the community that the water is unfit for human consumption….

Tests conducted by a variety of agencies, including the government of India, confirmed that Coca-Cola products contained high levels of pesticides, and as a result, the Parliament of India has banned the sale of Coca-Cola in its cafeteria. However, Coca-Cola not only continues to sell drinks laced with poisons in India (that could never be sold in the US and EU), it is also introducing new products in the Indian market. And as if selling drinks with DDT and other pesticides to Indians was not enough, one of Coca-Cola’s latest bottling facilities to open in India, in Ballia, is located in an area with a severe contamination of arsenic in its groundwater.(India Resource Center, Coca-Cola Crisis in India, undated)

In developing countries, the hikes in fuel prices have increased the costs of boiling tap water by households, which in turn favors the privatization of water resources.

In the more advanced phase of water privatization, the actual ownership of lakes and rivers by private corporations is contemplated. Mesopotamia was not only invaded for its extensive oil resources, the Valley of the two rivers (Tigris and Euphrates)  has extensive water reserves.

Concluding Remarks 

We are dealing with a complex and centralized constellation of economic power in which the instruments of market manipulation have a direct bearing on the lives of millions of people.

The prices of food, water, fuel are determined at the global level, beyond the reach of national government policy. The price hikes of these three essential commodities constitute an instrument of “economic warfare”, carried out through the “free market” on the futures and options exchanges.

These hikes in the prices of food, water and fuel are contributing in a very real sense to “eliminating the poor” through “starvation deaths”. The sugar coated bullets of the “free market” kill our children. The act to kill is instrumented in a detached fashion through computer program trading on the commodity exchanges, where the global prices of rice, wheat and corn are decided upon.

‘The Commission on Population Growth and the American Future’

But we are not dealing solely with market concepts. The outbreak of famines in different parts of the World, resulting from spiraling food and fuel prices have broad strategic and geopolitical implications.

President Richard Nixon at the outset of his term in office in 1969 asserted “his belief that overpopulation gravely threatens world peace and stability.”  Henry Kissinger, who at the time was Nixon’s National Security adviser, directed various agencies of government to jointly undertake “a study of the impact of world population growth on U.S. security and overseas interests.”

In March 1970, the U.S. Congress set up a Commission on Population Growth and the American Future. (See Center for Research on Population and Security). The Commission was no ordinary Task Force. It integrated representatives from USAID, the State Department and the Department of Agriculture with CIA and Pentagon officials. Its objective was not to assist developing countries but rather to curb World population with a view to serving US strategic and national security interests. The Commission also viewed population control as a means to ensuring a stable and secure environment for US investors as well as gaining control over developing countries’ mineral and petroleum resources.

This Commission completed its work in December 1974 and circulated  a classified document entitled  National Security Study Memorandum 200: Implications of Worldwide Population Growth for U.S. Security and Overseas Interests”  to “designated Secretaries and Agency heads for their review and comments.” In November 1975, the report and its recommendations were endorsed by President Gerald Ford.

Kissinger had indeed intimated in the context of the National Security Study Memorandum 200 (NSSSM 200)  that the recurrence of famines, disease and war could constitute a de facto instrument of population control.

Although the NSSM 200 report did not assign, for obvious reasons, an explicit  policy role to famine formation, it nonetheless intimated that the occurrence of famines could, under certain circumstances, provide a de facto solution to overpopulation:

“Accordingly, those countries where large-scale hunger and malnutrition are already present face the bleak prospect of little, if any, improvement in the food intake in the years ahead barring a major foreign financial food aid program, more rapid expansion of domestic food production, reduced population growth or some combination of all three. Worse yet, a series of crop disasters could transform some of them into classic Malthusian cases with famines involving millions of people.

While foreign assistance probably will continue to be forthcoming to meet short-term emergency situations like the threat of mass starvation, it is more questionable whether aid donor countries will be prepared to provide the sort of massive food aid called for by the import projections on a long-term continuing basis.

Reduced population growth rates clearly could bring significant relief over the longer term.….

In the extreme cases where population pressures lead to endemic famine, food riots, and breakdown of social order, those conditions are scarcely conducive to systematic exploration for mineral deposits or the long-term investments required for their exploitation. Short of famine, unless some minimum of popular aspirations for material improvement can be satisfied, and unless the terms of access and exploitation persuade governments and peoples that this aspect of the international economic order has “something in it for them,” concessions to foreign companies are likely to be expropriated or subjected to arbitrary intervention. Whether through government action, labor conflicts, sabotage, or civil disturbance, the smooth flow of needed materials will be jeopardized. Although population pressure is obviously not the only factor involved, these types of frustrations are much less likely under conditions of slow or zero population growth.”

(1974 National Security Study Memorandum 200: Implications of Worldwide Population Growth for U.S. Security and Overseas Interests”. (emphasis added)

The report concludes with a couple of key questions pertaining to the role of food as “an instrument of national power”, which could be used in the pursuit of US strategic interests.

  • On what basis should such food resources then be provided? Would food be considered an instrument of national power? Will we be forced to make choices as to whom we can reasonably assist, and if so, should population efforts be a criterion for such assistance?
  • Is the U.S. prepared to accept food rationing to help people who can’t/won’t control their population growth?” (Ibid, emphasis added)

In the words of Henry Kissinger: “Control oil and you control nations; control food and you control the people.”


ANNEX

Corporate Actors highlighted in this article (among many other important corporate actors)

Speculative Trade in Crude Oil:

Goldman Sachs, Morgan Stanley, British Petroleum (BP), Deutsche Bank, Société Générale, Bank of America, Switzerland’s Mercuria.

Water Privatization

Water Infrastructure: Suez, Veolia, Bechtel-United Utilities, Thames Water and Germany’s RWE-AG

Retail Distribution of Drinking Water: Coca-Cola, Danone, Nestlé and PepsiCo

Food Prices and Genetically Modified Seeds

Monsanto, Syngenta, Aventis, DuPont, Dow Chemical, Cargill,  Arch Daniel Midland.

Military Industrial Complex

Lockheed Martin, Raytheon, Northrop Grunman, Boeing, General Dynamics, British Aerospace Systems Corporation (BAES)

The Globalization of Poverty and the New World Order 

by Michel Chossudovsky

originalIn this new and expanded edition of Chossudovsky’s international best-seller, the author outlines the contours of a New World Order which feeds on human poverty and the destruction of the environment, generates social apartheid, encourages racism and ethnic strife and undermines the rights of women. The result as his detailed examples from all parts of the world show so convincingly, is a globalization of poverty.

This book is a skilful combination of lucid explanation and cogently argued critique of the fundamental directions in which our world is moving financially and economically.

In this new enlarged edition –which includes ten new chapters and a new introduction– the author reviews the causes and consequences of famine in Sub-Saharan Africa, the dramatic meltdown of financial markets, the demise of State social programs and the devastation resulting from corporate downsizing and trade liberalisation.

Michel Chossudovsky is Professor of Economics at the University of Ottawa and Director of the Centre for Research on Globalization (CRG), which hosts the critically acclaimed website www.globalresearch.ca . He is a contributor to the Encyclopedia Britannica. His writings have been translated into more than 20 languages.

Published in 11 languages. More than 100,000 copies sold Worldwide.

 TO ORDER ONLINE OR MAIL ORDER CLICK HERE

“The present invention is based upon the isolation and identification of a new human Ebola virus species, EboBun and the sequencing of the only other known West African Ebola species EboIC. EboBun was isolated from the patients suffering from hemorrhagic fever in a recent outbreak in Uganda.

The isolated virus is a member of the Filoviridae family, a family of negative sense RNA viruses. Accordingly, the invention relates to the isolated EboBun or EBOIC virus that morphologically and phylogenetically relates to known members filoviridae.”

Publication number US20120251502 A1
Publication type Application
Application number US 13/125,890
PCT number PCT/US2009/062079
Publication date Oct 4, 2012
Filing date Oct 26, 2009
Priority date Oct 24, 2008
Also published as CA2741523A1, 4 More »
Inventors Jonathan S. Towner, 4 More »
Original Assignee The Government of the US as Represented by the Secretary of the Dept. of health
Export Citation BiBTeX, EndNote, RefMan
Patent Citations (2), Non-Patent Citations (8), Classifications (39), Legal Events (1)
External Links: USPTO, USPTO Assignment, Espacenet

Human Ebola Virus Species and Compositions and Methods Thereof

US 20120251502 A1

Abstract

Compositions and methods including and related to the Ebola Bundibugyo virus (EboBun) are provided. Compositions are provided that are operable as immunogens to elicit and immune response or protection from EboBun challenge in a subject such as a primate. Inventive methods are directed to detection and treatment of EboBun infection.
Images(27)
click to open
Patent Drawing
Patent Drawing
Patent Drawing
Patent Drawing
Patent Drawing
Patent Drawing
Patent Drawing
Patent Drawing
Patent Drawing
Patent Drawing
Patent Drawing
Patent Drawing
Patent Drawing
Patent Drawing
Patent Drawing
Patent Drawing
Patent Drawing
Patent Drawing
Patent Drawing
Patent Drawing
Patent Drawing
Patent Drawing
Patent Drawing
Patent Drawing
Patent Drawing
Patent Drawing
Patent Drawing
Claims(30)
1. An isolated hEbola virus comprising a nucleic acid molecule comprising a nucleotide sequence of:
a) a nucleotide sequence set forth in SEQ ID NOS: 1 or 10;
b) a nucleotide sequence hybridizing under stringent conditions to SEQ ID NOS: 1 or 10; or
c) a nucleotide sequence of at least 70%-99% identity to the SEQ ID NOS: 1 or 10, with the proviso that said nucleotide sequence is not SEQ ID NO: 20.
2. An isolated hEbola virus having Centers for Disease Control Deposit Accession No. 200706291.
3. The hEbola virus of claim 1 which is killed.
4. The hEbola virus of claim 1 which is an attenuated hEbola virus.
5. The virus of claim 4 wherein at least one property of the attenuated hEbola virus is reduced from among infectivity, replication ability, protein synthesis ability, assembling ability or cytopathic effect.
6. An isolated nucleic acid molecule comprising the nucleotide sequence of SEQ ID NOS: 1 or 10 or a complement thereof, or a fragment thereof wherein said fragment comprises a nucleotide sequence of between 4 and 4900 contiguous nucleotides of the nucleotide sequence of SEQ ID NOS: 1 or 10, or a complement thereof; with the proviso that said nucleotide sequence is not comprised by the nucleotide sequence set forth in SEQ ID NO: 20; or between 5500 and 6600 contiguous nucleotides of the nucleotide sequence of SEQ ID NOS: 1 or 10, or a complement thereof.
7. The isolated nucleic acid molecule of claim 6 comprising a nucleotide sequence of between 4 and 4900 contiguous nucleotides of the nucleotide sequence of SEQ ID NOS: 1 or 10, or a complement thereof; with the proviso that said nucleotide sequence is not comprised by the nucleotide sequence set forth in SEQ ID NO: 20; or between 5500 and 6600 contiguous nucleotides of the nucleotide sequence of SEQ ID NOS: 1 or 10, or a complement thereof.
8. The isolated nucleic acid molecule of claim 7 comprising a nucleotide sequence that encodes the amino acid sequence of SEQ ID NO: 2-9, 59, or SEQ ID NO: 11-19 or a complement thereof.
9. An isolated RNA or DNA nucleic acid molecule which hybridizes under stringent conditions to a nucleic acid molecule having the nucleotide sequence of SEQ ID NOS: 1 or 10 or a complement thereof.
10. An isolated polypeptide encoded by the nucleic acid molecule of claim 7.

11. The polypeptide of claim 10 comprising the amino acid of:

a) an amino acid sequence set forth in any of SEQ ID NOS: 2-19, or 59; or
b) an amino acid sequence that has 70%-99% homology to the amino acid sequence of (a).

12. The polypeptide of claim 10 wherein the amino acid sequence has

5 to 250 contiguous amino acid residues of the amino acid sequence of SEQ ID NOS: 5 or 18 (VP24);
5 to 280 contiguous residues of the amino acid sequence of SEQ ID NOS: 6 or 17 (VP30);
5 to 320 contiguous residues of the amino acid sequence of SEQ ID NOS: 8 or 13 (VP40);
5 to 340 contiguous residues of the amino acid sequence of SEQ ID NOS: 7 or 12 (VP35);
5 to 370 contiguous residues of the amino acid sequence of SEQ ID NOS: 4 or 15 (SGP);
5 to 370 contiguous residues of the amino acid sequence of SEQ ID NOS: 59 or 16 (SSGP);
5 to 670 contiguous residues of the amino acid sequence of SEQ ID NOS: 9 or 14 (GP);
5 to 730 contiguous residues of the amino acid sequence of SEQ ID NOS: 3 or 11 (NP); or
5 to 2200 contiguous residues of the amino acid sequence of SEQ ID NOS: 2 or 19 (L).
13. (canceled)
14. (canceled)
15. (canceled)
16. (canceled)
17. (canceled)
18. (canceled)
19. (canceled)
20. The hEbola virus of claims 3 or 4, or a protein extract therefrom, and a pharmaceutically acceptable carrier.
21. (canceled)
22. The nucleic acid molecule of claims 6 or 9, and a pharmaceutically acceptable carrier.
23. (canceled)
24. (canceled)
25. (canceled)
26. (canceled)
27. (canceled)
28. (canceled)
29. (canceled)
30. (canceled)

Description

RELATED APPLICATIONS

This application claims priority benefit of U.S. Provisional Application 61/108,175 filed 24 Oct. 2008; the contents of which are hereby incorporated by reference.

DEPOSIT STATEMENT

The invention provides the isolated human Ebola (hEbola) viruses denoted as Bundibugyo (EboBun) deposited with the Centers for Disease Control and Prevention (“CDC”; Atlanta, Ga., United States of America) on Nov. 26, 2007 and accorded an accession number 200706291. This deposit was not made to an International Depository Authority (IDA) as established under the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure, and is a non-Budapest treaty deposit. The deposited organism is not acceptable by American Type Culture Collection (ATCC), Manassas, Va., an International Depository Authority (IDA) as established under the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure. Samples of the stated Deposit Accession No. 200706291 will be made available to approved facilities for thirty years from the date of deposit, and for the lifetime of the patent issuing from, or claiming priority to this application.

FIELD OF THE INVENTION

The invention is related to compositions and methods directed to a novel species of human Ebola (hEbola) virus.

BACKGROUND OF THE INVENTION

The family Filoviridae consists of two genera, Marburgvirus and Ebolavirus, which have likely evolved from a common ancestor1. The genus Ebolavirus includes four species: Zaire, Sudan, Reston and Côte d’Ivoire (Ivory Coast) ebolaviruses, which have, with the exception of Reston and Côte d’Ivoire ebolaviruses, been associated with large hemorrhagic fever (HF) outbreaks in Africa with high case fatality (53-90%)2.

Viruses of each species have genomes that are at least 30-40% divergent from one another, a level of diversity that presumably reflects differences in the ecological niche they occupy and in their evolutionary history. Identification of the natural reservoir of ebolaviruses remains somewhat elusive, although recent PCR and antibody data suggest that three species of arboreal fruit bats may be carriers of Zaire ebolavirus3. No data has yet been published to suggest reservoirs for the Sudan, Reston and Côte d’Ivoire ebolavirus species. However, a cave-dwelling fruit bat has been recently implicated as a natural host for marburgvirus4, 5, supporting the hypothesis that different bat species may be the reservoir hosts for the various filoviruses.

Filovirus outbreaks are sporadic, sometimes interspersed by years or even decades of no apparent disease activity. The last new species of ebolavirus was discovered 14 years ago (1994), in Cote d’Ivoire (Ivory Coast), and involved a single non-fatal case, a veterinarian who performed an autopsy on an infected chimpanzee found in the Tai Forest6. No further disease reports have been associated with Côte d’Ivoire ebolavirus, in contrast to Zaire and Sudan ebolaviruses which have each caused multiple large outbreaks over the same time period.

In late November 2007, HF cases were reported in the townships of Bundibugyo and Kikyo in Bundibugyo District, Western Uganda. The outbreak continued through January 2008, and resulted in approximately 149 cases and 37 deaths2. Laboratory investigation of the initial 29 suspect-case blood specimens by classic methods (antigen capture, IgM and IgG ELISA) and a recently developed random-primed pyrosequencing approach identified this to be an Ebola HF outbreak associated with a new discovered ebolavirus species. These specimens were negative when initially tested with highly sensitive real-time RT-PCR assays specific for all known Zaire and Sudan ebolaviruses and Marburg viruses. This new species is referred to herein as “the Bundibugyo species”, abbreviated “EboBun”.

Accordingly, compositions and methods directed to the new Ebola virus species are described herein and the most closely related Ebola Ivory Coast species, which compositions and methods are useful for diagnosis and prevention of human Ebola virus infection; including related vaccine development, and prevention of hemorrhagic fever in a human population.

SUMMARY OF THE INVENTION

The present invention is based upon the isolation and identification of a new human Ebola virus species, EboBun. EboBun was isolated from the patients suffering from hemorrhagic fever in a recent outbreak in Uganda. The isolated virus is a member of the Filoviridae family, a family of negative sense RNA viruses. Accordingly, the invention relates to the isolated EboBun virus that morphologically and phylogenetically relates to known members filoviridae.

In one aspect, the invention provides the isolated EboBun virus deposited with the Centers for Disease Control and Prevention (“CDC”; Atlanta, Ga., United States of America) on Nov. 26, 2007 and accorded an accession number 200706291, as stated in the paragraph entitled “DEPOSIT STATEMENT” supra.

In another aspect, the invention provides an isolated hEbola EboBun virus comprising a nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of: a) a nucleotide sequence set forth in SEQ ID NO: 1; b) a nucleotide sequence that hybridizes to the sequence set forth in SEQ ID NO: 1 under stringent conditions; and c) a nucleotide sequence that has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to the SEQ ID NO: 1. In another aspect, the invention provides the complete genomic sequence of the hEbola virus EboBun.

In a related aspect, the invention provides nucleic acid molecules isolated from EboBun, or fragments thereof.

In another aspect, the invention provides proteins or polypeptides that are isolated from the EboBun, including viral proteins isolated from cells infected with the virus but not present in comparable uninfected cells; or fragments thereof. In one embodiment of the present invention, the amino acid sequences of the proteins or polypeptides are set forth in SEQ ID NOS: 2-9 and 59, or fragments thereof.

In a related aspect, the invention provides an isolated polypeptide encoded by the nucleic acid molecule of the inventive hEbola EboIC (Sequence ID No. 10) virus described above.

In another aspect, the invention provides an isolated hEbola EboIC virus comprising a nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of: a) a nucleotide sequence set forth in SEQ ID NO: 10; b) a nucleotide sequence that hybridizes to the sequence set forth in SEQ ID NO: 10 under stringent conditions; and c) a nucleotide sequence that has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to the SEQ ID NO: 10. In another aspect, the invention provides the complete genomic sequence of the hEbola virus EboIC.

In a related aspect, the invention provides nucleic acid molecules isolated from EboIC, or fragments thereof.

In another aspect, the invention provides proteins or polypeptides that are isolated from the EboIC, including viral proteins isolated from cells infected with the virus but not present in comparable uninfected cells; or fragments thereof. In one embodiment of the present invention, the amino acid sequences of the proteins or polypeptides are set forth in SEQ ID NOs: 11-19, or fragments thereof.

In a related aspect, the invention provides an isolated polypeptide encoded by the nucleic acid molecule of the inventive hEbola EboIC virus described above.

In other aspects, the invention relates to the use of the isolated hEbola virus for diagnostic and therapeutic methods based on EbBun, EboIC, or a combination thereof. In one embodiment, the invention provides a method of detecting in a biological sample an antibody immunospecific for the genus of West Afrin Ebola Species constituting hEbola EbBun and EboIC virus using at least one the inventive isolated hEbola virus described herein, or any of the inventive proteins or polypeptides as described herein. In another specific embodiment, the invention provides a method of screening for an antibody which immunospecifically binds and neutralizes hEbola EboBun. Such an antibody is useful for a passive immunization or immunotherapy of a subject infected with hEbola.

In another aspect, the invention provides an isolated antibody or an antigen-binding fragment thereof which immunospecifically binds to the hEbola virus of the invention described above.

In other aspects, the invention provides methods for detecting the presence, activity or expression of the Glade of Bundibungyo-Ivory Coast hEbola virus in a biological material, such as cells, blood, saliva, urine, feces and so forth; and specifically at least one of EbBun or EboIC.

In a related aspect, the invention provides a method for detecting the presence of the inventive hEbola virus described above in a biological sample, the method includes (a) contacting the sample with an agent that selectively binds to a West African hEbola virus; and (b) detecting whether the compound binds to the West African hEbola virus in the sample.

In another aspect, the invention provides a method for detecting the presence of the inventive polypeptide described above, in a biological sample, said method includes (a) contacting the biological sample with an agent that selectively binds to the polypeptide; and (b) detecting whether the agent binds to the polypeptide in the sample. In another aspect, the invention provides a method for detecting the presence of a first nucleic acid molecule derived from the inventive hEbola virus described above in a biological sample, the method comprising: (a) contacting the biological sample with an agent that selectively binds to the polypeptide; and (b) detecting whether the agent binds to the polypeptide in the sample.

In another aspect, the invention provides a method for propagating the hEbola virus in host cells comprising infecting the host cells with the inventive isolated hEbola virus described above, culturing the host cells to allow the virus to multiply, and harvesting the resulting virions. Also provided by the present invention are host cells infected with the inventive hEbola virus described above.

In another aspect, the invention provides a method of detecting in a biological sample the presence of an antibody that immunospecifically binds hEbola virus, the method comprising: (a) contacting the biological sample with the inventive host cell host described above; and (b) detecting the antibody bound to the cell.

In another aspect, the invention provides vaccine preparations, comprising the inventive hEbola virus, including recombinant and chimeric forms of the virus, nucleic acid molecules comprised by the virus, or protein subunits of the virus. The invention also provides a vaccine formulation comprising a therapeutically or prophylactically effective amount of the inventive hEbola virus described above, and a pharmaceutically acceptable carrier. In one embodiment, the invention provides a vaccine formulation comprising a therapeutically or prophylactically effective amount of a protein extract of the inventive hEbola virus described above, or a subunit thereof; and a pharmaceutically acceptable carrier. In another, the invention provides a vaccine formulation comprising a therapeutically or prophylactically effective amount of a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 1 or a complement thereof, and a pharmaceutically acceptable carrier. In another, the invention provides a vaccine formulation comprising a therapeutically or prophylactically effective amount of a nucleic acid molecule comprising any of inventive the nucleotide sequences as described above, or a complement thereof, and a pharmaceutically acceptable carrier.

In a related aspect, the invention provides an immunogenic formulation comprising an immunogenically effective amount of the inventive hEbola virus described above, and a pharmaceutically acceptable carrier. In another related aspect, the invention provides an immunogenic formulation comprising an immunogenically effective amount of a protein extract of the inventive hEbola virus described above or a subunit thereof, and a pharmaceutically acceptable carrier. In another related aspect, the invention provides an immunogenic formulation comprising an immunogenically effective amount of a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 1 or a complement thereof, and a pharmaceutically acceptable carrier. In another related aspect, the invention provides an immunogenic formulation comprising an immunogenically effective amount of a nucleic acid molecule comprising the inventive nucleotide sequence as described above or a complement thereof, and a pharmaceutically acceptable carrier. In another related aspect, the invention provides an immunogenic formulation comprising an immunogenically effective amount of any of the inventive polypeptides described above.

In another aspect, the present invention provides pharmaceutical compositions comprising antiviral agents of the present invention and a pharmaceutically acceptable carrier. In a specific embodiment, the antiviral agent of the invention is an antibody that immunospecifically binds hEbola virus or any hEbola epitope. In another specific embodiment, the antiviral agent is a polypeptide or protein of the present invention or nucleic acid molecule of the invention.

In a related aspect, the invention provides a pharmaceutical composition comprising a prophylactically or therapeutically effective amount of an anti-hEbola EboBun agent and a pharmaceutically acceptable carrier.

The invention also provides kits containing compositions and formulations of the present invention. Thus, in another aspect, the invention provides a kit comprising a container containing the inventive immunogenic formulation described above. In another aspect, the invention provides a kit comprising a container containing the inventive vaccine formulation described above. In another, the invention provides a kit comprising a container containing the inventive pharmaceutical composition described above. In another, the invention provides a kit comprising a container containing the inventive vaccine formulation described above. In another, the invention provides a method for identifying a subject infected with the inventive hEbola virus described above, comprising: (a) obtaining total RNA from a biological sample obtained from the subject; (b) reverse transcribing the total RNA to obtain cDNA; and (c) amplifying the cDNA using a set of primers derived from a nucleotide sequence of the inventive hEbola virus described above.

The invention further relates to the use of the sequence information of the isolated virus for diagnostic and therapeutic methods.

In another aspect, the present invention provides methods for screening antiviral agents that inhibit the infectivity or replication of hEbola virus or variants thereof.

The invention further provides methods of preparing recombinant or chimeric forms of hEbola.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 represents a Phylogenetic tree comparing full-length genomes of Ebolavirus and Marburg virus by Bayesian analysis;

FIG. 2 represents an alignment of genomes of novel hEbola EboBun (SEQ ID NO: 1) referred to below as “Ebola Bundibugyo” or “EboBun”, and hEbola Zaire (SEQ ID NO: 20); referred to below as “Ebola Zaire ’76” or “EboZ” and hEbola Ivory Coast (SEQ ID NO: 10) also referred to below as “EboIC”.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

It is to be understood that the present invention is not limited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.

Due to the sequence divergence of EboBun relative to all previously recognized ebolaviruses, the present invention has utility in design of diagnostic assays to monitor Ebola HF disease in humans and animals, and develop effective antivirals and vaccines.

The EboBun virus of the present invention is genetically distinct, differing by more than 30% at the genome level from all other known ebolavirus species. The unique nature of this virus created challenges for traditional filovirus molecular based diagnostic assays and genome sequencing approaches. Instead, over 70% of the virus genome was sequenced using a recently developed random-primed pyrosequencing approach which allowed the rapid development of molecular detection assay which were deployed in the disease outbreak response. This random-primed pyrosequencing draft sequence allowed faster completion of the whole genome sequence using traditional primer walking approach and confirmation that the EboBun virus represented a new ebolavirus species.

Definitions

The definitions herein provided are operative throughout the entire description of the invention set forth herein, including the Summary of the Invention.

The term “an antibody or an antibody fragment that immunospecifically binds a polypeptide of the invention” as used herein refers to an antibody or a fragment thereof that immunospecifically binds to the polypeptide encoded by the nucleotide sequence of SEQ ID NO: 1 (EboBun), or a fragment thereof, and does not non-specifically bind to other polypeptides. An antibody or a fragment thereof that immunospecifically binds to the polypeptide of the invention may cross-react with other antigens. Preferably, an antibody or a fragment thereof that immunospecifically binds to a polypeptide of the invention does not cross-react with other antigens. An antibody or a fragment thereof that immunospecifically binds to the polypeptide of the invention can be identified by, for example, immunoassays or other techniques known to those skilled in the art, or otherwise as described herein.

An “isolated” or “purified” peptide or protein is substantially free of cellular material or other contaminating proteins from the cell or tissue source from which the protein is derived, or substantially free of chemical precursors or other chemicals when chemically synthesized. The language “substantially free of cellular material” includes preparations of a polypeptide/protein in which the polypeptide/protein is separated from cellular components of the cells from which it is isolated or recombinantly produced. Thus, a polypeptide/protein that is substantially free of cellular material includes preparations of the polypeptide/protein having less than about 30%, 20%, 10%, 5%, 2.5%, or 1% (by dry weight) of contaminating protein. When the polypeptide/protein is recombinantly produced, it is also preferably substantially free of culture medium, i.e., culture medium represents less than about 20%, 10%, or 5% of the volume of the protein preparation.

When polypeptide/protein is produced by chemical synthesis, it is preferably substantially free of chemical precursors or other chemicals, i.e., it is separated from chemical precursors or other chemicals which are involved in the synthesis of the protein. Accordingly, such preparations of the polypeptide/protein have less than about 30%, 20%, 10%, 5% (by dry weight) of chemical precursors or compounds other than polypeptide/protein fragment of interest. In a preferred embodiment of the present invention, polypeptides/proteins are isolated or purified.

An “isolated” nucleic acid molecule is one which is separated from other nucleic acid molecules which are present in the natural source of the nucleic acid molecule. Moreover, an “isolated” nucleic acid molecule, such as a cDNA molecule, can be substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized. In a preferred embodiment of the invention, nucleic acid molecules encoding polypeptides/proteins of the invention are isolated or purified. The term “isolated” nucleic acid molecule does not include a nucleic acid that is a member of a library that has not been purified away from other library clones containing other nucleic acid molecules.

The term “portion” or “fragment” as used herein includes the specified fragment lengths, and all integers in between, inclusive of the specified end points in a specified range, and inclusive of any length up to the full length of a protein, polypeptide, or nucleic acid.

The term “having a biological activity of the protein” or “having biological activities of the polypeptides of the invention” refers to the characteristics of the polypeptides or proteins having a common biological activity, similar or identical structural domain, and/or having sufficient amino acid identity to the polypeptide encoded by the nucleotide sequence of SEQ ID NO: 1 (EboBun). Such common biological activities of the polypeptides of the invention include antigenicity and immunogenicity.

The term “under stringent condition” refers to hybridization and washing conditions under which nucleotide sequences having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to each other remain hybridized to each other. Such hybridization conditions are described in, for example but not limited to, Current Protocols in Molecular Biology, John Wiley & Sons, NY (1989), 6.3.1-6.3.6; Basic Methods in Molecular Biology, Elsevier Science Publishing Co., Inc., NY (1986), pp. 75-78, and 84-87; and Molecular Cloning, Cold Spring Harbor Laboratory, NY (1982), pp. 387-389, and are well known to those skilled in the art. A preferred, non-limiting example of stringent hybridization conditions is hybridization in 6× sodium chloride/sodium citrate (SSC), 0.5% SDS at about 68° C. followed by one or more washes in 2×SSC, 0.5% SDS at room temperature. Another preferred, non-limiting example of stringent hybridization conditions is hybridization in 6×SSC at about 45° C., followed by one or more washes in 0.2×SSC, 0.1% SDS at about 50-65° C.

The term “variant” as used herein refers either to a naturally occurring genetic mutant of hEbola EboBun, or hEbola EboIC, or a recombinantly prepared variation of these hEbola species, each of which contain one or more mutations in its genome compared to the hEbola of SEQ ID NO: 1 or 10. The term “variant” may also refer either to a naturally occurring variation of a given peptide or a recombinantly prepared variation of a given peptide or protein in which one or more amino acid residues have been modified by amino acid substitution, addition, or deletion.

“Homology” refers to sequence similarity or, alternatively, sequence identity, between two or more polynucleotide sequences or two or more polypeptide sequences.

The terms “percent identity” and “% identity,” as applied to polynucleotide sequences, refer to the percentage of identical nucleotide matches between at least two polynucleotide sequences aligned using a standardized algorithm. Such an algorithm may insert, in a standardized and reproducible way, gaps in the sequences being compared in order to optimize alignment between two sequences, and therefore achieve a more meaningful comparison of the two sequences.

Percent identity between polynucleotide sequences may be determined using one or more computer algorithms or programs known in the art or described herein. For example, percent identity can be determined using the default parameters of the CLUSTAL V algorithm as incorporated into the MEGALIGN version 3.12e sequence alignment program. This program is part of the LASERGENE software package, a suite of molecular biological analysis programs (DNASTAR, Madison, Wis.). CLUSTAL V is described in Higgins, D. G. and P. M. Sharp (1989; CABIOS 5:151-153) and in Higgins, D. G. et al. (1992; CABIOS 8:189-191). For pairwise alignments of polynucleotide sequences, the default parameters are set as follows: Ktuple=2, gap penalty=5, window=4, and “diagonals saved”=4. The “weighted” residue weight table is selected as the default.

Alternatively, a suite of commonly used and freely available sequence comparison algorithms which can be used is provided by the National Center for Biotechnology Information (NCBI) Basic Local Alignment Search Tool (BLAST) (Altschul, S. F. et al. (1990) J. Mol. Biol. 215:403-410), which is available from several sources, including the NCBI, Bethesda, Md., and on the NCBI World Wide Web site available on the Internet. The BLAST software suite includes various sequence analysis programs including “blastn,” that is used to align a known polynucleotide sequence with other polynucleotide sequences from a variety of databases. Also available is a tool called “BLAST 2 Sequences” that is used for direct pairwise comparison of two nucleotide sequences. “BLAST 2 Sequences” can be accessed and used interactively on the Internet via the NCBI World Wide Web site as well. The “BLAST 2 Sequences” tool can be used for both blastn and blastp (discussed below). BLAST programs are commonly used with gap and other parameters set to default settings. For example, to compare two nucleotide sequences, one may use blastn with the “BLAST 2 Sequences” tool Version 2.0.12 (Apr. 21, 2000) set at default parameters. Such default parameters may be, for example: Matrix:BLOSUM62; Reward for match: 1; Penalty for mismatch: −2; Open Gap: 5 and Extension Gap: 2 penalties; Gap×drop-off: 50; Expect: 10; Word Size: 11; Filter: on.

Percent identity may be measured over the length of an entire defined sequence, for example, as defined by a particular SEQ ID number, or may be measured over a shorter length, for example, over the length of a fragment taken from a larger, defined sequence, for instance, a fragment of at least 20, at least 30, at least 40, at least 50, at least 70, at least 100, or at least 200 contiguous nucleotides. Such lengths are exemplary only, and it is understood that any fragment length supported by the sequences shown herein, in the tables, figures, or sequence listing, may be used to describe a length over which percentage identity may be measured.

The phrases “percent identity” and “% identity”, as applied to polypeptide sequences, refer to the percentage of identical residue matches between at least two polypeptide sequences aligned using a standardized algorithm. Methods of polypeptide sequence alignment are well known. Some alignment methods take into account conservative amino acid substitutions. Such conservative substitutions, explained in more detail above, generally preserve the charge and hydrophobicity at the site of substitution, thus preserving the structure (and therefore function) of the polypeptide. The phrases “percent similarity” and “% similarity”, as applied to polypeptide sequences, refer to the percentage of residue matches, including identical residue matches and conservative substitutions, between at least two polypeptide sequences aligned using a standardized algorithm. In contrast, conservative substitutions are not included in the calculation of percent identity between polypeptide sequences.

Percent identity between polypeptide sequences may be determined using the default parameters of the CLUSTAL V algorithm as incorporated into the MEGALIGN version 3.12e sequence alignment program (described and referenced above). For pairwise alignments of polypeptide sequences using CLUSTAL V, the default parameters are set as follows: Ktuple=1, gap penalty=3, window=5, and “diagonals saved”=5. The PAM250 matrix is selected as the default residue weight table.

Alternatively the NCBI BLAST software suite may be used. For example, for a pairwise comparison of two polypeptide sequences, one may use the “BLAST 2 Sequences” tool Version 2.0.12 (Apr. 21, 2000) with blastp set at default parameters. Such default parameters may be, for example: Matrix: BLOSUM62; Open Gap: 11 and Extension Gap: 1 penalties; Gap×drop-off: 50; Expect: 10; Word Size: 3; Filter: on.

Percent identity may be measured over the length of an entire defined polypeptide sequence, for example, as defined by a particular SEQ ID number, or may be measured over a shorter length, for example, over the length of a fragment taken from a larger, defined polypeptide sequence, for instance, a fragment of at least 15, at least 20, at least 30, at least 40, at least 50, at least 70 or at least 150 contiguous residues. Such lengths are exemplary only, and it is understood that any fragment length supported by the sequences shown herein, in the tables, figures or sequence listing, may be used to describe a length over which percentage identity may be measured.

The term “agent” encompasses any chemical, biochemical, or biological molecule; such as small molecules, proteins, polypeptides, antibodies, nucleic acid molecules including DNA or RNA, and the like.

Methods and Compositions Related to the Inventive hEbola

The present invention is based upon the isolation and identification of a new human Ebola virus species, EboBun and the sequencing of the only other known West African Ebola species EboIC. EboBun was isolated from the patients suffering from hemorrhagic fever in a recent outbreak in Uganda. The isolated virus is a member of the Filoviridae family, a family of negative sense RNA viruses. Accordingly, the invention relates to the isolated EboBun or EBOIC virus that morphologically and phylogenetically relates to known members filoviridae.

In another aspect, the invention provides an isolated hEbola virus including a nucleic acid molecule with a nucleotide sequence that is preferably: a) a nucleotide sequence set forth in SEQ ID NO: 1; b) a nucleotide sequence that hybridizes to the sequence set forth in SEQ ID NO: 1 under stringent conditions; or c) a nucleotide sequence that has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to the SEQ ID NO: 1. In one embodiment of the present invention, the hEbola virus is killed. In another, the virus is attenuated. In another, the infectivity of the attenuated hEbola virus is reduced. In another, the infectivity is reduced by at least 5-fold, 10-fold, 25-fold, 50-fold, 100-fold, 250-fold, 500-fold, or 10,000-fold. In another, the replication ability of the attenuated hEbola virus is reduced. In another, the replication ability of the attenuated virus is educed by at least 5-fold, 10-fold, 25-fold, 50-fold, 100-fold, 250-fold, 500-fold, 1,000-fold, or 10,000-fold. In another, the protein synthesis ability of the attenuated virus is reduced. In another, the protein synthesis ability is reduced by at least 5-fold, 10-fold, 25-fold, 50-fold, 100-fold, 250-fold, 500-fold, 1,000-fold, or 10,000-fold. In another, the assembling ability of the attenuated hEbola virus is reduced. In another, the assembling ability of the attenuated virus is reduced by at least 5-fold, 10-fold, 25-fold, 50-fold, 100-fold, 250-fold, 500-fold, 1,000-fold, or 10,000-fold. In another, the cytopathic effect of the attenuated hEbola virus is reduced. In another, the cytopathic effect is reduced by at least 5-fold, 10-fold, 25-fold, 50-fold, 100-fold, 250-fold, 500-fold, 1,000-fold, or 10,000-fold.

In another aspect, the invention provides the complete genomic sequence of the hEbola virus EboBun or EboIC. In a specific embodiment, the virus includes a nucleotide sequence of SEQ ID NOs: 1 or 10, respectively.

In a related aspect, the invention provides nucleic acid molecules isolated from EboBun, EboIC, or fragments thereof. In one embodiment of the present invention, the isolated nucleic acid molecule includes the nucleotide sequence of SEQ ID NOs: 1 or 10, or a complement thereof. In another, the nucleic acid molecule includes a nucleotide sequence having at least 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 4600, 4700, 4800, or 4900 contiguous nucleotides of the nucleotide sequence of SEQ ID NO: 1, or a complement thereof; with the proviso that the nucleotide sequence is not comprised by the nucleotide sequence set forth in SEQ ID NO: 20 (Ebola Zaire nucleotide sequence); or at least 5000, 5500, 5600, 5700, 5800, 5900, 6000, 6100, 6200, 6300, 6400, 6500, or 6600 contiguous nucleotides of the nucleotide sequence of SEQ ID NOs: 1 or 10, or a complement thereof. In another embodiment, the isolated nucleic acid molecule includes a nucleotide sequence that encodes the EboBun amino acid sequence of SEQ ID NOs: 2-9 or 59, the EboIC amino acid sequence of SEQ ID NOs: 11-19, or a complement of the nucleotide sequence that encodes the EboBun amino acid sequences of SEQ ID NOs: 2-9 or 59 or the EboIC amino acid sequences of SEQ ID NOs: 11-19. In another, the isolated nucleic acid molecule hybridizes under stringent conditions to a nucleic acid molecule having the nucleotide sequence of SEQ ID NOs: 1 or 10 or a complement thereof, wherein the nucleic acid molecule encodes an amino acid sequence which has a biological activity exhibited by a polypeptide encoded by the nucleotide sequence of SEQ ID NOs: 1 or 10. In another, nucleic acid molecule is RNA. In another, nucleic acid molecule is DNA.

In another aspect, the invention provides proteins or polypeptides that are isolated from the EboBun, including viral proteins isolated from cells infected with the virus but not present in comparable uninfected cells. In one embodiment of the present invention, the amino acid sequences of the proteins or polypeptides are set forth in SEQ ID NOs: 2-9, 59, or 11-19, or fragments thereof. In one embodiment, polypeptides or proteins of the present invention have a biological activity of the protein (including antigenicity and/or immunogenicity) encoded by the sequence of SEQ ID NOs: 1 or 10. In another, the polypeptides or the proteins of the present invention have a biological activity of at least one protein having the amino acid sequence (including antigenicity and/or immunogenicity) set forth in SEQ ID NOS: 2-9, 59, or 11-19, or a fragment thereof.

In a related aspect, the invention provides an isolated polypeptide encoded by the nucleic acid molecule of the invention described above. In one embodiment of the present invention, the isolated polypeptide includes the amino acid sequence selected from the group consisting of: a) an amino acid sequence set forth in SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, or 9; 11, 12, 13, 14, 15, 16, 17, 18 or 19; and b) an amino acid sequence that has 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology to the amino acid sequence according to a). In another, the isolated polypeptide comprises the amino acid sequence having at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 210, 220, 230, 240 or 250 contiguous amino acid residues of the amino acid sequence of SEQ ID NOs: 5 or 18 (VP24); 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 210, 220, 230, 240, 250, 260, 270, 280 contiguous amino acid residues of the amino acid sequence of SEQ ID NOs: 6 or 17 (VP30); 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 310, or 320 contiguous amino acid residues of the amino acid sequence of SEQ ID NOs: 8 or 13 (VP40); 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 310, 320, 330, or 340 contiguous amino acid residues of the amino acid sequence of SEQ ID NOs: 7 or 12 (VP35); 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 310, 320, 330, 340, 350, 360, or 370 contiguous amino acid residues of the amino acid sequence of SEQ ID NOs: 4 or 15 (SGP); 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 310, 320, 330, 340, 350, 360, or 370 contiguous amino acid residues of the amino acid sequence of SEQ ID NOs: 59 or 16 (SSGP); 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 450, 500, 550, 600, 610, 620, 630, 640, 650, 660, or 670 contiguous amino acid residues of the amino acid sequence of SEQ ID NOs: 9 or 14 (GP); 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 450, 500, 550, 600, 650, 700, 710, 720, or 730 contiguous amino acid residues of the amino acid sequence of SEQ ID NOs: 3 or 11 (NP); or 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1450, 1500, 1550, 1600, 1650, 1700, 1750, 1800, 1850, 1900, 1950, 2000, 2050, 2100, 2150, 2160, 2170, 2180, 2190, or 2200 contiguous amino acid residues of the amino acid sequence of SEQ ID NOs: 2 or 19 (L).

In other aspects, the invention relates to the use of an isolated West African hEbola virus for diagnostic and therapeutic methods. In one embodiment, the invention provides a method of detecting in a biological sample an antibody immunospecific for the hEbola virus using the inventive isolated hEbola virus described herein, or any of the inventive proteins or polypeptides as described herein. In another specific embodiment, the invention provides a method of screening for an antibody which immunospecifically binds and neutralizes hEbola EboBun or EboIC or a combination thereof. Such an antibody is useful for a passive immunization or immunotherapy of a subject infected with hEbola.

In another aspect, the invention provides an isolated antibody or an antigen-binding fragment thereof which immunospecifically binds to a West African genus hEbola virus of the invention described above, and illustratively including EboBun or EboIC. In one embodiment of the present invention, the isolated antibody or an antigen-binding fragment thereof neutralizes a West African genus hEbola virus. In another, the isolated antibody or an antigen-binding fragment thereof immunospecifically binds to the inventive polypeptide described above. The invention further provides antibodies that specifically bind a polypeptide of the invention encoded by the nucleotide sequence of SEQ ID NOs: 1 (EboBun) or 10 (EboIC), a fragment thereof, or encoded by a nucleic acid comprising a nucleotide sequence that hybridizes under stringent conditions to the nucleotide sequence of SEQ ID NOs: 1 (EboBun) or 10 (EboIC) and/or any hEbola EboBun epitope, having one or more biological activities of a polypeptide of the invention. These polypeptides include those shown in SEQ ID NOs: 2-9, 59, and 11-19. Such antibodies include, but are not limited to, polyclonal, monoclonal, bi-specific, multi-specific, human, humanized, chimeric antibodies, single chain antibodies, Fab fragments, F(ab′)2 fragments, disulfide-linked Fvs, intrabodies and fragments containing either a VL or VH domain or even a complementary determining region (CDR) that specifically binds to a polypeptide of the invention.

In other aspects, the invention provides methods for detecting the presence, activity or expression of the hEbola virus of the invention in a biological material, such as cells, blood, saliva, urine, and so forth. The increased or decreased activity or expression of the hEbola virus in a sample relative to a control sample can be determined by contacting the biological material with an agent which can detect directly or indirectly the presence, activity or expression of the hEbola virus. In one embodiment of the present invention, the detecting agents are the antibodies or nucleic acid molecules of the present invention. Antibodies of the invention can also be used to treat hemorrhagic fever.

In a related aspect, the invention provides a method for detecting the presence of the inventive hEbola virus described above in a biological sample, the method comprising: (a) contacting the sample with an agent that selectively binds to the hEbola virus; and (b) detecting whether the compound binds to the hEbola virus in the sample. In one embodiment of the present invention, the biological sample is selected from the group consisting of cells; blood; serum; plasma; feces; rectal, vaginal and conjunctival swabs. In another, the agent that binds to the virus is an antibody. In another, the agent that binds to the virus is a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 1 or a complement thereof. In another, the agent that binds to the virus is a nucleic acid molecule comprising a nucleotide sequence having at least 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 4600, 4700, 4800, 4900, 5000, 5500, 5600, 5700, 5800, 5900, 6000, 6100, 6200, 6300, 6400, 6500, or 6600 contiguous nucleotides of the nucleotide sequence of SEQ ID NOs: 1 or 10, or a complement thereof.

In another aspect, the invention provides a method for detecting the presence of the inventive polypeptide described above, in a biological sample, the method comprising: (a) contacting the biological sample with an agent that selectively binds to the polypeptide; and (b) detecting whether the agent binds to the polypeptide in the sample. In one embodiment of the present invention, the biological sample is selected from the group consisting of cells; blood; serum; plasma; feces; rectal, vaginal and conjunctival swabs. In another, the agent that binds to the polypeptide is an antibody or an antigen-binding fragment thereof.

In another aspect, the invention provides a method for detecting the presence of a first nucleic acid molecule derived from the inventive hEbola virus described above in a biological sample, the method includes (a) contacting the biological sample with an agent that selectively binds to the nucleic acid; and (b) detecting whether the agent binds to the nucleotide in the sample. In one embodiment of the present invention, the agent that binds to the first nucleic acid molecule is a second nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 1 or a complement thereof. In another, the second nucleic acid molecule comprises at least 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 4600, 4700, 4800, 4900, 5000, 5500, 5600, 5700, 5800, 5900, 6000, 6100, 6200, 6300, 6400, 6500, or 6600 contiguous nucleotides of the nucleotide sequence of SEQ ID NOs: 1 or 10, or a complement thereof.

In another aspect, the invention provides a method for propagating the hEbola virus in host cells comprising infecting the host cells with an inventive isolated West African hEbola virus described above, culturing the host cells to allow the virus to multiply, and harvesting the resulting virions. Also provided by the present invention are host cells infected with the inventive hEbola virus described above. In one embodiment of the present invention, the host cell is a primate cell.

In another aspect, the invention provides a method of detecting in a biological sample the presence of an antibody that immunospecifically binds hEbola virus, the method includes: (a) contacting the biological sample with the inventive host cell described above; and (b) detecting the antibody bound to the cell.

In another aspect, the invention provides vaccine preparations, including the inventive hEbola virus, including recombinant and chimeric forms of the virus, nucleic acid molecules comprised by the virus, or protein subunits of the virus. In one embodiment, the vaccine preparations of the present invention includes live but attenuated hEbola virus with or without pharmaceutically acceptable carriers, including adjuvants. In another, the vaccine preparations of the invention comprise an inactivated or killed hEbola EboBun virus, EboIC virus, or a combination thereof, with or without pharmaceutically acceptable carriers, including adjuvants. Such attenuated or inactivated viruses may be prepared by a series of passages of the virus through the host cells or by preparing recombinant or chimeric forms of virus. Accordingly, the present invention further provides methods of preparing recombinant or chimeric forms of the inventive hEbola viruses described herein.

In another specific embodiment, the invention provides a vaccine formulation comprising a therapeutically or prophylactically effective amount of the inventive hEbola virus described above, and a pharmaceutically acceptable carrier. In another, the invention provides a vaccine formulation comprising a therapeutically or prophylactically effective amount of a protein extract of the inventive hEbola virus described above, or a subunit thereof; and a pharmaceutically acceptable carrier. In another aspect, the invention provides a vaccine formulation comprising a therapeutically or prophylactically effective amount of a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NOs: 1 or 10, or a complement thereof, and a pharmaceutically acceptable carrier. In another, the invention provides a vaccine formulation comprising a therapeutically or prophylactically effective amount of a nucleic acid molecule comprising any of inventive the nucleotide sequences as described above, or a complement thereof, and a pharmaceutically acceptable carrier. In another aspect, the invention provides a vaccine formulation comprising a therapeutically or prophylactically effective amount of a protein extract of the inventive hEbola virus described above, or a subunit thereof; and a pharmaceutically acceptable carrier. In another aspect, the invention provides a vaccine formulation comprising a therapeutically or prophylactically effective amount of a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NOs: 1 or 10, or a complement thereof, and a pharmaceutically acceptable carrier. In another, the invention provides a vaccine formulation comprising a therapeutically or prophylactically effective amount of a nucleic acid molecule comprising any of inventive the nucleotide sequences as described above, or a complement thereof, and a pharmaceutically acceptable carrier.

In yet another specific embodiment, the vaccine preparations of the present invention comprise a nucleic acid or fragment of the hEbola virus, e.g., the virus having Accession No. 200706291, or nucleic acid molecules having the sequence of SEQ ID NOs: 1 or 10, or a fragment thereof. In another, the vaccine preparations comprise a polypeptide of the invention encoded by the nucleotide sequence of SEQ ID NOs: 1 or 10 or a fragment thereof. In a specific embodiment, the vaccine preparations comprise polypeptides of the invention as shown in SEQ ID NOs: 2-9, 59, or 11-19, or encoded by the nucleotide sequence of SEQ ID NOs: 1 or 10, or a fragment thereof.

Furthermore, the present invention provides methods for treating, ameliorating, managing or preventing hemorrhagic fever by administering the vaccine preparations or antibodies of the present invention alone or in combination with adjuvants, or other pharmaceutically acceptable excipients. Furthermore, the present invention provides methods for treating, ameliorating, managing, or preventing hemorrhagic fever by administering the inventive compositions and formulations including the vaccine preparations or antibodies of the present invention alone or in combination with antivirals [e.g., amantadine, rimantadine, gancyclovir, acyclovir, ribavirin, penciclovir, oseltamivir, foscamet zidovudine (AZT), didanosine (ddI), lamivudine (3TC), zalcitabine (ddC), stavudine (d4T), nevirapine, delavirdine, indinavir, ritonavir, vidarabine, nelfinavir, saquinavir, relenza, tamiflu, pleconaril, interferons, etc.], steroids and corticosteroids such as prednisone, cortisone, fluticasone and glucocorticoid, antibiotics, analgesics, bronchodilators, or other treatments for respiratory and/or viral infections.

In a related aspect, the invention provides an immunogenic formulation comprising an immunogenically effective amount of the inventive hEbola virus described above, and a pharmaceutically acceptable carrier.

In another related aspect, the invention provides an immunogenic formulation comprising an immunogenically effective amount of a protein extract of the inventive hEbola virus described above or a subunit thereof, and a pharmaceutically acceptable carrier.

In another related aspect, the invention provides an immunogenic formulation comprising an immunogenically effective amount of a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NOs: 1, 10, a combination thereof, or a complement thereof, and a pharmaceutically acceptable carrier.

In another related aspect, the invention provides an immunogenic formulation comprising an immunogenically effective amount of a nucleic acid molecule comprising the inventive nucleotide sequence as described above or a complement thereof, and a pharmaceutically acceptable carrier.

In another related aspect, the invention provides an immunogenic formulation comprising an immunogenically effective amount of any of the inventive polypeptides described above.

In another aspect, the present invention provides pharmaceutical compositions comprising antiviral agents of the present invention and a pharmaceutically acceptable carrier. In a specific embodiment, the antiviral agent of the invention is an antibody that immunospecifically binds hEbola virus or any hEbola epitope. In another specific embodiment, the antiviral agent is a polypeptide or protein of the present invention or nucleic acid molecule of the invention.

In a related aspect, the invention provides a pharmaceutical composition comprising a prophylactically or therapeutically effective amount of an anti-hEbola EboBun agent and a pharmaceutically acceptable carrier. In one embodiment of the present invention, the anti-hEbola EboBun agent is an antibody or an antigen-binding fragment thereof which immunospecifically binds to the hEbola virus of Deposit Accession No. 200706291, or polypeptides or protein derived therefrom. In another, the anti-hEbola agent is a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NOs: 1, 10, a combination thereof, or a fragment thereof. In another, the anti-hEbola agent is a polypeptide encoded by a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NOs: 1, 10, a combination thereof, or a fragment thereof having a biological activity of the polypeptide.

The invention also provides kits containing compositions and formulations of the present invention. Thus, in another aspect, the invention provides a kit comprising a container containing the inventive immunogenic formulation described above.

In another aspect, the invention provides a kit includes a container containing the inventive vaccine formulation described above.

In another aspect, the invention provides a kit including a container containing the inventive pharmaceutical composition described above.

In another aspect, the invention provides a kit including a container containing the inventive vaccine formulation described above.

In another aspect, the invention provides a method for identifying a subject infected with the inventive hEbola virus described above, including: (a) obtaining total RNA from a biological sample obtained from the subject; (b) reverse transcribing the total RNA to obtain cDNA; and (c) amplifying the cDNA using a set of primers derived from a nucleotide sequence of the inventive hEbola virus described above.

In one embodiment of the present invention, the set of primers are derived from the nucleotide sequence of the genome of the hEbola virus of Deposit Accession No. 200706291. In another, the set of primers are derived from the nucleotide sequence of SEQ ID NOs: 1 or 10 or any of the inventive nucleotide sequences as described above, or a complement thereof.

The invention further relates to the use of the sequence information of the isolated virus for diagnostic and therapeutic methods. In a specific embodiment, the invention provides nucleic acid molecules which are suitable for use as primers consisting of or including the nucleotide sequence of SEQ ID NOs: 1 or 10, or a complement thereof, or at least a portion of the nucleotide sequence thereof. In another specific embodiment, the invention provides nucleic acid molecules which are suitable for hybridization to the inventive hEbola nucleic acid; including, but not limited to PCR primers, Reverse Transcriptase primers, probes for Southern analysis or other nucleic acid hybridization analysis for the detection of hEbola nucleic acids, e.g., consisting of or including the nucleotide sequence of SEQ ID NOs: 1, 10 a combination thereof, a complement thereof, or a portion thereof. The invention further encompasses chimeric or recombinant viruses encoded in whole or in part by the nucleotide sequences.

In another aspect, the present invention provides methods for screening antiviral agents that inhibit the infectivity or replication of hEbola virus or variants thereof.

The invention further provides methods of preparing recombinant or chimeric forms of hEbola.

In another aspect, the invention provides vaccine preparations including the hEbola virus, including recombinant and chimeric forms of the virus, or subunits of the virus. The present invention encompasses recombinant or chimeric viruses encoded by viral vectors derived from the genome of the inventive hEbola virus described herein or natural variants thereof. In a specific embodiment, a recombinant virus is one derived from the hEbola virus of Deposit Accession No. 200706291. It is recognized that natural variants of the inventive hEbola viruses described herein comprise one or more mutations, including, but not limited to, point mutations, rearrangements, insertions, deletions etc., to the genomic sequence. It is recognized that the mutations may or may not result in a phenotypic change.

In another specific embodiment, a chimeric virus of the invention is a recombinant hEbola EboBun or EboIC virus which further comprises a heterologous nucleotide sequence. In accordance with the invention, a chimeric virus may be encoded by a nucleotide sequence in which heterologous nucleotide sequences have been added to the genome or in which endogenous or native nucleotide sequences have been replaced with heterologous nucleotide sequences.

According to the present invention, the chimeric viruses are encoded by the viral vectors of the invention which further comprise a heterologous nucleotide sequence. In accordance with the present invention a chimeric virus is encoded by a viral vector that may or may not include nucleic acids that are non-native to the viral genome. In accordance with the invention a chimeric virus is encoded by a viral vector to which heterologous nucleotide sequences have been added, inserted or substituted for native or non-native sequences. In accordance with the present invention, the chimeric virus may be encoded by nucleotide sequences derived from different species or variants of hEbola virus. In particular, the chimeric virus is encoded by nucleotide sequences that encode antigenic polypeptides derived from different species or variants of hEbola virus.

A chimeric virus may be of particular use for the generation of recombinant vaccines protecting against two or more viruses (Tao et al., J. Virol. 72, 2955-2961; Durbin et al., 2000, J. Virol. 74, 6821-6831; Skiadopoulos et al., 1998, J. Virol. 72, 1762-1768 (1998); Teng et al., 2000, J. Virol. 74, 9317-9321). For example, it can be envisaged that a virus vector derived from the hEbola virus expressing one or more proteins of variants of hEbola virus including hEbola EboBun, or vice versa, will protect a subject vaccinated with such vector against infections by both the native hEbola and the variant. Attenuated and replication-defective viruses may be of use for vaccination purposes with live vaccines as has been suggested for other viruses. (See, for example, PCT WO 02/057302, at pp. 6 and 23; and United States Patent Application Publication 2008/0069838 incorporated by reference herein).

In accordance with the present invention the heterologous sequence to be incorporated into the viral vectors encoding the recombinant or chimeric viruses of the invention include sequences obtained or derived from different species or variants of hEbola.

In certain embodiments, the chimeric or recombinant viruses of the invention are encoded by viral vectors derived from viral genomes wherein one or more sequences, intergenic regions, termini sequences, or portions or entire ORF have been substituted with a heterologous or non-native sequence. In certain embodiments of the invention, the chimeric viruses of the invention are encoded by viral vectors derived from viral genomes wherein one or more heterologous sequences have been inserted or added to the vector.

The selection of the viral vector may depend on the species of the subject that is to be treated or protected from a viral infection. If the subject is human, then an attenuated hEbola virus can be used to provide the antigenic sequences.

In accordance with the present invention, the viral vectors can be engineered to provide antigenic sequences which confer protection against infection by the inventive hEbola and natural variants thereof. The viral vectors may be engineered to provide one, two, three or more antigenic sequences. In accordance with the present invention the antigenic sequences may be derived from the same virus, from different species or variants of the same type of virus, or from different viruses.

The expression products and/or recombinant or chimeric virions obtained in accordance with the invention may advantageously be utilized in vaccine formulations. The expression products and chimeric virions of the present invention may be engineered to create vaccines against a broad range of pathogens, including viral and bacterial antigens, tumor antigens, allergen antigens, and auto antigens involved in autoimmune disorders. One way to achieve this goal involves modifying existing hEbola genes to contain foreign sequences in their respective external domains. Where the heterologous sequences are epitopes or antigens of pathogens, these chimeric viruses may be used to induce a protective immune response against the disease agent from which these determinants are derived. In particular, the chimeric virions of the present invention may be engineered to create vaccines for the protection of a subject from infections with hEbola virus and variants thereof.

Thus, the present invention further relates to the use of viral vectors and recombinant or chimeric viruses to formulate vaccines against a broad range of viruses and/or antigens. The present invention also encompasses recombinant viruses including a viral vector derived from the hEbola or variants thereof which contains sequences which result in a virus having a phenotype more suitable for use in vaccine formulations, e.g., attenuated phenotype or enhanced antigenicity. The mutations and modifications can be in coding regions, in intergenic regions and in the leader and trailer sequences of the virus.

The invention provides a host cell including a nucleic acid or a vector according to the invention. Plasmid or viral vectors containing the polymerase components of hEbola virus are generated in prokaryotic cells for the expression of the components in relevant cell types (bacteria, insect cells, eukaryotic cells). Plasmid or viral vectors containing full-length or partial copies of the hEbola genome will be generated in prokaryotic cells for the expression of viral nucleic acids in vitro or in vivo. The latter vectors optionally contain other viral sequences for the generation of chimeric viruses or chimeric virus proteins, optionally lack parts of the viral genome for the generation of replication defective virus, and optionally contain mutations, deletions or insertions for the generation of attenuated viruses. In addition, the present invention provides a host cell infected with hEbola virus of Deposit Accession No. 200706291,

Infectious copies of West African hEbola (being wild type, attenuated, replication-defective or chimeric) are optionally produced upon co-expression of the polymerase components according to the state-of-the-art technologies described above.

In addition, eukaryotic cells, transiently or stably expressing one or more full-length or partial hEbola proteins are optionally used. Such cells are preferably made by transfection (proteins or nucleic acid vectors), infection (viral vectors) or transduction (viral vectors) and are useful for complementation of mentioned wild type, attenuated, replication-defective or chimeric viruses.

The viral vectors and chimeric viruses of the present invention optionally modulate a subject’s immune system by stimulating a humoral immune response, a cellular immune response or by stimulating tolerance to an antigen. As used herein, a subject means: humans, primates, horses, cows, sheep, pigs, goats, dogs, cats, avian species and rodents.

Formulation of Vaccines and Antivirals

In a preferred embodiment, the invention provides a proteinaceous molecule or hEbola virus specific viral protein or functional fragment thereof encoded by a nucleic acid according to the invention. Useful proteinaceous molecules are for example derived from any of the genes or genomic fragments derivable from the virus according to the invention, preferably the GP, L, NP, sGP, VP24, VP30, VP35, and VP 40 proteins described herein. Such molecules, or antigenic fragments thereof, as provided herein, are for example useful in diagnostic methods or kits and in pharmaceutical compositions such as subunit vaccines. Particularly useful are polypeptides encoded by the nucleotide sequence of SEQ ID NOs: 1 or 10; or antigenic fragments thereof for inclusion as antigen or subunit immunogen, but inactivated whole virus can also be used. Particularly useful are also those proteinaceous substances that are encoded by recombinant nucleic acid fragments of the hEbola genome, of course preferred are those that are within the preferred bounds and metes of ORFs, in particular, for eliciting hEbola specific antibody or T cell responses, whether in vivo (e.g. for protective or therapeutic purposes or for providing diagnostic antibodies) or in vitro (e.g. by phage display technology or another technique useful for generating synthetic antibodies).

It is recognized that numerous variants, analogues, or homologues of EboBun polypeptides are within the scope of the present invention including amino acid substitutions, alterations, modifications, or other amino acid changes that increase, decrease, or do not alter the function or immunogenic propensity of the inventive immunogen or vaccine. Several post-translational modifications are similarly envisioned as within the scope of the present invention illustratively including incorporation of a non-naturally occurring amino acid(s), phosphorylation, glycosylation, sulfation, and addition of pendent groups such as biotynlation, fluorophores, lumiphores, radioactive groups, antigens, or other molecules.

Methods of expressing and purifying natural or recombinant peptides and proteins are well known in the art. Illustratively, peptides and proteins are recombinantly expressed in eukaryotic cells. Exemplary eukaryotic cells include yeast, HeLa cells, 293 cells, COS cells, Chinese hamster ovary cells (CHO), and many other cell types known in the art. Both eukaryotic and prokaryotic expression systems and cells are available illustratively from Invitrogen Corp., Carlsbad, Calif. It is appreciated that cell-free expression systems are similarly operable.

In a preferred embodiment an immunogenic polypeptide is a full length EboBun protein. Preferably, an immunogen is a full length EboBun protein of SEQ ID NOs: 2-9 or 59, or EboIC SEQ ID NOs: 11-19, or a fragment thereof as described herein. Preferably, an immunogen is has a minimum of 5 amino acids. As used herein an immunogen is preferably a polypeptide. In the context of an immunogenic polypeptide the terms immunogen, polypeptide, and antigen are used interchangeably.

Modifications and changes can be made in the structure of the inventive immunogens that are the subject of the application and still obtain a molecule having similar or improved characteristics as the wild-type sequence (e.g., a conservative amino acid substitution). For example, certain amino acids are optionally substituted for other amino acids in a sequence without appreciable loss of immunogenic activity. Because it is the interactive capacity and nature of a polypeptide that defines that polypeptide’s biological functional activity, certain amino acid sequence substitutions can be made in a polypeptide sequence and nevertheless obtain a polypeptide with like or improved properties. Optionally, a polypeptide is used that has less or more immunogenic activity compared to the wild-type sequence.

In making such changes, the hydropathic index of amino acids is preferably considered. The importance of the hydropathic amino acid index in conferring interactive biologic function on a polypeptide is generally understood in the art. It is known that certain amino acids can be substituted for other amino acids having a similar hydropathic index or score and still result in a polypeptide with similar biological activity. Each amino acid has been assigned a hydropathic index on the basis of its hydrophobicity and charge characteristics. Those indices are: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine/cysteine (+2.5); methionine (+1.9); alanine (+1.8); glycine (−0.4); threonine (−0.7); serine (−0.8); tryptophan (−0.9); tyrosine (−1.3); proline (−1.6); histidine (−3.2); glutamate (−3.5); glutamine (−3.5); aspartate (−3.5); asparagine (−3.5); lysine (−3.9); and arginine (−4.5).

It is believed that the relative hydropathic character of the amino acid determines the secondary structure of the resultant polypeptide, which in turn defines the interaction of the polypeptide with other molecules, such as enzymes, substrates, receptors, antibodies, antigens, and the like. It is known in the art that an amino acid can be substituted by another amino acid having a similar hydropathic index and still obtain a functionally equivalent immunogen. In such changes, the substitution of amino acids whose hydropathic indices are within ±2 is preferred, those within ±1 are particularly preferred, and those within ±0.5 are even more particularly preferred.

As outlined above, amino acid substitutions are generally based on the relative similarity of the amino acid side-chain substituents, for example, their hydrophobicity, hydrophilicity, charge, size, and the like. Exemplary substitutions that take various of the foregoing characteristics into consideration are well known to those of skill in the art and include (original residue: exemplary substitution): (Ala: Gly, Ser), (Arg: Lys), (Asn: Gln, His), (Asp: Glu, Cys, Ser), (Gln: Asn), (Glu: Asp), (Gly: Ala), (His: Asn, Gln), (Ile: Leu, Val), (Leu: Ile, Val), (Lys: Arg), (Met: Leu, Tyr), (Ser: Thr), (Thr: Ser), (Tip: Tyr), (Tyr: Trp, Phe), and (Val: Ile, Leu). Embodiments of this disclosure thus contemplate functional or biological equivalents of a polypeptide and immunogen as set forth above. In particular, embodiments of the polypeptides and immunogens optionally include variants having about 50%, 60%, 70%, 80%, 90%, and 95% sequence identity to the polypeptide of interest.

The invention provides vaccine formulations for the prevention and treatment of infections with hEbola virus. In certain embodiments, the vaccine of the invention comprises recombinant and chimeric viruses of the hEbola virus. In certain embodiments, the virus is attenuated.

In another embodiment of this aspect of the invention, inactivated vaccine formulations are prepared using conventional techniques to “kill” the chimeric viruses. Inactivated vaccines are “dead” in the sense that their infectivity has been destroyed. Ideally, the infectivity of the virus is destroyed without affecting its immunogenicity. In order to prepare inactivated vaccines, the chimeric virus may be grown in cell culture or in the allantois of the chick embryo, purified by zonal ultracentrifugation, inactivated by formaldehyde or β-propiolactone, and pooled. The resulting vaccine is usually inoculated intramuscularly or intranasally.

Inactivated viruses are optionally formulated with a suitable adjuvant in order to enhance the immunological response. Such adjuvants illustratively include but are not limited to mineral gels, e.g., aluminum hydroxide; surface active substances such as lysolecithin, pluronic polyols, polyanions; peptides; oil emulsions; and potentially useful human adjuvants such as BCG and Corynebacterium parvum.

In another aspect, the present invention also provides DNA vaccine formulations including a nucleic acid or fragment of the inventive hEbola virus, e.g., the virus having Accession No. 200706291, or nucleic acid molecules having the sequence of SEQ ID NOs: 1 or 10, or a fragment thereof. In another specific embodiment, the DNA vaccine formulations of the present invention comprise a nucleic acid or fragment thereof encoding the antibodies which immunospecifically bind hEbola viruses. In DNA vaccine formulations, a vaccine DNA comprises a viral vector, such as that derived from the hEbola virus, bacterial plasmid, or other expression vector, bearing an insert including a nucleic acid molecule of the present invention operably linked to one or more control elements, thereby allowing expression of the vaccinating proteins encoded by the nucleic acid molecule in a vaccinated subject. Such vectors can be prepared by recombinant DNA technology as recombinant or chimeric viral vectors carrying a nucleic acid molecule of the present invention.

A nucleic acid as used herein refers to single- or double-stranded molecules which are optionally DNA, including the nucleotide bases A, T, C and G, or RNA, including the bases A, U (substitutes for T), C, and G. The nucleic acid may represent a coding strand or its complement. Nucleic acids are optionally identical in sequence to the sequence which is naturally occurring or include alternative codons which encode the same amino acid as that which is found in the naturally occurring sequence. Furthermore, nucleic acids optionally include codons which represent conservative substitutions of amino acids as are well known in the art.

As used herein, the term “isolated nucleic acid” means a nucleic acid separated or substantially free from at least some of the other components of the naturally occurring organism, for example, the cell structural components commonly found associated with nucleic acids in a cellular environment and/or other nucleic acids. The isolation of nucleic acids is illustratively accomplished by techniques such as cell lysis followed by phenol plus chloroform extraction, followed by ethanol precipitation of the nucleic acids. The nucleic acids of this invention are illustratively isolated from cells according to methods well known in the art for isolating nucleic acids. Alternatively, the nucleic acids of the present invention are optionally synthesized according to standard protocols well described in the literature for synthesizing nucleic acids. Modifications to the nucleic acids of the invention are also contemplated, provided that the essential structure and function of the peptide or polypeptide encoded by the nucleic acid are maintained.

The nucleic acid encoding the peptide or polypeptide of this invention is optionally part of a recombinant nucleic acid construct comprising any combination of restriction sites and/or functional elements as are well known in the art which facilitate molecular cloning and other recombinant DNA manipulations. Thus, the present invention further provides a recombinant nucleic acid construct including a nucleic acid encoding a polypeptide of this invention.

Generally, it may be more convenient to employ as the recombinant polynucleotide a cDNA version of the polynucleotide. It is believed that the use of a cDNA version will provide advantages in that the size of the gene will generally be much smaller and more readily employed to transfect the targeted cell than will a genomic gene, which will typically be up to an order of magnitude larger than the cDNA gene. However, the inventor does not exclude the possibility of employing a genomic version of a particular gene where desired.

As used herein, the terms “engineered” and “recombinant” cells are synonymous with “host” cells and are intended to refer to a cell into which an exogenous DNA segment or gene, such as a cDNA or gene has been introduced. Therefore, engineered cells are distinguishable from naturally occurring cells which do not contain a recombinantly introduced exogenous DNA segment or gene. A host cell is optionally a naturally occurring cell that is transformed with an exogenous DNA segment or gene or a cell that is not modified. A host cell preferably does not possess a naturally occurring gene encoding RSV G protein. Engineered cells are, thus, cells having a gene or genes introduced through the hand of man. Recombinant cells illustratively include those having an introduced cDNA or genomic DNA, and also include genes positioned adjacent to a promoter not naturally associated with the particular introduced gene.

To express a recombinant encoded polypeptide in accordance with the present invention one optionally prepares an expression vector that comprises a polynucleotide under the control of one or more promoters. To bring a coding sequence “under the control of” a promoter, one positions the 5′ end of the translational initiation site of the reading frame generally between about 1 and 50 nucleotides “downstream” of (i.e., 3′ of) the chosen promoter. The “upstream” promoter stimulates transcription of the inserted DNA and promotes expression of the encoded recombinant protein. This is the meaning of “recombinant expression” in the context used here.

Many standard techniques are available to construct expression vectors containing the appropriate nucleic acids and transcriptional/translational control sequences in order to achieve protein or peptide expression in a variety of host-expression systems. Cell types available for expression include, but are not limited to, bacteria, such as E. coli and B. subtilis transformed with recombinant phage DNA, plasmid DNA or cosmid DNA expression vectors.

Certain examples of prokaryotic hosts illustratively include E. coli strain RR1, E. coli LE392, E. coli B, E. coli 1776 (ATCC No. 31537) as well as E. coli W3110 (F-, lambda-, prototrophic, ATCC No. 273325); bacilli such as Bacillus subtilis; and other enterobacteria such as Salmonella typhimurium, Serratia marcescens, and various Pseudomonas species.

In general, plasmid vectors containing replicon and control sequences that are derived from species compatible with the host cell are used in connection with these hosts. The vector ordinarily carries a replication site, as well as marking sequences that are capable of providing phenotypic selection in transformed cells. For example, E. coli is often transformed using pBR322, a plasmid derived from an E. coli species. Plasmid pBR322 contains genes for ampicillin and tetracycline resistance and thus provides easy means for identifying transformed cells. The pBR322 plasmid, or other microbial plasmid or phage may also contain, or be modified to contain, promoters that can be used by the microbial organism for expression of its own proteins.

In addition, phage vectors containing replicon and control sequences that are compatible with the host microorganism are optionally used as transforming vectors in connection with these hosts. For example, the phage lambda is optionally utilized in making a recombinant phage vector that can be used to transform host cells, such as E. coli LE392.

Further useful vectors include pIN vectors and pGEX vectors, for use in generating glutathione S-transferase (GST) soluble fusion proteins for later purification and separation or cleavage. Other suitable fusion proteins are those with β-galactosidase, ubiquitin, or the like.

Promoters that are most commonly used in recombinant DNA construction include the β-lactamase (penicillinase), lactose and tryptophan (trp) promoter systems. While these are the most commonly used, other microbial promoters have been discovered and utilized, and details concerning their nucleotide sequences have been published, enabling those of skill in the art to ligate them functionally with plasmid vectors.

For expression in Saccharomyces, the plasmid YRp7, for example, is commonly used. This plasmid contains the trp1 gene, which provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, for example ATCC No. 44076 or PEP4-1. The presence of the trp1 lesion as a characteristic of the yeast host cell genome then provides an effective environment for detecting transformation by growth in the absence of tryptophan.

Suitable promoting sequences in yeast vectors illustratively include the promoters for 3-phosphoglycerate kinase or other glycolytic enzymes, such as enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase, and glucokinase. In constructing suitable expression plasmids, the termination sequences associated with these genes are also preferably ligated into the expression vector 3′ of the sequence desired to be expressed to provide polyadenylation of the mRNA and termination.

Other suitable promoters, which have the additional advantage of transcription controlled by growth conditions, illustratively include the promoter region for alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degradative enzymes associated with nitrogen metabolism, and the aforementioned glyceraldehyde-3-phosphate dehydrogenase, and enzymes responsible for maltose and galactose utilization.

In addition to microorganisms, cultures of cells derived from multicellular organisms are also operable as hosts. In principle, any such cell culture is operable, whether from vertebrate or invertebrate culture. In addition to mammalian cells, these include insect cell systems infected with recombinant virus expression vectors (e.g., baculovirus); and plant cell systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors (e.g., Ti plasmid) containing one or more coding sequences.

In a useful insect system, Autographica californica nuclear polyhedrosis virus (AcNPV) is used as a vector to express foreign genes. The virus grows in Spodoptera frugiperda cells. The isolated nucleic acid coding sequences are cloned into non-essential regions (for example the polyhedron gene) of the virus and placed under control of an AcNPV promoter (for example, the polyhedron promoter). Successful insertion of the coding sequences results in the inactivation of the polyhedron gene and production of non-occluded recombinant virus (i.e., virus lacking the proteinaceous coat coded for by the polyhedron gene). These recombinant viruses are then used to infect Spodoptera frugiperda cells in which the inserted gene is expressed (e.g., U.S. Pat. No. 4,215,051).

Examples of useful mammalian host cell lines include VERO and HeLa cells, Chinese hamster ovary (CHO) cell lines, W138, BHK, COS-7, 293, HepG2, NIH3T3, RIN and MDCK cell lines. In addition, a host cell is preferably chosen that modulates the expression of the inserted sequences, or modifies and processes the gene product in the specific fashion desired. Such modifications (e.g., glycosylation) and processing (e.g., cleavage) of protein products may be important for the function of the encoded protein.

Different host cells have characteristic and specific mechanisms for the post-translational processing and modification of proteins. Appropriate cell lines or host systems are preferably chosen to ensure the correct modification and processing of the foreign protein expressed. Expression vectors for use in mammalian cells ordinarily include an origin of replication (as necessary), a promoter located in front of the gene to be expressed, along with any necessary ribosome binding sites, RNA splice sites, polyadenylation site, and transcriptional terminator sequences. The origin of replication is preferably provided either by construction of the vector to include an exogenous origin, such as may be derived from SV40 or other viral (e.g., Polyoma, Adeno, VSV, BPV) source, or may be provided by the host cell chromosomal replication mechanism. If the vector is integrated into the host cell chromosome, the latter is often sufficient.

The promoters are optionally derived from the genome of mammalian cells (e.g., metallothionein promoter) or from mammalian viruses (e.g., the adenovirus late promoter; the vaccinia virus 7.5K promoter). Further, it is also possible, and may be desirable, to utilize promoter or control sequences normally associated with the desired gene sequence, provided such control sequences are compatible with the host cell systems.

A number of viral based expression systems are operable herein, for example, commonly used promoters are derived from polyoma, Adenovirus 2, Adenovirus 5, cytomegalovirus and Simian Virus 40 (SV40). The early and late promoters of SV40 virus are useful because both are obtained easily from the virus as a fragment which also contains the SV40 viral origin of replication. Smaller or larger SV40 fragments are also operable, particularly when there is included the approximately 250 bp sequence extending from the HindIII site toward the BglI site located in the viral origin of replication.

In cases where an adenovirus is used as an expression vector, the coding sequences are preferably ligated to an adenovirus transcription/translation control complex, e.g., the late promoter and tripartite leader sequence. This chimeric gene is then optionally inserted in the adenovirus genome by in vitro or in vivo recombination. Insertion in a non-essential region of the viral genome (e.g., region E1 or E3) will result in a recombinant virus that is viable and capable of expressing proteins in infected hosts.

Specific initiation signals may also be required for efficient translation of the claimed isolated nucleic acid coding sequences. These signals include the ATG initiation codon and adjacent sequences. Exogenous translational control signals, including the ATG initiation codon, may additionally need to be provided. One of ordinary skill in the art would readily be capable of determining this need and providing the necessary signals. It is well known that the initiation codon must be in-frame (or in-phase) with the reading frame of the desired coding sequence to ensure translation of the entire insert. These exogenous translational control signals and initiation codons are optionally of a variety of origins, both natural and synthetic. The efficiency of expression is optionally enhanced by the inclusion of appropriate transcription enhancer elements or transcription terminators.

In eukaryotic expression, one will also typically desire to incorporate into the transcriptional unit an appropriate polyadenylation site if one was not contained within the original cloned segment. Typically, the poly A addition site is placed about 30 to 2000 nucleotides “downstream” of the termination site of the protein at a position prior to transcription termination.

For long-term, high-yield production of recombinant proteins, stable expression is preferred. For example, cell lines that stably express constructs encoding proteins are engineered. Rather than using expression vectors that contain viral origins of replication, host cells are preferably transformed with vectors controlled by appropriate expression control elements (e.g., promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.), and a selectable marker. Following the introduction of foreign DNA, engineered cells may be allowed to grow for 1-2 days in an enriched medium, and then are switched to a selective medium. The selectable marker in the recombinant plasmid confers resistance to the selection and allows cells to stably integrate the plasmid into their chromosomes and grow to form foci, which in turn can be cloned and expanded into cell lines.

A number of selection systems are illustratively used, including, but not limited, to the herpes simplex virus thymidine kinase, hypoxanthine-guanine phosphoribosyltransferase and adenine phosphoribosyltransferase genes, in tk−, hgprt− or aprt− cells, respectively. Also, antimetabolite resistance is optionally used as the basis of selection for dhfr, which confers resistance to methotrexate; gpt, which confers resistance to mycophenolic acid; neo, which confers resistance to the aminoglycoside G-418; and hygro, which confers resistance to hygromycin. It is appreciated that numerous other selection systems are known in the art that are similarly operable in the present invention.

The nucleic acids encoding the peptides and polypeptides of this invention are optionally administered as nucleic acid vaccines. For the purposes of vaccine delivery, a nucleic acid encoding a peptide or polypeptide of this invention is preferably in an expression vector that includes viral nucleic acid including, but not limited to, vaccinia virus, adenovirus, retrovirus and/or adeno-associated virus nucleic acid. The nucleic acid or vector of this invention is optionally in a liposome or a delivery vehicle which can be taken up by a cell via receptor-mediated or other type of endocytosis. The nucleic acid vaccines of this invention are preferably in a pharmaceutically acceptable carrier or administered with an adjuvant. The nucleic acids encoding the peptides and polypeptides of this invention can also be administered to cells in vivo or ex vivo.

It is contemplated that the isolated nucleic acids of the disclosure are optionally “overexpressed”, i.e., expressed in increased levels relative to its natural expression in cells of its indigenous organism, or even relative to the expression of other proteins in the recombinant host cell. Such overexpression is assessed by a variety of methods illustratively including radio-labeling and/or protein purification. However, simple and direct methods are preferred, for example, those involving SDS/PAGE and protein staining or immunoblotting, followed by quantitative analyses, such as densitometric scanning of the resultant gel or blot. A specific increase in the level of the recombinant protein or peptide in comparison to the level in natural in transfected cells is indicative of overexpression, as is a relative abundance of the specific protein in relation to the other proteins produced by the host cell and, e.g., visible on a gel.

Various heterologous vectors are described for DNA vaccinations against viral infections. For example, the vectors described in the following references, incorporated herein by reference, may be used to express hEbola sequences instead of the sequences of the viruses or other pathogens described; in particular, vectors described for hepatitis B virus (Michel, M. L. et al., 1995, DAN-mediated immunization to the hepatitis B surface antigen in mice: Aspects of the humoral response mimic hepatitis B viral infection in humans, Proc. Natl. Aca. Sci. USA 92:5307-5311; Davis, H. L. et al., 1993, DNA-based immunization induces continuous secretion of hepatitis B surface antigen and high levels of circulating antibody, Human Molec. Genetics 2:1847-1851), HIV virus (Wang, B. et al., 1993, Gene inoculation generates immune responses against human immunodeficiency virus type 1, Proc. Natl. Acad. Sci. USA 90:4156-4160; Lu, S. et al., 1996, Simian immunodeficiency virus DNA vaccine trial in Macques, J. Virol. 70:3978-3991; Letvin, N. L. et al., 1997, Potent, protective anti-HIV immune responses generated by bimodal HIV envelope DNA plus protein vaccination, Proc Natl Acad Sci USA. 94(17):9378-83), and influenza viruses (Robinson, H L et al., 1993, Protection against a lethal influenza virus challenge by immunization with a haemagglutinin-expressing plasmid DNA, Vaccine 11:957-960; Ulmer, J. B. et al., Heterologous protection against influenza by injection of DNA encoding a viral protein, Science 259:1745-1749), as well as bacterial infections, such as tuberculosis (Tascon, R. E. et al., 1996, Vaccination against tuberculosis by DNA injection, Nature Med. 2:888-892; Huygen, K. et al., 1996, Immunogenicity and protective efficacy of a tuberculosis DNA vaccine, Nature Med., 2:893-898), and parasitic infection, such as malaria (Sedegah, M., 1994, Protection against malaria by immunization with plasmid DNA encoding circumsporozoite protein, Proc. Natl. Acad. Sci. USA 91:9866-9870; Doolan, D. L. et al., 1996, Circumventing genetic restriction of protection against malaria with multigene DNA immunization: CD8+T cell-interferon .delta., and nitric oxide-dependent immunity, J. Exper. Med., 1183:1739-1746).

Many methods are optionally used to introduce the vaccine formulations described above. These include, but are not limited to, oral, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, and intranasal routes. Alternatively, in a preferred embodiment the chimeric virus vaccine formulation is introduced via the natural route of infection of the pathogen for which the vaccine is designed. The DNA vaccines of the present invention are optionally administered in saline solutions by injections into muscle or skin using a syringe and needle (Wolff J. A. et al., 1990, Direct gene transfer into mouse muscle in vivo, Science 247:1465-1468; Raz, E., 1994, Intradermal gene immunization: The possible role of DNA uptake in the induction of cellular immunity to viruses, c. Natl. Acd. Sci. USA 91:9519-9523). Another way to administer DNA vaccines operable herein is called the “gene gun” method, whereby microscopic gold beads coated with the DNA molecules of interest is fired into cells (Tang, D. et al., 1992, Genetic immunization is a simple method for eliciting an immune response, Nature 356:152-154). For general reviews of the methods for DNA vaccines, see Robinson, H. L., 1999, DNA vaccines: basic mechanism and immune responses (Review), Int. J. Mol. Med. 4(5):549-555; Barber, B., 1997, Introduction: Emerging vaccine strategies, Seminars in Immunology 9(5):269-270; and Robinson, H. L. et al., 1997, DNA vaccines, Seminars in Immunology 9(5):271-283.

Attenuation of hEbola Virus or Variants Thereof

The hEbola virus or variants thereof of the invention are optionally genetically engineered to exhibit an attenuated phenotype. In particular, the viruses of the invention exhibit an attenuated phenotype in a subject to which the virus is administered as a vaccine. Attenuation can be achieved by any method known to a skilled artisan. Without being bound by theory, the attenuated phenotype of the viruses of the invention is caused, e.g., by using a virus that naturally does not replicate well in an intended host species, for example, by reduced replication of the viral genome, by reduced ability of the virus to infect a host cell, or by reduced ability of the viral proteins to assemble to an infectious viral particle relative to the wild type species of the virus.

The attenuated phenotypes of hEbola virus or variants thereof are optionally tested by any method known to the artisan. A candidate virus, for example, is optionally tested for its ability to infect a host or for the rate of replication in a cell culture system. In certain embodiments, growth curves at different temperatures are used to test the attenuated phenotype of the virus. For example, an attenuated virus is able to grow at 35° C., but not at 39° C. or 40° C. In certain embodiments, different cell lines are used to evaluate the attenuated phenotype of the virus. For example, an attenuated virus may only be able to grow in monkey cell lines but not the human cell lines, or the achievable virus titers in different cell lines are different for the attenuated virus. In certain embodiments, viral replication in the respiratory tract of a small animal model, including but not limited to, hamsters, cotton rats, mice and guinea pigs, is used to evaluate the attenuated phenotypes of the virus. In other embodiments, the immune response induced by the virus, including but not limited to, the antibody titers (e.g., assayed by plaque reduction neutralization assay or ELISA) is used to evaluate the attenuated phenotypes of the virus. In a specific embodiment, the plaque reduction neutralization assay or ELISA is carried out at a low dose. In certain embodiments, the ability of the hEbola virus to elicit pathological symptoms in an animal model is tested. A reduced ability of the virus to elicit pathological symptoms in an animal model system is indicative of its attenuated phenotype. In a specific embodiment, the candidate viruses are tested in a monkey model for nasal infection, indicated by mucus production.

The viruses of the invention are optionally attenuated such that one or more of the functional characteristics of the virus are impaired. In certain embodiments, attenuation is measured in comparison to the wild type species of the virus from which the attenuated virus is derived. In other embodiments, attenuation is determined by comparing the growth of an attenuated virus in different host systems. Thus, for a non-limiting example, hEbola virus or a variant thereof is attenuated when grown in a human host if the growth of the hEbola or variant thereof in the human host is reduced compared to the non-attenuated hEbola or variant thereof.

In certain embodiments, the attenuated virus of the invention is capable of infecting a host, is capable of replicating in a host such that infectious viral particles are produced. In comparison to the wild type species, however, the attenuated species grows to lower titers or grows more slowly. Any technique known to the skilled artisan can be used to determine the growth curve of the attenuated virus and compare it to the growth curve of the wild type virus.

In certain embodiments, the attenuated virus of the invention (e.g., a recombinant or chimeric hEbola) cannot replicate in human cells as well as the wild type virus (e.g., wild type hEbola) does. However, the attenuated virus can replicate well in a cell line that lacks interferon functions, such as Vero cells.

In other embodiments, the attenuated virus of the invention is capable of infecting a host, of replicating in the host, and of causing proteins of the virus of the invention to be inserted into the cytoplasmic membrane, but the attenuated virus does not cause the host to produce new infectious viral particles. In certain embodiments, the attenuated virus infects the host, replicates in the host, and causes viral proteins to be inserted in the cytoplasmic membrane of the host with the same efficiency as the wild type hEbola. In other embodiments, the ability of the attenuated virus to cause viral proteins to be inserted into the cytoplasmic membrane into the host cell is reduced compared to the wild type virus. In certain embodiments, the ability of the attenuated hEbola virus to replicate in the host is reduced compared to the wild type virus. Any technique known to the skilled artisan can be used to determine whether a virus is capable of infecting a mammalian cell, of replicating within the host, and of causing viral proteins to be inserted into the cytoplasmic membrane of the host.

In certain embodiments, the attenuated virus of the invention is capable of infecting a host. In contrast to the wild type hEbola, however, the attenuated hEbola cannot be replicated in the host. In a specific embodiment, the attenuated hEbola virus can infect a host and can cause the host to insert viral proteins in its cytoplasmic membranes, but the attenuated virus is incapable of being replicated in the host. Any method known to the skilled artisan can be used to test whether the attenuated hEbola has infected the host and has caused the host to insert viral proteins in its cytoplasmic membranes.

In certain embodiments, the ability of the attenuated virus to infect a host is reduced compared to the ability of the wild type virus to infect the same host. Any technique known to the skilled artisan can be used to determine whether a virus is capable of infecting a host.

In certain embodiments, mutations (e.g., missense mutations) are introduced into the genome of the virus, for example, into the sequence of SEQ ID NOs: 1 or 10, or to generate a virus with an attenuated phenotype. Mutations (e.g., missense mutations) can be introduced into the structural genes and/or regulatory genes of the hEbola. Mutations are optionally additions, substitutions, deletions, or combinations thereof. Such variant of hEbola can be screened for a predicted functionality, such as infectivity, replication ability, protein synthesis ability, assembling ability, as well as cytopathic effect in cell cultures. In a specific embodiment, the missense mutation is a cold-sensitive mutation. In another embodiment, the missense mutation is a heat-sensitive mutation. In another embodiment, the missense mutation prevents a normal processing or cleavage of the viral proteins.

In other embodiments, deletions are introduced into the genome of the hEbola virus, which result in the attenuation of the virus.

In certain embodiments, attenuation of the virus is achieved by replacing a gene of the wild type virus with a gene of a virus of a different species, of a different subgroup, or of a different variant. In another aspect, attenuation of the virus is achieved by replacing one or more specific domains of a protein of the wild type virus with domains derived from the corresponding protein of a virus of a different species. In certain other embodiments, attenuation of the virus is achieved by deleting one or more specific domains of a protein of the wild type virus.

When a live attenuated vaccine is used, its safety should also be considered. The vaccine preferably does not cause disease. Any techniques known in the art for improving vaccine safety are operable in the present invention. In addition to attenuation techniques, other techniques are optionally be used. One non-limiting example is to use a soluble heterologous gene that cannot be incorporated into the virion membrane. For example, a single copy of the soluble version of a viral transmembrane protein lacking the transmembrane and cytosolic domains thereof is used.

Various assays are optionally used to test the safety of a vaccine. For example, sucrose gradients and neutralization assays are used to test the safety. A sucrose gradient assay is optionally used to determine whether a heterologous protein is inserted in a virion. If the heterologous protein is inserted in the virion, the virion is preferably tested for its ability to cause symptoms in an appropriate animal model since the virus may have acquired new, possibly pathological, properties.

5.4 Adjuvants and Carrier Molecules

hEbola-associated antigens are administered with one or more adjuvants. In one embodiment, the hEbola-associated antigen is administered together with a mineral salt adjuvants or mineral salt gel adjuvant. Such mineral salt and mineral salt gel adjuvants include, but are not limited to, aluminum hydroxide (ALHYDROGEL, REHYDRAGEL), aluminum phosphate gel, aluminum hydroxyphosphate (ADJU-PHOS), and calcium phosphate.

In another embodiment, hEbola-associated antigen is administered with an immunostimulatory adjuvant. Such class of adjuvants include, but are not limited to, cytokines (e.g., interleukin-2, interleukin-7, interleukin-12, granulocyte-macrophage colony stimulating factor (GM-CSF), interferon-γ interleukin-1β (IL-1β), and IL-1β peptide or Sclavo Peptide), cytokine-containing liposomes, triterpenoid glycosides or saponins (e.g., QuilA and QS-21, also sold under the trademark STIMULON, ISCOPREP), Muramyl Dipeptide (MDP) derivatives, such as N-acetyl-muramyl-L-threonyl-D-isoglutamine (Threonyl-MDP, sold under the trademark TERMURTIDE), GMDP, N-acetyl-nor-muramyl-L-alanyl-D-isoglutamine, N-acetylmuramyl-L-alanyl-D-isoglutaminyl-L-alanine-2-(1′-2′-dipalmitoyl-s-n-glycero-3-hydroxy phosphoryloxy)-ethylamine, muramyl tripeptide phosphatidylethanolamine (MTP-PE), unmethylated CpG dinucleotides and oligonucleotides, such as bacterial DNA and fragments thereof, LPS, monophosphoryl Lipid A (3D-MLA sold under the trademark MPL), and polyphosphazenes.

In another embodiment, the adjuvant used is a particular adjuvant, including, but not limited to, emulsions, e.g., Freund’s Complete Adjuvant, Freund’s Incomplete Adjuvant, squalene or squalane oil-in-water adjuvant formulations, such as SAF and MF59, e.g., prepared with block-copolymers, such as L-121 (polyoxypropylene/polyoxyetheylene) sold under the trademark PLURONIC L-121, Liposomes, Virosomes, cochleates, and immune stimulating complex, which is sold under the trademark ISCOM.

In another embodiment, a microparticular adjuvant is used. Microparticular adjuvants include, but are not limited to, biodegradable and biocompatible polyesters, homo- and copolymers of lactic acid (PLA) and glycolic acid (PGA), poly(lactide-co-glycolides) (PLGA) microparticles, polymers that self-associate into particulates (poloxamer particles), soluble polymers (polyphosphazenes), and virus-like particles (VLPs) such as recombinant protein particulates, e.g., hepatitis B surface antigen (HbsAg).

Yet another class of adjuvants that are optionally used include mucosal adjuvants, including but not limited to heat-labile enterotoxin from Escherichia coli (LT), cholera holotoxin (CT) and cholera Toxin B Subunit (CTB) from Vibrio cholerae, mutant toxins (e.g., LTK63 and LTR72), microparticles, and polymerized liposomes.

In other embodiments, any of the above classes of adjuvants are optionally used in combination with each other or with other adjuvants. For example, non-limiting examples of combination adjuvant preparations used to administer the hEbola-associated antigens of the invention include liposomes containing immunostimulatory protein, cytokines, T-cell and/or B-cell peptides, or microbes with or without entrapped IL-2 or microparticles containing enterotoxin. Other adjuvants known in the art are also included within the scope of the invention (see Vaccine Design: The Subunit and Adjuvant Approach, Chap. 7, Michael F. Powell and Mark J. Newman (eds.), Plenum Press, New York, 1995, which is incorporated herein in its entirety).

The effectiveness of an adjuvant is illustratively determined by measuring the induction of antibodies directed against an immunogenic polypeptide containing a hEbola polypeptide epitope, the antibodies resulting from administration of this polypeptide in vaccines which are also comprised of the various adjuvants.

The polypeptides are optionally formulated into the vaccine as neutral or salt forms. Pharmaceutically acceptable salts include the acid additional salts (formed with free amino groups of the peptide) and which are formed with inorganic acids, such as, for example, hydrochloric or phosphoric acids, or organic acids such as acetic, oxalic, tartaric, maleic, and the like. Salts formed with free carboxyl groups are optionally derived from inorganic bases, such as, for example, sodium potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, 2-ethylamino ethanol, histidine, procaine and the like.

The vaccines of the invention are preferably multivalent or univalent. Multivalent vaccines are made from recombinant viruses that direct the expression of more than one antigen.

Many methods are operable herein to introduce the vaccine formulations of the invention; these include but are not limited to oral, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal routes, and via scarification (scratching through the top layers of skin, e.g., using a bifurcated needle).

The patient to which the vaccine is administered is preferably a mammal, most preferably a human, but is also optionally a non-human animal including but not limited to lower primates, cows, horses, sheep, pigs, fowl (e.g., chickens), goats, cats, dogs, hamsters, mice and rats.

Preparation of Antibodies

Antibodies that specifically recognize a polypeptide of the invention, such as, but not limited to, polypeptides including the sequence of SEQ ID NOs: 2-9, 59, or 11-19 and other polypeptides as described herein, or hEbola epitope or antigen-binding fragments thereof are used in a preferred embodiment for detecting, screening, and isolating the polypeptide of the invention or fragments thereof, or similar sequences that might encode similar enzymes from the other organisms. For example, in one specific embodiment, an antibody which immunospecifically binds hEbola epitope, or a fragment thereof, is used for various in vitro detection assays, including enzyme-linked immunosorbent assays (ELISA), radioimmunoassays, western blot, etc., for the detection of a polypeptide of the invention or, preferably, hEbola, in samples, for example, a biological material, including cells, cell culture media (e.g., bacterial cell culture media, mammalian cell culture media, insect cell culture media, yeast cell culture media, etc.), blood, plasma, serum, tissues, sputum, naseopharyngeal aspirates, etc.

Antibodies specific for a polypeptide of the invention or any epitope of hEbola are optionally generated by any suitable method known in the art. Polyclonal antibodies to an antigen of interest, for example, the hEbola virus from Deposit Accession No. 200706291, or including a nucleotide sequence of SEQ ID NOs: 1 or 10, are optionally produced by various procedures well known in the art. For example, an antigen is optionally administered to various host animals including, but not limited to, rabbits, mice, rats, etc., to induce the production of antisera containing polyclonal antibodies specific for the antigen. Various adjuvants are optionally used to increase the immunological response, depending on the host species, and include but are not limited to, Freund’s (complete and incomplete) adjuvant, mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanins, dinitrophenol, and potentially useful adjuvants for humans such as BCG (Bacille Calmette-Guerin) and Corynebacterium parvum. Such adjuvants are also well known in the art.

Monoclonal antibodies are optionally prepared using a wide variety of techniques known in the art including the use of hybridoma, recombinant, and phage display technologies, or a combination thereof. In one example, monoclonal antibodies are produced using hybridoma techniques including those known in the art and taught, for example, in Harlow et al., Antibodies: A Laboratory Manual (Cold Spring Harbor Laboratory Press, 2nd ed. 1988); Hammerling, et al., in: Monoclonal Antibodies and T-Cell Hybridomas, pp. 563-681 (Elsevier, N.Y., 1981) (both of which are incorporated by reference in their entireties). The term “monoclonal antibody” as used herein is not limited to antibodies produced through hybridoma technology. The term “monoclonal antibody” refers to an antibody that is derived from a single clone, including any eukaryotic, prokaryotic, or phage clone, and not the method by which it is produced.

Methods for producing and screening for specific antibodies using hybridoma technology are routine and well known in the art. In a non-limiting example, mice are immunized with an antigen of interest or a cell expressing such an antigen. Once an immune response is detected, e.g., antibodies specific for the antigen are detected in the mouse serum, the mouse spleen is harvested and splenocytes isolated. The splenocytes are then fused by well known techniques to any suitable myeloma cells. Hybridomas are selected and cloned by limiting dilution. The hybridoma clones are then assayed by methods known in the art for cells that secrete antibodies capable of binding the antigen. Ascites fluid, which generally contains high levels of antibodies, is optionally generated by inoculating mice intraperitoneally with positive hybridoma clones.

Antibody fragments which recognize specific epitopes are optionally generated by known techniques. For example, Fab and F(ab′)2 fragments are illustratively produced by proteolytic cleavage of immunoglobulin molecules, using enzymes such as papain (to produce Fab fragments) or pepsin (to produce F(ab′)2 fragments). F(ab′)2 fragments preferably contain the complete light chain, and the variable region, the CH1 region and the hinge region of the heavy chain.

The antibodies of the invention or fragments thereof are optionally produced by any method known in the art for the synthesis of antibodies, in particular, by chemical synthesis or preferably, by recombinant expression techniques.

The nucleotide sequence encoding an antibody is obtained from any information available to those skilled in the art (i.e., from Genbank, the literature, or by routine cloning and sequence analysis). If a clone containing a nucleic acid encoding a particular antibody or an epitope-binding fragment thereof is not available, but the sequence of the antibody molecule or epitope-binding fragment thereof is known, a nucleic acid encoding the immunoglobulin may be chemically synthesized or obtained from a suitable source (e.g., an antibody cDNA library, or a cDNA library generated from, or nucleic acid, preferably poly A+RNA, isolated from any tissue or cells expressing the antibody, such as hybridoma cells selected to express an antibody) by PCR amplification using synthetic primers hybridizable to the 3′ and 5′ ends of the sequence or by cloning using an oligonucleotide probe specific for the particular gene sequence to identify, e.g., a cDNA clone from a cDNA library that encodes the antibody. Amplified nucleic acids generated by PCR are optionally then cloned into replicable cloning vectors using any method known in the art.

Once the nucleotide sequence of the antibody is determined, the nucleotide sequence of the antibody is optionally manipulated using methods well known in the art for the manipulation of nucleotide sequences, e.g., recombinant DNA techniques, site directed mutagenesis, PCR, etc. (see, for example, the techniques described in Sambrook et al., supra; and Ausubel et al., eds., 1998, Current Protocols in Molecular Biology, John Wiley & Sons, NY, which are both incorporated by reference herein in their entireties), to generate antibodies having a different amino acid sequence by, for example, introducing amino acid substitutions, deletions, and/or insertions into the epitope-binding domain regions of the antibodies or any portion of antibodies which may enhance or reduce biological activities of the antibodies.

Recombinant expression of an antibody requires construction of an expression vector containing a nucleotide sequence that encodes the antibody. Once a nucleotide sequence encoding an antibody molecule or a heavy or light chain of an antibody, or portion thereof has been obtained, the vector for the production of the antibody molecule is optionally produced by recombinant DNA technology using techniques known in the art as discussed in the previous sections. Methods which are known to those skilled in the art are optionally used to construct expression vectors containing antibody coding sequences and appropriate transcriptional and translational control signals. These methods include, for example, in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. The nucleotide sequence encoding the heavy-chain variable region, light-chain variable region, both the heavy-chain and light-chain variable regions, an epitope-binding fragment of the heavy- and/or light-chain variable region, or one or more complementarity determining regions (CDRs) of an antibody are optionally cloned into such a vector for expression. Thus, prepared expression vector is optionally then introduced into appropriate host cells for the expression of the antibody. Accordingly, the invention includes host cells containing a polynucleotide encoding an antibody specific for the polypeptides of the invention or fragments thereof.

The host cell is optionally co-transfected with two expression vectors of the invention, the first vector encoding a heavy chain derived polypeptide and the second vector encoding a light chain derived polypeptide. The two vectors illustratively contain identical selectable markers which enable equal expression of heavy and light chain polypeptides or different selectable markers to ensure maintenance of both plasmids. Alternatively, a single vector is optionally used which encodes, and is capable of expressing, both heavy and light chain polypeptides. In such situations, the light chain should be placed before the heavy chain to avoid an excess of toxic free heavy chain (Proudfoot, Nature, 322:52, 1986; and Kohler, Proc. Natl. Acad. Sci. USA, 77:2 197, 1980). The coding sequences for the heavy and light chains optionally include cDNA or genomic DNA.

In another embodiment, antibodies are generated using various phage display methods known in the art. In phage display methods, functional antibody domains are displayed on the surface of phage particles which carry the polynucleotide sequences encoding them. In a particular embodiment, such phage is utilized to display antigen binding domains, such as Fab and Fv or disulfide-bond stabilized Fv, expressed from a repertoire or combinatorial antibody library (e.g., human or murine). Phage expressing an antigen binding domain that binds the antigen of interest is optionally selected or identified with antigen, e.g., using labeled antigen or antigen bound or captured to a solid surface or bead. Phages used in these methods are typically filamentous phage, including fd and M13. The antigen binding domains are expressed as a recombinantly fused protein to either the phage gene III or gene VIII protein. Examples of phage display methods that can be used to make the immunoglobulins, or fragments thereof, of the present invention include those disclosed in Brinkman et al., J. Immunol. Methods, 182:41-50, 1995; Ames et al., J. Immunol. Methods, 184:177-186, 1995; Kettleborough et al., Eur. J. Immunol., 24:952-958, 1994; Persic et al., Gene, 187:9-18, 1997; Burton et al., Advances in Immunology, 57:191-280, 1994; PCT application No. PCT/GB91/01134; PCT publications WO 90/02809; WO 91/10737; WO 92/01047; WO 92/18619; WO 93/11236; WO 95/15982; WO 95/20401; and U.S. Pat. Nos. 5,698,426; 5,223,409; 5,403,484; 5,580,717; 5,427,908; 5,750,753; 5,821,047; 5,571,698; 5,427,908; 5,516,637; 5,780,225; 5,658,727; 5,733,743 and 5,969,108; each of which is incorporated herein by reference in its entirety.

As described in the above references, after phage selection, the antibody coding regions from the phage is optionally isolated and used to generate whole antibodies, including human antibodies, or any other desired fragments, and expressed in any desired host, including mammalian cells, insect cells, plant cells, yeast, and bacteria, e.g., as described in detail below. For example, techniques to recombinantly produce Fab, Fab′ and F(ab′)2 fragments are optionally employed using methods known in the art such as those disclosed in PCT publication WO 92/22324; Mullinax et al., BioTechniques, 12(6):864-869, 1992; and Sawai et al., AJR1, 34:26-34, 1995; and Better et al., Science, 240:1041-1043, 1988 (each of which is incorporated by reference in its entirety). Examples of techniques operable to produce single-chain Fvs and antibodies include those described in U.S. Pat. Nos. 4,946,778 and 5,258,498; Huston et al., Methods in Enzymology, 203:46-88, 1991; Shu et al., PNAS, 90:7995-7999, 1993; and Skerra et al., Science, 240:1038-1040, 1988.

Once an antibody molecule of the invention has been produced by any methods described above, or otherwise known in the art, it is then optionally purified by any method known in the art for purification of an immunoglobulin molecule, for example, by chromatography (e.g., ion exchange, affinity, particularly by affinity for the specific antigen after Protein A or Protein G purification, and sizing column chromatography), centrifugation, differential solubility, or by any other standard technique(s) for the purification of proteins. Further, the antibodies of the present invention or fragments thereof are optionally fused to heterologous polypeptide sequences described herein or otherwise known in the art to facilitate purification. Illustrative examples include 6×His tag, FLAG tag, biotin, avidin, or other system.

For some uses, including in vivo use of antibodies in humans and in vitro detection assays, it is preferable to use chimeric, humanized, or human antibodies. A chimeric antibody is a molecule in which different portions of the antibody are derived from different animal species, such as antibodies having a variable region derived from a murine monoclonal antibody and a constant region derived from a human immunoglobulin. Methods for producing chimeric antibodies are known in the art. See e.g., Morrison, Science, 229:1202, 1985; Oi et al., BioTechniques, 4:214 1986; Gillies et al., J. Immunol. Methods, 125:191-202, 1989; U.S. Pat. Nos. 5,807,715; 4,816,567; and 4,816,397, which are incorporated herein by reference in their entireties. Humanized antibodies are antibody molecules from non-human species that bind the desired antigen having one or more complementarity determining regions (CDRs) from the non-human species and framework regions from a human immunoglobulin molecule. Often, framework residues in the human framework regions will be substituted with the corresponding residue from the CDR donor antibody to alter, preferably improve, antigen binding. These framework substitutions are identified by methods well known in the art, e.g., by modeling of the interactions of the CDR and framework residues to identify framework residues important for antigen binding and sequence comparison to identify unusual framework residues at particular positions. See, e.g., Queen et al., U.S. Pat. No. 5,585,089; Riechmann et al., Nature, 332:323, 1988, which are incorporated herein by reference in their entireties. Antibodies are humanized using a variety of techniques known in the art including, for example, CDR-grafting (EP 239,400; PCT publication WO 91/09967; U.S. Pat. Nos. 5,225,539; 5,530,101 and 5,585,089), veneering or resurfacing (EP 592,106; EP 519,596; Padlan, Molecular Immunology, 28(4/5):489-498, 1991; Studnicka et al., Protein Engineering, 7(6):805-814, 1994; Roguska et al., Proc Natl. Acad. Sci. USA, 91:969-973, 1994), and chain shuffling (U.S. Pat. No. 5,565,332), all of which are hereby incorporated by reference in their entireties.

Completely human antibodies are particularly desirable for therapeutic treatment of human patients. Human antibodies are made by a variety of methods known in the art illustratively including phage display methods described above using antibody libraries derived from human immunoglobulin sequences. See U.S. Pat. Nos. 4,444,887 and 4,716,111; and PCT publications WO 98/46645; WO 98/50433; WO 98/24893; WO 98/16654; WO 96/34096; WO 96/33735; and WO 91/10741, each of which is incorporated herein by reference in its entirety.

Human antibodies are also illustratively produced using transgenic mice which are incapable of expressing functional endogenous immunoglobulins, but which can express human immunoglobulin genes. For an overview of this technology for producing human antibodies, see Lonberg and Huszar, Int. Rev. Immunol., 13:65-93, 1995. For a detailed discussion of this technology for producing human antibodies and human monoclonal antibodies and protocols for producing such antibodies, see, e.g., PCT publications WO 98/24893; WO 92/01047; WO 96/34096; WO 96/33735; European Patent No. 0 598 877; U.S. Pat. Nos. 5,413,923; 5,625,126; 5,633,425; 5,569,825; 5,661,016; 5,545,806; 5,814,318; 5,885,793; 5,916,771; and 5,939,598, which are incorporated by reference herein in their entireties. In addition, companies such as Abgenix, Inc. (Fremont, Calif.), Medarex (NJ) and Genpharm (San Jose, Calif.) can be engaged to provide human antibodies directed against a selected antigen using technology similar to that described above.

Completely human antibodies which recognize a selected epitope are optionally generated using a technique referred to as “guided selection.” In this approach a selected non-human monoclonal antibody, e.g., a mouse antibody, is used to guide the selection of a completely human antibody recognizing the same epitope. (Jespers et al., Bio/technology, 12:899-903, 1988).

Antibodies fused or conjugated to heterologous polypeptides are optionally used in in vitro immunoassays and in purification methods (e.g., affinity chromatography) known in the art. See e.g., PCT publication No. WO 93/21232; EP 439,095; Naramura et al., Immunol. Lett., 39:91-99, 1994; U.S. Pat. No. 5,474,981; Gillies et al., PNAS, 89:1428-1432, 1992; and Fell et al., J. Immunol., 146:2446-2452, 1991, which are incorporated herein by reference in their entireties.

Antibodies may also be illustratively attached to solid supports, which are particularly useful for immunoassays or purification of the polypeptides of the invention or fragments, derivatives, analogs, or variants thereof, or similar molecules having the similar enzymatic activities as the polypeptide of the invention. Such solid supports include, but are not limited to, glass, cellulose, polyacrylamide, nylon, polystyrene, polyvinyl chloride or polypropylene.

Pharmaceutical Compositions and Kits

The present invention encompasses pharmaceutical compositions including antiviral agents of the present invention. In a specific embodiment, the antiviral agent is preferably an antibody which immunospecifically binds and neutralizes the hEbola virus or variants thereof, or any proteins derived therefrom. In another specific embodiment, the antiviral agent is a polypeptide or nucleic acid molecule of the invention. The pharmaceutical compositions have utility as an antiviral prophylactic agent are illustratively administered to a subject where the subject has been exposed or is expected to be exposed to a virus.

Various delivery systems are known and operable to administer the pharmaceutical composition of the invention, illustratively, encapsulation in liposomes, microparticles, microcapsules, recombinant cells capable of expressing the mutant viruses, and receptor mediated endocytosis (see, e.g., Wu and Wu, 1987, J. Biol. Chem. 262:4429 4432). Methods of introduction include but are not limited to intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, and oral routes. The compounds may be administered by any convenient route, for example by infusion or bolus injection, by absorption through epithelial or mucocutaneous linings (e.g., oral mucosa, rectal and intestinal mucosa, etc.) and optionally administered together with other biologically active agents. Administration is systemic or local. In a preferred embodiment, it is desirable to introduce the pharmaceutical compositions of the invention into the lungs by any suitable route. Pulmonary administration can also be employed, e.g., by use of an inhaler or nebulizer, and formulation with an aerosolizing agent.

In a specific embodiment, it is desirable to administer the pharmaceutical compositions of the invention locally to the area in need of treatment. This administration may be achieved by, for example, and not by way of limitation, local infusion during surgery, topical application, e.g., in conjunction with a wound dressing after surgery, by injection, by means of a catheter, by means of a suppository, by means of nasal spray, or by means of an implant, the implant being of a porous, non-porous, or gelatinous material, including membranes, such as sialastic membranes, or fibers. In one embodiment, administration can be by direct injection at the site (or former site) infected tissues.

In another embodiment, the pharmaceutical composition is delivered in a vesicle, in particular a liposome (see Langer, 1990, Science 249:1527-1533; Treat et al., in Liposomes in the Therapy of Infectious Disease and Cancer, Lopez Berestein and Fidler (eds.), Liss, New York, pp. 353-365 (1989); Lopez-Berestein, ibid., pp. 317-327; see generally ibid.).

In yet another embodiment, the pharmaceutical composition is delivered in a controlled release system. In one embodiment, a pump is used (see Langer, supra; Sefton, 1987, CRC Crit. Ref. Biomed. Eng. 14:201; Buchwald et al., 1980, Surgery 88:507; and Saudek et al., 1989, N. Engl. J. Med. 321:574). In another embodiment, polymeric materials are used (see Medical Applications of Controlled Release, Langer and Wise (eds.), CRC Pres., Boca Raton, Fla. (1974); Controlled Drug Bioavailability, Drug Product Design and Performance, Smolen and Ball (eds.), Wiley, New York (1984); Ranger and Peppas, J. Macromol. Sci. Rev. Macromol. Chem. 23:61 (1983); see also Levy et al., 1985, Science 228:190; During et al., 1989, Ann. Neurol. 25:351; Howard et al., 1989, J. Neurosurg. 71:105). In yet another embodiment, a controlled release system is placed in proximity of the composition’s target, i.e., the lung, thus, requiring only a fraction of the systemic dose (see, e.g., Goodson, in Medical Applications of Controlled Release, supra, vol. 2, pp. 115-138 (1984)).

Other controlled release systems are discussed in the review by Langer (Science 249:1527-1533 (1990)) the contents of which are incorporated herein by reference.

The pharmaceutical compositions of the present invention illustratively include a therapeutically effective amount of a live attenuated, inactivated or killed West African hEbola virus, or recombinant or chimeric hEbola virus, and a pharmaceutically acceptable carrier. In a specific embodiment, the term “pharmaceutically acceptable” means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans. The term “carrier” refers to a diluent, adjuvant, excipient, or vehicle with which the pharmaceutical composition is administered. Such pharmaceutical carriers are illustratively sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a preferred carrier when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions are optionally employed as liquid carriers, particularly for injectable solutions. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like. The composition, if desired, also contains wetting or emulsifying agents, or pH buffering agents. These compositions optionally take the form of solutions, suspensions, emulsion, tablets, pills, capsules, powders, sustained release formulations and the like. The composition is optionally formulated as a suppository, with traditional binders and carriers such as triglycerides. Oral formulation illustratively includes standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, etc. Examples of suitable pharmaceutical carriers are described in “Remington’s Pharmaceutical Sciences” by E. W. Martin. The formulation should suit the mode of administration.

In a preferred embodiment, the composition is formulated in accordance with routine procedures as a pharmaceutical composition adapted for intravenous administration to human beings. Typically, compositions for intravenous administration are solutions in sterile isotonic aqueous buffer. The composition also includes an optional solubilizing agent and a local anesthetic such as lignocaine to ease pain at the site of the injection. Generally, the ingredients are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water-free concentrate in a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent. Where the composition is to be administered by infusion, it can be dispensed with an infusion bottle containing sterile pharmaceutical grade water or saline. Where the composition is administered by injection, an ampoule of sterile water for injection or saline is optionally provided so that the ingredients may be mixed prior to administration.

The pharmaceutical compositions of the invention are illustratively formulated as neutral or salt forms. Pharmaceutically acceptable salts illustratively include those formed with free amino groups such as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc., and those formed with free carboxyl groups such as those derived from sodium, potassium, ammonium, calcium, ferric hydroxides, isopropylamine, triethylamine, 2 ethylamino ethanol, histidine, procaine, etc.

The amount of the pharmaceutical composition of the invention which will be effective in the treatment of a particular disorder or condition will depend on the nature of the disorder or condition, and can be determined by standard clinical techniques. In addition, in vitro assays are optionally employed to help identify optimal dosage ranges. The precise dose to be employed in the formulation will also depend on the route of administration, and the seriousness of the disease or disorder, and should be decided according to the judgment of the practitioner and each patient’s circumstances. However, suitable dosage ranges for intravenous administration are generally about 20 to 500 micrograms of active compound per kilogram body weight. Suitable dosage ranges for intranasal administration are generally about 0.01 pg/kg body weight to 1 mg/kg body weight. Effective doses may be extrapolated from dose response curves derived from in vitro or animal model test systems.

Suppositories generally contain active ingredient in the range of 0.5% to 10% by weight; oral formulations preferably contain 10% to 95% active ingredient.

The invention also provides a pharmaceutical pack or kit including one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention. Optionally associated with such container(s) is a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration. In a preferred embodiment, the kit contains an antiviral agent of the invention, e.g., an antibody specific for the polypeptides encoded by a nucleotide sequence of SEQ ID NOs: 1 or 10, or as shown in SEQ ID NOs: 2-9, 59, or 11-19, or any hEbola epitope, or a polypeptide or protein of the present invention, or a nucleic acid molecule of the invention, alone or in combination with adjuvants, antivirals, antibiotics, analgesic, bronchodilators, or other pharmaceutically acceptable excipients.

The present invention further encompasses kits including a container containing a pharmaceutical composition of the present invention and instructions for use.

Detection Assays

The present invention provides a method for detecting an antibody, which immunospecifically binds to the hEbola virus, in a biological sample, including for example blood, serum, plasma, saliva, urine, feces, etc., from a patient suffering from hEbola infection, and/or hemorrhagic fever. In a specific embodiment, the method including contacting the sample with the hEbola virus, for example, of Deposit Accession No. 200706291, or having a genomic nucleic acid sequence of SEQ ID NOs: 1 or 10, directly immobilized on a substrate and detecting the virus-bound antibody directly or indirectly by a labeled heterologous anti-isotype antibody. In another specific embodiment, the sample is contacted with a host cell which is infected by the hEbola virus, for example, of Deposit Accession No. 200706291, or having a genomic nucleic acid sequence of SEQ ID NOs: 1 or 10, and the bound antibody is optionally detected by immunofluorescent assay.

An exemplary method for detecting the presence or absence of a polypeptide or nucleic acid of the invention in a biological sample involves obtaining a biological sample from various sources and contacting the sample with a compound or an agent capable of detecting an epitope or nucleic acid (e.g., mRNA, genomic DNA) of the hEbola virus such that the presence of the hEbola virus is detected in the sample. A preferred agent for detecting hEbola mRNA or genomic RNA of the invention is a labeled nucleic acid probe capable of hybridizing to mRNA or genomic RNA encoding a polypeptide of the invention. The nucleic acid probe is, for example, a nucleic acid molecule including the nucleotide sequence of SEQ ID NOs: 1 or 10, a complement thereof, or a portion thereof, such as an oligonucleotide of at least 15, 20, 25, 30, 50, 100, 250, 500, 750, 1000 or more contiguous nucleotides in length and sufficient to specifically hybridize under stringent conditions to a hEbola mRNA or genomic RNA.

As used herein, the term “stringent conditions” describes conditions for hybridization and washing under which nucleotide sequences having at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% identity to each other typically remain hybridized to each other. Such hybridization conditions are described in, for example but not limited to, Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1 6.3.6; Basic Methods in Molecular Biology, Elsevier Science Publishing Co., Inc., N.Y. (1986), pp. 75 78, and 84 87; and Molecular Cloning, Cold Spring Harbor Laboratory, N.Y. (1982), pp. 387 389, and are well known to those skilled in the art. A preferred, non-limiting example of stringent hybridization conditions is hybridization in 6× sodium chloride/sodium citrate (SSC), 0.5% SDS at about 68° C. followed by one or more washes in 2×SSC, 0.5% SDS at room temperature. Another preferred, non-limiting example of stringent hybridization conditions is hybridization in 6×SSC at about 45° C. followed by one or more washes in 0.2×SSC, 0.1% SDS at 50 to 65° C.

A nucleic acid probe, polynucleotide, oligonucleotide, or other nucleic acid is preferably purified. An “isolated” or “purified” nucleotide sequence is substantially free of cellular material or other contaminating proteins from the cell or tissue source from which the nucleotide is derived, or is substantially free of chemical precursors or other chemicals when chemically synthesized. The language “substantially free of cellular material” includes preparations of a nucleotide/oligonucleotide in which the nucleotide/oligonucleotide is separated from cellular components of the cells from which it is isolated or produced. Thus, a nucleotide/oligonucleotide that is substantially free of cellular material includes preparations of the nucleotide having less than about 30%, 20%, 10%, 5%, 2.5%, or 1%, (by dry weight) of contaminating material. When nucleotide/oligonucleotide is produced by chemical synthesis, it is preferably substantially free of chemical precursors or other chemicals, i.e., it is separated from chemical precursors or other chemicals which are involved in the synthesis of the protein. Accordingly, such preparations of the nucleotide/oligonucleotide have less than about 30%, 20%, 10%, or 5% (by dry weight) of chemical precursors or compounds other than the nucleotide/oligonucleotide of interest. In a preferred embodiment of the present invention, the nucleotide/oligonucleotide is isolated or purified.

In another preferred specific embodiment, the presence of hEbola virus is detected in the sample by a reverse transcription polymerase chain reaction (RT-PCR) using the primers that are constructed based on a partial nucleotide sequence of the genome of hEbola virus, for example, that of Deposit Accession No. 200706291, or having a genomic nucleic acid sequence of SEQ ID NOs: 1 or 10. In a non-limiting specific embodiment, preferred primers to be used in a RT-PCR method are the primers are described in detail herein.

In more preferred specific embodiment, the present invention provides a real-time quantitative PCR assay to detect the presence of hEbola virus in a biological sample by subjecting the cDNA obtained by reverse transcription of the extracted total RNA from the sample to PCR reactions using the specific primers described in detail herein, and a fluorescence dye, such as SYBR® Green I, which fluoresces when bound nonspecifically to double-stranded DNA. The fluorescence signals from these reactions are captured at the end of extension steps as PCR product is generated over a range of the thermal cycles, thereby allowing the quantitative determination of the viral load in the sample based on an amplification plot.

A preferred agent for detecting hEbola is an antibody that specifically binds a polypeptide of the invention or any hEbola epitope, preferably an antibody with a detectable label. Antibodies are illustratively polyclonal, or more preferably, monoclonal. An intact antibody, or a fragment thereof (e.g., Fab or F(ab′)2) is operable herein.

The term “labeled”, with regard to the probe or antibody, is intended to encompass direct labeling of the probe or antibody by coupling (i.e., physically linking) a detectable substance to the probe or antibody, optionally via a linker, as well as indirect labeling of the probe or antibody by reactivity with another reagent that is directly labeled. Examples of indirect labeling include detection of a primary antibody using a fluorescently labeled secondary antibody and end-labeling of a DNA probe with biotin such that it is detectable with fluorescently labeled streptavidin. The detection method of the invention is optionally used to detect mRNA, protein (or any epitope), or genomic RNA in a sample in vitro as well as in vivo. Exemplary in vitro techniques for detection of mRNA include northern hybridizations, in situ hybridizations, RT-PCR, and RNase protection. In vitro techniques for detection of an epitope of hEbola illustratively include enzyme linked immunosorbent assays (ELISAs), western blots, immunoprecipitations and immunofluorescence. In vitro techniques for detection of genomic RNA include northern hybridizations, RT-PCT, and RNase protection. Furthermore, in vivo techniques for detection of hEbola include introducing into a subject organism a labeled antibody directed against the polypeptide. In one embodiment, the antibody is labeled with a radioactive marker whose presence and location in the subject organism is detected by standard imaging techniques, including autoradiography.

In a specific embodiment, the methods further involve obtaining a control sample from a control subject, contacting the control sample with a compound or agent capable of detecting hEbola, e.g., a polypeptide of the invention or mRNA or genomic RNA encoding a polypeptide of the invention, such that the presence of hEbola or the polypeptide or mRNA or genomic RNA encoding the polypeptide is detected in the sample, and comparing the absence of hEbola or the polypeptide or mRNA or genomic RNA encoding the polypeptide in the control sample with the presence of hEbola, or the polypeptide or mRNA or genomic DNA encoding the polypeptide in the test sample.

The invention also encompasses kits for detecting the presence of hEbola or a polypeptide or nucleic acid of the invention in a test sample. The kit illustratively includes a labeled compound or agent capable of detecting hEbola or the polypeptide or a nucleic acid molecule encoding the polypeptide in a test sample and, in certain embodiments, a means for determining the amount of the polypeptide or mRNA in the sample (e.g., an antibody which binds the polypeptide or an oligonucleotide probe which binds to DNA or mRNA encoding the polypeptide). Kits optionally include instructions for use.

For antibody-based kits, the kit illustratively includes: (1) a first antibody (e.g., attached to a solid support) which binds to a polypeptide of the invention or hEbola epitope; and, optionally, (2) a second, different antibody which binds to either the polypeptide or the first antibody and is preferably conjugated to a detectable agent.

For oligonucleotide-based kits, the kit illustratively includes: (1) an oligonucleotide, e.g., a detectably labeled oligonucleotide, which hybridizes to a nucleic acid sequence encoding a polypeptide of the invention or to a sequence within the hEbola genome; or (2) a pair of primers useful for amplifying a nucleic acid molecule containing an hEbola sequence. The kit optionally includes a buffering agent, a preservative, or a protein stabilizing agent. The kit optionally includes components necessary for detecting the detectable agent (e.g., an enzyme or a substrate). The kit optionally contains a control sample or a series of control samples which can be assayed and compared to the test sample contained. Each component of the kit is usually enclosed within an individual container and all of the various containers are within a single package along with instructions for use.

Screening Assays to Identify Antiviral Agents

The invention provides methods for the identification of a compound that inhibits the ability of hEbola virus to infect a host or a host cell. In certain embodiments, the invention provides methods for the identification of a compound that reduces the ability of hEbola virus to replicate in a host or a host cell. Any technique well known to the skilled artisan is illustratively used to screen for a compound useful to abolish or reduce the ability of hEbola virus to infect a host and/or to replicate in a host or a host cell.

In certain embodiments, the invention provides methods for the identification of a compound that inhibits the ability of hEbola virus to replicate in a mammal or a mammalian cell. More specifically, the invention provides methods for the identification of a compound that inhibits the ability of hEbola virus to infect a mammal or a mammalian cell. In certain embodiments, the invention provides methods for the identification of a compound that inhibits the ability of hEbola virus to replicate in a mammalian cell. In a specific embodiment, the mammalian cell is a human cell.

In another embodiment, a cell is contacted with a test compound and infected with the hEbola virus. In certain embodiments, a control culture is infected with the hEbola virus in the absence of a test compound. The cell is optionally contacted with a test compound before, concurrently with, or subsequent to the infection with the hEbola virus. In a specific embodiment, the cell is a mammalian cell. In an even more specific embodiment, the cell is a human cell. In certain embodiments, the cell is incubated with the test compound for at least 1 minute, at least 5 minutes, at least 15 minutes, at least 30 minutes, at least 1 hour, at least 2 hours, at least 5 hours, at least 12 hours, or at least 1 day. The titer of the virus is optionally measured at any time during the assay. In certain embodiments, a time course of viral growth in the culture is determined. If the viral growth is inhibited or reduced in the presence of the test compound, the test compound is identified as being effective in inhibiting or reducing the growth or infection of the hEbola virus. In a specific embodiment, the compound that inhibits or reduces the growth of the hEbola virus is tested for its ability to inhibit or reduce the growth rate of other viruses to test its specificity for the hEbola virus.

In one embodiment, a test compound is administered to a model animal and the model animal is infected with the hEbola virus. In certain embodiments, a control model animal is infected with the hEbola virus without the administration of a test compound. The test compound is optionally administered before, concurrently with, or subsequent to the infection with the hEbola virus. In a specific embodiment, the model animal is a mammal. In an even more specific embodiment, the model animal is, but is not limited to, a cotton rat, a mouse, or a monkey. The titer of the virus in the model animal is optionally measured at any time during the assay. In certain embodiments, a time course of viral growth in the culture is determined. If the viral growth is inhibited or reduced in the presence of the test compound, the test compound is identified as being effective in inhibiting or reducing the growth or infection of the hEbola virus. In a specific embodiment, the compound that inhibits or reduces the growth of the hEbola in the model animal is tested for its ability to inhibit or reduce the growth rate of other viruses to test its specificity for the hEbola virus.

According to the method of the invention, a human or an animal is optionally treated for for EboBun or EboIC, other viral infection or bacterial infection by administering an effective amount of an inventive therapeutic composition. Preferably, a vaccine is administered prophylactically. An “effective amount” is an amount that will induce an immune response in a subject. Illustratively, an effective amount of the compositions of this invention ranges from nanogram/kg to milligram/kg amounts for young children and adults. Equivalent dosages for lighter or heavier body weights can readily be determined. The dose should be adjusted to suit the individual to whom the composition is administered and will vary with age, weight and metabolism of the individual. The exact amount of the composition required will vary from subject to subject, depending on the species, age, weight and general condition of the subject, the particular peptide or polypeptide used, its mode of administration and the like. An appropriate amount can be determined by one of ordinary skill in the art using only routine experimentation given the teachings herein. One skilled in the art will realize that dosages are best optimized by the practicing physician or veterinarian and methods for determining dose amounts and regimens and preparing dosage forms are described, for example, in Remington’s Pharmaceutical Sciences, (Martin, E. W., ed., latest edition), Mack Publishing Co., Easton, Pa. Preferably, a single administration is operable to induce an immune response.

Methods involving conventional biological techniques are described herein. Such techniques are generally known in the art and are described in detail in methodology treatises such as Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, ed. Sambrook et al., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989; and Current Protocols in Molecular Biology, ed. Ausubel et al., Greene Publishing and Wiley-Interscience, New York, 1992 (with periodic updates). Immunological methods (e.g., preparation of antigen-specific antibodies, immunoprecipitation, and immunoblotting) are described, e.g., in Current Protocols in Immunology, ed. Coligan et al., John Wiley & Sons, New York, 1991; and Methods of Immunological Analysis, ed. Masseyeff et al., John Wiley & Sons, New York, 1992.

Embodiments of inventive compositions and methods are illustrated in the following detailed examples. These examples are provided for illustrative purposes and are not considered limitations on the scope of inventive compositions and methods.

EXAMPLES Example 1 Newly Discovered Ebola Virus Associated with Hemorrhagic Fever Outbreak in Bundibugyo, Uganda

In late November 2007 HF cases were reported in the townships of Bundibugyo and Kikyo in Bundibugyo District, Western Uganda (FIG. 1A). These samples were assayed as described by Towner, J S, et al., PLoS Pathog, 2008 November; 4(11): e1000212, the contents of which are incorporated herein by reference for methods, results, reagents, and all other aspects of the publication. A total of 29 blood samples were initially collected from suspect cases and showed evidence of acute ebolavirus infection in eight specimens using a broadly reactive ebolavirus antigen capture assay known to cross-react with the different ebolavirus species’ and an IgM capture assay based on Zaire ebolavirus reagents (Table 1). These specimens were negative when initially tested with highly sensitive real-time RT-PCR assays specific for all known Zaire and Sudan ebolaviruses and marburgviruses. However, further evidence of acute ebolavirus infection was obtained using a traditionally less sensitive (relative to the real-time RT-PCR assays) but more broadly reactive filovirus L gene-specific RT-PCR assay (1 specimen) (Table 1). Sequence analysis of the PCR fragment (400 bp of the virus L gene) revealed the reason for the initial failure of the real-time RT-PCR assays, as the sequence was distinct from that of the 4 known species of ebolavirus, although distantly related to Côte d’Ivoire ebolavirus. In total, 9 of 29 specimens showed evidence of ebolavirus infection, and all tests were negative for marburgvirus (data not shown).

Approximately 70% of the virus genome was rapidly sequenced from total RNA extracted from a patient serum (#200706291) using a newly established metagenomics pyrosequencing method (454 Life Sciences) which involves successive rounds of random DNA amplification8. Using the newly derived draft sequence, a real-time RT-PCR assay specific for the NP gene of this virus was quickly developed and evaluated. The assay was shown to have excellent sensitivity (Table 1), finding positive all the initial six samples that tested positive by either virus antigen capture (five specimens) or virus isolation assays (four specimens). The antigen-capture, IgM, IgG and newly designed real-time PCR assays were quickly transferred to the Uganda Virus Research Institute during the course of the outbreak to facilitate rapid identification and isolation of Ebola cases in the affected area for efficient control of the outbreak. The outbreak continued through late December 2007, and resulted in 149 suspected cases and 37 deaths9.

Table 1. Ebolavirus diagnostic results of initial 29 specimens obtained from Bundibugyo District with numerical specimen numbers assigned. RT-PCR refers to results obtained from conventional PCR using the broadly reactive Filo A/B primers13. Ag, IgM, and IgG refer to results from ELISA-based assays10, 11 with Zaire ebolavirus reagents while virus isolation refers to culture attempts on Vero E6 cells’2. Q-RT-PCR refers to results obtained using the optimized Bundibugyo ebolavirus specific real-time RT-PCR assay with cycle threshold (Ct) values of positive (Pos) samples indicated in the far right column. * Specimen #200706291 is the clinical sample from which prototype isolate #811250 was obtained.

 

TABLE 1
Sample RT- Virus Q- RT-
No. PCR Ag IgM IgG Isolation PCR Ct
200706288 neg neg neg neg neg neg 40
200706289 neg neg neg neg neg neg 40
200706290 neg neg neg neg neg neg 40
200706291* Pos Pos neg neg Pos Pos 23.64
200706292 neg neg neg neg neg neg 40
200706293 neg neg neg neg neg neg 40
200706294 neg neg neg neg neg neg 40
200706295 neg neg neg neg neg neg 40
200706296 neg neg Pos Pos neg neg 40
200706297 neg neg Pos Pos neg neg 40
200706298 neg Pos Pos Pos neg Pos 34.83
200706299 neg neg Pos Pos neg neg 40
200706300 neg neg neg neg neg neg 40
200706301 neg neg neg neg neg neg 40
200706302 neg Pos Pos neg neg Pos 35.01
200706303 neg neg neg neg neg neg 40
200706304 neg neg neg neg Pos Pos 38.18
200706305 neg neg neg neg neg neg 40
200706306 neg neg neg neg neg neg 40
200706307 neg neg neg neg neg neg 40
200706320 ND Pos neg neg Pos Pos 30.24
200706321 ND neg neg neg neg neg 40
200706322 ND neg neg neg neg neg 40
200706323 ND neg neg neg neg neg 40
200706324 ND neg neg neg neg neg 40
200706325 ND neg neg neg neg neg 40
200706326 ND neg neg neg neg neg 40
200706327 ND Pos neg neg Pos Pos 34.41
200706328 ND neg neg neg neg neg 40

The entire genome sequence of this virus was completed using a classic primer walking sequencing approach on RNA. The complete genome of the Eb ebolavirus was not available, so it too was derived by a similar combination of random primed pyrosequencing and primer walking approaches. Acquisition of these sequences allowed for the first time the phylogenetic analysis of the complete genomes of representatives of all known species of Ebola and Marburg viruses. The analysis revealed that the newly discovered virus differed from the four existing ebolavirus species (FIG. 1), with approximately 32% nucleotide difference from even the closest relative, EboIC (Table 2). Similar complete genome divergence (35-45%) is seen between the previously characterized ebolavirus species.

Table 2. Identity matrix based on comparisons of full-length genome sequences of Zaire ebolaviruses 1976 (Genbank accession number NC002549) and 1995 (Genbank accession number AY354458), Sudan ebolavirus 2000 (Genbank accession number NC006432), Cote d’Ivoire ebolavirus 1994 (SEQ ID NO: 10), Reston ebolavirus 1989 (Genbank accession number NC004161), and Bundibugyo ebolavirus 2007 (SEQ ID NO: 1).

 

TABLE 2
Zaire Sudan EboIC EboBun Reston
’95 ’00 ’94 ’07 ’89
Zaire ’76 .988 .577 .630 .632 .581
Zaire ’95 .577 .631 .633 .581
Sudan ’00 .577 .577 .609
EboIC ’94 .683 .575
EboBun ’07 .576

The material and information obtained from the discovery of the new unique virus EboBun and the realization that together with EboIC these viruses represent a Glade of Bundibungyo-Ivory Coast Ebola virus species is valuable, and makes possible the development of clinical, diagnostic and research tools directed to human hEbola infection.

Material and Methods

Ebolavirus Detection and Virus Isolation.

Several diagnostic techniques were used for each sample: (i) antigen capture, IgG, and IgM assays were performed as previously described11 (ii) virus isolation attempts were performed on Vero E6 cells’2 and monitored for 14 days; (iii) RNA was extracted and tested for Zaire16 and Sudan ebolavirus and marburgvirus4 using real-time quantitative RT-PCR assays designed to detect all known species of each respective virus species the primers/probe for the Sudan ebolavirus assay were EboSudBMG 1(+) 5′-GCC ATG GIT TCA GGT TTG AG-3′ (SEQ ID NO: 21), EboSudBMG 1(−) 5′-GGT IAC ATT GGG CAA CAA TTC A-3′ (SEQ ID NO: 22) and Ebola Sudan BMG Probe 5′FAM-AC GGT GCA CAT TCT CCT TTT CTC GGA-BHQ1 (SEQ ID NO: 23)]; (iv) the conventional RT-PCR was performed with the filo A/B primer set as previously described16 using Superscript III (Invitrogen) according to the manufacturer’s instructions. The specimen 200706291 was selected as the reference sample for further sequence analysis.

Genome Sequencing.

Pyrosequencing was carried out utilizing the approach developed by 454 Life Sciences, and the method described by Cox-Foster et al.8 Subsequent virus whole genome primer walking was performed as previously described17 but using the primers specific for Bundibugyo ebolavirus RT-PCR amplification. In total, the entire virus genome was amplified in six overlapping RT-PCR fragments (all primers listed 5′ to 3′): fragment A (predicted size 2.7 kb) was amplified using forward-GTGAGACAAAGAATCATTCCTG (SEQ ID NO: 24) with reverse-CATCAATTGCTCAGAGATCCACC (SEQ ID NO: 25); fragment B (predicted size 3.0 kb) was amplified using forward-CCAACAACACTGCATGTAAGT (SEQ ID NO: 26) with reverse-AGGTCGCGTTAATCTTCATC (SEQ ID NO: 27); fragment C (predicted size 3.5 kb) was amplified using forward-GATGGTTGAGTTACTTTCCGG (SEQ ID NO: 28) with reverse-GTCTTGAGTCATCAATGCCC (SEQ ID NO: 29); fragment D (predicted size 3.1 kb) was amplified using forward-CCACCAGCACCAAAGGAC (SEQ ID NO: 30) with reverse-CTATCGGCAATGTAACTATTGG (SEQ ID NO: 31); fragment E (predicted size 3.4 kb) was amplified using forward-GCCGTTGTAGAGGACACAC (SEQ ID NO: 32) with reverse-CACATTAAATTGTTCTAACATGCAAG (SEQ ID NO: 33) and fragment F (predicted size 3.5 kb) was amplified using forward-CCTAGGTTATTTAGAAGGGACTA (SEQ ID NO: 34) with reverse-GGT AGA TGT ATT GAC AGC AAT ATC (SEQ ID NO: 35).

The exact 5′ and 3′ ends of Bundibugyo ebolavirus were determined by 3′ RACE from virus RNA extracted from virus infected Vero E6 cell monolayers using TriPure isolation reagent. RNAs were then polyadenylated in vitro using A-Plus poly(A) polymerase tailing kit (Epicenter Biotechnologies) following the manufacturer’s instructions and then purified using an RNeasy kit (Qiagen) following standard protocols. Ten microliters of in vitro polyadenylated RNA were added as template in RT-PCR reactions, using SuperScript III One-Step RT-PCR system with Platinum Taq High Fidelity (Invitrogen) following the manufacturer’s protocol. Two parallel RT-PCR reactions using the oligo(dT)-containing 3′RACE-AP primer (Invitrogen) mixed with 1 of 2 viral specific primers, Ebo-U 692(−) ACAAAAAGCTATCTGCACTAT (SEQ ID NO: 36) and Ebo-V18269(+) CTCAGAAGCAAAATTAATGG (SEQ ID NO: 37), generated ˜700 nt long fragments containing the 3′ ends of either genomic and antigenomic RNAs. The resulting RT-PCR products were analyzed by agarose electrophoresis, and DNA bands of the correct sizes were purified using QIAquick Gel Extraction Kit (Qiagen) and sequenced using standard protocols (ABI).

The nucleotide sequence of the Côte d’Ivoire ebolavirus (EboIC) isolate RNA was initially determined using the exact same pyrosequencing strategy as that used for Bundibugyo ebolavirus described above. This method generated sequence for approximately 70% of the entire genome. This draft sequence was then used to design a whole genome primer walking strategy for filling any gaps and confirming the initial sequence. The following Côte d’Ivoire ebolavirus-specific primers were used to generate RT-PCR fragments, designated A-F, as follows: Fragment A (predicted size 3.0 kb) was amplified using forward-GTGTGCGAATAACTATGAGGAAG (SEQ ID NO: 38) and reverse-GTCTGTGCAATGTTGATGAAGG (SEQ ID NO: 39); Fragment B (predicted size 3.2 kb) was amplified using forward-CATGAAAACCACACTCAACAAC (SEQ ID NO: 40) and reverse-GTTGCCTTAATCTTCATCAAGTTC (SEQ ID NO: 41); Fragment C (predicted size 3.0 kb) was amplified using forward-GGCTATAATGAATTTCCTCCAG (SEQ ID NO: 42) and reverse-CAAGTGTATTTGTGGTCCTAGC (SEQ ID NO: 43); fragment D (predicted size 3.5 kb) was amplified using forward-GCTGGAATAGGAATCACAGG (SEQ ID NO: 44) and reverse-CGGTAGTCTACAGTTCTTTAG (SEQ ID NO: 45); fragment E (predicted size 4.0 kb) was amplified using forward-GACAAAGAGATTAGATTAGCTATAG (SEQ ID NO: 46) and reverse-GTAATGAGAAGGTGTCATTTGG (SEQ ID NO: 47); fragment F (predicted size 2.9 kb) was amplified using forward-CACGACTTAGTTGGACAATTGG (SEQ ID NO: 48) and reverse-CAGACACTAATTAGATCTGGAAG (SEQ ID NO: 49); fragment G (predicted size 1.3 kb) was amplified using forward-CGGACACACAAAAAGAAWRAA (SEQ ID NO: 50) and reverse-CGTTCTTGACCTTAGCAGTTC (SEQ ID NO: 51); and fragment H (predicted size 2.5 kb) was amplified using forward-GCACTATAAGCTCGATGAAGTC (SEQ ID NO: 52) and reverse-TGGACACACAAAAARGARAA (SEQ ID NO: 53). A gap in the sequence contig was located between fragments C and D and this was resolved using the following primers to generate a predicted fragment of 1.5 kb: forward-CTGAGAGGATCCAGAAGAAAG (SEQ ID NO: 54) and reverse-GTGTAAGCGTTGATATACCTCC (SEQ ID NO: 55). The terminal ˜20 nucleotides of the sequence were not experimentally determined but were inferred by comparing with the other known Ebola genome sequences.

Bundibugyo ebolavirus Real-Time RT-PCR Assay.

The primers and probe used in the Bundibugyo ebolavirus specific Q-RT-PCR assay were as follows: EboU965(+): 5′-GAGAAAAGGCCTGTCTGGAGAA-3′ (SEQ ID NO: 56), EboU1039(−): 5′-TCGGGTATTGAATCAGACCTTGTT-3′ (SEQ ID NO: 57) and EboU989 Prb: 5′Fam-TTCAACGACAAATCCAAGTGCACGCA-3′BHQ1 (SEQ ID NO 58). Q-RT-PCR reactions were set up using Superscript III One-Step Q-RT-PCR (Invitrogen) according to the manufacturer’s instructions and run for 40 cycles with a 58° C. annealing temperature.

Phylogenetic Analysis.

Modeltest 3.718 was used to examine 56 models of nucleotide substitution to determine the model most appropriate for the data. The General Time Reversible model incorporating invariant sites and a gamma distribution (GTR+I+G) was selected using the Akaike Information Criterion (AIC). Nucleotide frequencies were A=0.3278, C=0.2101, G=0.1832, T=0.2789, the proportion of invariant sites=0.1412, and the gamma shape parameter=1.0593. A maximum likelihood analysis was subsequently performed in PAUP*4.0b1019 using the GTR+I+G model parameters. Bootstrap support values were used to assess topological support and were calculated based on 1,000 pseudoreplicates20.

In addition, a Bayesian phylogenetic analysis was conducted in MrBayes 3.221 using the GTR+I+G model of nucleotide substitution. Two simultaneous analyses, each with four Markov chains, were run for 5,000,000 generations sampling every 100 generations. Prior to termination of the run, the AWTY module was used to assess Markov Chain Monte Carlo convergence to ensure that the length of the analysis was sufficient22. Trees generated before the stabilization of the likelihood scores were discarded (burn in =40), and the remaining trees were used to construct a consensus tree. Nodal support was assessed by posterior probability values (>95=statistical support).

Example 2 Immunization against EboBun

To determine the capability of immunogens to elict an immune response in non-human primates (NHP), 12 cynomolgus macaques, of which 10 are immunized with VSVΔG/EboBunGP either orally (OR; n=4), intranasally (IN; n=4) or intramuscularly (IM; n=2) in accordance with all animal control and safety guidelines and essentially as described by Qiu, X, et al., PLoS ONE. 2009; 4(5): e5547. The remaining 2 control animals are vaccinated intramuscularly with VSVΔG/MARVGP. VSVΔG/MARVGP does not provide heterologous protection against EboBun, therefore these NHPs succumb to EboBun infection. Animals are acclimatized for 14 days prior to infection. Animals are fed and monitored twice daily (pre- and post-infection) and fed commercial monkey chow, treats and fruit. Husbandry enrichment consists of commercial toys and visual stimulation.

The recombinant VSVΔG/EboBun vaccines are synthesized expressing the EboBun glycoprotein (GP) (SEQ ID NO: 9), soluble glycoprotein (sGP) (SEQ ID NO: 4), or nucleoprotein (NP) (SEQ ID NO: 3). Control VSVΔG/MARVGP vaccines represent the analogous proteins from Lake victoria marburgvirus (MARV) (strain Musoke). The following results for GP are similar for sGP and NP. Vaccines are generated using VSV (Indiana serotype) as described previously. Garbutt, M, et al., J Virol, 2004; 78(10):5458-5465; Schnell, M J, et al., PNAS USA, 1996; 93(21):11359-11365. EboBun challenge virus is passaged in Vero E6 cells prior to challenge, as described previously Jones, S M, et al., Nat Med, 2005; 11(7):786-790; Jahrling, P B, et al., J Infect Dis, 1999; 179 (Suppl 1):S224-34. An EboBun immunogen peptide pool consisting of 15mers with 11 amino acid overlaps (Sigma-Genosys) spanning the entire sequence of the EboBun immunogens and strain Mayinga 1976 GP are used.

Twelve filovirus naïve cynomolgus monkeys randomized into four groups receive 2 ml of 1×107 PFU/ml of vaccine in Dulbecco’s modified Eagle’s medium (DMEM). Animals in the three experimental groups are vaccinated with either: 1) 2 ml orally (OR) (n=4); 2) 1 ml dripped into each nostril, intranasally (IN) (n=4); or 3) 1 ml each into two sites intramuscularly (IM) (n=2). The two controls are injected intramuscularly with 2 ml of 1×107 PFU/ml of VSVΔG/MARVGP. All animals are challenged intramuscularly 28 days later with 1,000 PFU of EboBun.

Routine examination is conducted on 0, 2, 4, 6, 10, 14 and 21 days post-vaccination, then 0, 3, 6, 10, 14, 19, 26 days, 6 and 9 months after the EboBun challenge. For the examinations animals are anaesthetized by intramuscular injection with 10 mg/kg of ketaset (Ayerst). Examinations include haematological analysis, monitoring temperature (rectal), respiration rate, lymph nodes, weight, hydration, discharges and mucous membranes. Also, swabs (throat, oral, nasal, rectal, vaginal) and blood samples are collected (4 ml from femoral vein, 1 ml in EDTA vacutainer tube; 3 ml in serum separator vacutainer tube). Cynomolgus monkey PBMCs are isolated using BD CPT sodium citrate Vacutainers (Becton Dickinson) as per manufacturer’s protocol.

All VSVΔG/EboBunGP immunized animals are protected from high dose challenge. These animals show no evidence of clinical illness after vaccination or EboBun challenge. Both control animals demonstrate typical symptoms associated with EboBun HF including fever, macular rashes, lethargy, and unresponsiveness. Continued infection requires euthanization. Hematology analyses at each examination date demonstrate increases in the platelet-crit in the OR and IN groups post-challenge, however, no significant changes are observed in any NHPs post-immunization or in the VSVΔG/EboBunGP immunized NHPs post-challenge.

EboBun antibody production from humoral antibody response to vaccination and challenge is examined by a virus like particle (VLP) based ELISA assay. Generation of EboBun VLPs is performed by the protocol for ZEBOV as described by Wahl-Jensen, V., et al., J Virol, 2005; 79(4):2413-2419. ELISA is performed by the protocol described by Qiu, X, et al., PLoS ONE. 2009; 4(5): e5547.

The VSVΔG/MARVGP immunized animals do not develop a detectable antibody response to EboBun. In contrast, potent antibody responses are detected in all VSVΔG/EboBunGP immunized animals independent of immunization route. Between days 14 and 21 post-vaccination, all VSVΔG/EboBunGP immunized NHPs develop high levels of IgA, IgM, and IgG against EboBunGP. After challenge the IgM titres do not exceed the post-vaccination levels, however, IgG and IgA antibody titres are increased peaking 14 days post-challenge then slowly decreasing before maintaining a relatively high antibody titre up to 9 months.

The level of neutralization antibodies is detected by a EboBun-GFP flow cytometric neutralization assay in serum collected at days 0 and 21 post-vaccination. Samples are assayed in duplicate for their ability to neutralize an infection with EboBun-GFP in VeroE6 cells. Serially diluted serum samples are incubated with an equal volume of EboBun-GFP in DMEM, at 37° C., 5% CO2 for 1 hr followed by addition of 150 μl per well of a confluent 12 well plate of VeroE6 cells (MOI=0.0005). After 2 hours at 37° C., 5% CO2, 1 ml of DMEM, 2% fetal bovine serym (FBS), 100 U/ml penicillin, 100 μg/ml streptomycin is added per well and incubated for 5 days. Cells are harvested by removing the culture supernatant, washing with 1 ml PBS, 0.04% EDTA, then adding 800 μl of PBS 0.04% EDTA for 5 minutes at 37° C. before adding 8 ml PBS, 4% paraformaldehyde (PFA) and overnight incubation. The cells are acquired (10,000 events) and analyzed with CellQuest Pro v3.3 on a Becton Dickinson FACSCalibur flow cytometer.

The OR and IN routes produce EboBunGP-specific neutralizing antibodies with the OR route producing the highest titres post-vaccination. The IM immunization produces detectable levels of neutralizing antibody. In comparison, 3/4 NHPs in the OR group demonstrate a 50% reduction in EboBun-GFP positive cells at a titre of 1:40. Similarly, the IN route results in a reduction of EboBun-GFP positive cells at the 1:40 dilution.

EboBunGP-specific effector cellular immune responses are determined using IL-2 and IFN-γ ELISPOT assays as described by Qin, X, et al., PLoS ONE. 2009; 4(5): e5547 to determine the number of IL-2 and IFN-γ secreting lymphocytes. Prior to challenge on days 10 to 14 post-vaccination there is a detectable EboBun immunogen-specific IFN-γ response in all immunized animals. The IM route is the most potent, inducing approximately 2-fold more IFN-γ secreting cells than OR (p<0.001) or IN (p=0.043) routes. A strong post-challenge secondary IFN-γ response is induced in all VSVΔG/EboBun immunized animals with the IM route producing the most IFN-γ cells at day 6. By day 10 the OR group demonstrates a stronger response. The IFN-γ in the IN group rises steadily, peaking at day 26 post-challenge with 4.3 and 2 fold more EboBun specific IFN-γ secreting cells than the IM (p=0.003) and OR (p=0.075) group, respectively. All three routes produce strong EboBun-specific IFN-γ responses.

Post-vaccination, the IM group also has more EboBunGP-specific IL-2 secreting cells than either of the mucosally immunized groups. Post-challenge, the IM route continues to dominate early after challenge peaking on day 10. This difference shows a trend when compared to the IN group (p=0.067) and is significant when compared to the OR group (p<0.001). Additionally, the IN group has more IL-2 producing cells than the OR group (p=0.090) on day 10 post-challenge. By day 26 post-challenge all three routes continue to produce a EboBunGP-specific IL-2 response, however, the IN group response is strongest. At day 26 post-challenge the IN group has the most potent IFN-γ and IL-2 responses, as well as the highest IgA and IgG antibody titre, indicating this immunization route, followed by a EboBun challenge, results in the development of potent and sustained effector responses.

Absolute lymphocyte numbers for CD3+, CD4+, and CD8+ (CD3+4) T cell populations are determined by flow cytometry. No decrease is observed in the lymphocyte populations for any of the VSVΔG/EboBunGP vaccinated NHPs. In contrast, control animals who are not protected from EboBun show lymphocyte numbers decreased by 28-57%.

Macrophage numbers are slightly increased in control animals. However, the number of CD14+ cells is greater in the VSVΔG/EboBunGP vaccinated groups with the IM route showing the most significant increases.

In order to determine the long term immune response after challenge, EboBunGP-specific CD4+ and CD8+ memory T-lymphocytes are examined for their ability to proliferate (CFSE) or produce IFN-γ in response to EboBunGP peptides at 6 months post-vaccination. EboBunGP-specific memory responses are observed as a result of vaccination followed by a ZEBOV challenge. These responses persist for at least 6 months. The memory populations in OR and IN inoculation routes demonstrate the greatest potential for proliferation and IFN-γ production post-challenge.

Any patents or publications mentioned in this specification are incorporated herein by reference to the same extent as if each individual publication is specifically and individually indicated to be incorporated by reference.

The compositions and methods described herein are presently representative of preferred embodiments, exemplary, and not intended as limitations on the scope of the invention. Changes therein and other uses will occur to those skilled in the art. Such changes and other uses can be made without departing from the scope of the invention as set forth in the claims. All numerical ranges are inclusive of the whole integers and decimals between the endpoints, and inclusive of the endpoints.

REFERENCES

 

  • 1. Suzuki, Y., and Gojobori, T., (1997) The origin and evolution of Ebola and Marburg viruses. Mol Bio Evol, 14(8): 800-806.
  • 2. Sanchez, A., Geisbert, T. W., Feldmann, H. in Fields Virology (ed. Knipe, D. M., Howley, P. M.) 1409-1448 (Lippincott Williams and Wilkins, Philadelphia, 2007).
  • 3. Leroy, E. M. et al., (2005) Fruit bats as reservoirs of Ebola virus. Nature, 438, 575-6.
  • 4. Towner, J. S. et al., (2007) Marburg virus infection detected in a common African bat. PLoS ONE, 2(8), e764.
  • 5. Swanepoel, R. et al., (2007) Studies of reservoir hosts for Marburg virus. Emerg Infect Dis, 13(12), 1847-51.
  • 6. Le Guenno, B. et al., (1995) Isolation and partial characterization of a new species of Ebola virus. Lancet, 345(8960), 1271-4.
  • 7. Ksiazek, T. G. et al. (1999) Clinical virology of Ebola hemorrhagic fever (EHF): virus, virus antigen, IgG and IgM antibody findings among EHF patients in Kikwit, 1995. J. Infect Dis 179 (suppl 1), S177-S187.
  • 8. Cox-Foster, D. L. et al. (2007) A metagenomic survey of microbes in honey bee colony collapse disorder. Science 318, 283-7.
  • 9. World Health Organization (2008) Ebola outbreak contained in Uganda. Features, 22 February, www.who.int/features/2008/ebola_outbreak/en/.
  • 10. Sullivan, N. J., Sanchez, A., Rollin, P. E., Yang, Z.-Y. & Nabel, G. J. (2000) Development of a preventive vaccine for Ebola virus infection in primates. Nature 408, 605-609.
  • 11. Ksiazek, T. G., West, C. P., Rollin, P. E., Jahrling, P. B. & Peters, C. J. (1999) ELISA for the detection of antibodies to Ebola viruses. J. Infect Dis 179 (suppl 1), S191-S198.
  • 12. Rodriguez, L. et al. (1999) Persistence and genetic stability of Ebola virus during the outbreak in Kikwit, Zaire 1995. J. Infect Dis 179 (suppl 1), S170-S176.
  • 13. Sanchez, A. et al. Detection and molecular characterization of Ebola viruses causing disease in human and nonhuman primates. J. Infect Dis 179 (suppl 1), S164-S169 (1999).
  • 14. Jones, S. M. et al. (2005) Live attenuated recombinant vaccine protects nonhuman primates against Ebola and Marburg viruses. Nat Med 11, 786-90.
  • 15. Geisbert, T. W. et al. (2008) Recombinant vesicular stomatitis virus vector mediates postexposure protection against Sudan Ebola hemorrhagic fever in nonhuman primates. J Virol 82, 5664-8.
  • 16. Towner, J. S., Sealy, T. K., Ksiazek, T. & Nichol, S. T. (2007) High-throughput molecular detection of hemorrhagic fever virus threats with applications for outbreak settings. J. Inf Dis 196 (suppl 2), S205-212.
  • 17. Towner, J. S. et al. (2006) Marburgvirus genomics and association with a large hemorrhagic fever outbreak in Angola. J Virol 80, 6497-516.
  • 18. Posada, D. & Crandall, K. A. (1998) MODELTEST: testing the model of DNA substitution. Bioinformatics 14, 817-818.
  • 19. Swofford, D. L. (2002) PAUP*: phylogenetic analysis using parsimony (*and other methods) version 4.0b10. Sinauer Assoc., Sunderland, Mass.
  • 20. Felsenstein, J. (1985) Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39, 783-791.
  • 21. Ronquist, F. & Huelsenbeck, J. P. (2003) MRBAYES 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19, 1572-1574.
  • 22. Nylander, J. A. A., Wilgenbusch, J. C., Warren, D. L. & Swofford, D. L. (2008) AWTY (are we there yet?): a system for graphical exploration of MCMC convergence in Bayesian phylogenetics. Bioinformatics 24, 581-583.
Patent Citations
Cited Patent Filing date Publication date Applicant Title
US20010053519 * Mar 6, 2000 Dec 20, 2001 Fodor Stephen P.A. Nucleotide sequences for use as tool in genetic engineering
WO2009128867A2 * Jan 7, 2009 Oct 22, 2009 Warf – Wisconsin Alumni Research Foundation Recombinant biologically contained filovirus
* Cited by examiner
Non-Patent Citations
Reference
1 * Ebihara et al. Journal of Infectious Diseases 196:S313-22, 2007
2 * Genbank AF086833.2
3 * GenBank FJ217162.1, 21 Nov 2008
4 * Le Guenno et al (Lancet 345:1271-74, 1995)
5 * Neumann et al. Journal of Virology 76:406-410, 2002
6 * Sanchez et al (Virus Research 113:16-25, 2005)
7 * Towner et al (Virology 332:20-27, 2005)
8 * Warfield et al (Journal of Infectious Diseases 196:S276-283, 15 Nov. 2007),
* Cited by examiner
Classifications
U.S. Classification 424/93.6, 530/325, 435/236, 530/330, 530/327, 435/235.1, 530/350, 530/328, 514/1.1, 530/324, 514/44.00R, 536/23.72, 530/326, 530/329
International Classification A61K38/02, A61K31/7088, C07H21/04, C07K7/06, C12N7/04, A61K35/76, C07H21/02, C12N7/00, C07K14/08, C07K7/08
Cooperative Classification C07K16/10, G01N33/56983, C12N7/00, C12N2760/14145, C07K2316/96, C12N2810/6072, C12N2760/14143, A61K39/12, A61K2039/53, A61K2039/5256, G01N2333/08
European Classification A61K39/12, C07K16/10, G01N33/569K, C12N7/00
Legal Events
Date Code Event Description
Apr 25, 2011 AS Assignment
Owner name: THE GOVERNMENT OF THE UNITED STATES OF AMERICA AS
Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:TOWNER, JONATHAN S.;NICHOL, STUART T.;COMER, JAMES A.;AND OTHERS;SIGNING DATES FROM 20110415 TO 20110425;REEL/FRAME:026177/0586

As Canada hits Russia with a new package of sanctions targeting Russian military officials, defense companies and the largest state-owned bank, political analyst Prof. Michel Chossudovsky believes the country is simply copying the policy of the US towards Moscow and adds that it is mostly a move to curry favor in the polls with the country’s Ukrainian diaspora.

“I think that there are essentially two elements here,” he told Radio VR.

“One pertains to the fact that in recent years, particularly under the government of Prime Minister Harper, Canadian foreign policy is a ‘copy and paste’ of that of Washington. Essentially, there is an agreement on basic principles. The US and Canada have integrated military commands, the two economies are heavily integrated and the corporate elites overlap with one another.”

“That’s the first element,” he added.

“The second has to do with the 1.2 million Ukrainians, or people of Ukrainian descent, who are largely concentrated in the western provinces – [such as] Manitoba.”

“And this, from the point of view of Prime Minister Stephen Harper, is an important source of political support in forthcoming elections and he has played on that,”

said Prof. Chossudovsky.

“But at the same time, that Ukrainian community in Canada is not necessarily aligned with the Poroshenko government. It has diverse opinions, and some people within that community are extremely critical of the ongoing processes and the Poroshenko government’s support of Nazi elements and so on.”

Prof. Chossudovsky also commented on Poroshenko’s trip abroad, including his visit to Ottawa, calling it a “public relations tour”.

“The prime minister has already promised that Canada would deploy so-called non-combat troops from the Canadian army and navy and air force,” he said.

“Non-combat sounds a bit contradictory. [They are] to join allies in Eastern Europe and I assume they may be even deployed inside Ukraine; that is an object for discussion.”

There is a financial assistance package, added Prof. Chossudovsky, but it is not particularly significant, and it would be a loan rather than direct foreign aid.

“And I think that we are dealing with a little bit of propaganda here, with public relations. Poroshenko is on a public relations tour.  And I think most of these positions taken by the Ottawa government are formulated in liaison with the US State Department.”

Women hold posters of hunger striking Palestinian prisoners outside the Red Cross offices in Jerusalem in June. (Saeed Qaq / APA images)

This past summer, as Israeli weapons deindustrialized Gaza and decimated its civilians, leftist publications in Latin America began circulating a 2012 essay by the renowned Uruguayan writer Eduardo Galeano. Writing in the wake of Israel’s November 2012 onslaught in Gaza, Galeano lamented the “erasing of Palestine from the map.” Palestinians, he wrote, “cannot breathe without permission” and “when they vote for someone who they shouldn’t, they are punished.”

For Galeano, a historian of Latin America, the 2006 election in Gaza, won by Hamas, seemed a lot like the 1932 election in El Salvador. While El Salvador’s military rulers conceded a place on the ballot for the long-marginalized Communist Party (just asGeorge W. Bush did with Hamas in 2006), they swiftly annulled the results after a Communist triumph, and within days launched a genocidal campaign targeting the party’s indigenous peasant base.

Similarly, after Bush’s “democracy promotion” elicited the “wrong” result in Gaza, the United States and Israel worked to undermine the winner of the election using a variety of methods, including orchestrating an abortive coup attempt with the Ramallah-basedPalestinian Authority. Meanwhile, Israel has continued to impose a suffocating blockadeon Gaza since 2007, which has the sadistic goal of keeping its people “on a diet” and its “economy on the brink of collapse.”

Linked plights

For Galeano and others, the respective plights of Latin Americans and Palestinians are not only linked in a fertile historical analogy — bridging the gulf of their separate oppressions is an unassailable fact.

In the second half of the twentieth century, Israel supplied repressive Latin American governments, from Guatemala to Argentina, with weapons, military transportation, intelligence equipment, counterinsurgency training and even public relations consulting.

Most notoriously, Israel kept close ties with Augusto Pinochet, the brutal Chilean general who took power during a bloody coup in 1973 with the help of the CIA. During his seventeen years of rule, Pinochet “disappeared” thousands of his citizens and committed countless human rights abuses. Throughout his reign, he benefitted from numerous shipments of Israeli weapons — and, of course, strong US backing as well.

Fewer friends

In Latin America today, Israel has far fewer friends. This reality becomes pronounced whenever it escalates the war against the population it continues to occupy.

When this happened this summer in Gaza, the now predictable pattern of destruction — the infrastructure callously destroyed, the staggering civilian casualty count — led many Latin American states to take a firm position on the Israeli attacks. (Of course, countries with close economic and military dealings with the United States — such as Colombia and Panama, which have also received arms shipments from Israel in recent years —were not among them.)

The procession of countries standing up for Palestinians was impressive. In late July, Bolivian President Evo Morales declared Israel “a terrorist state.”

Brazil, Ecuador, Chile, Peru and El Salvador withdrew their ambassadors from Tel Aviv, and the president of Argentina joined the heads of state of Brazil, Venezuela and Uruguay in issuing a “special communiqué” condemning Israel’s “disproportionate use of force.”

Cuba, a country which ruptured diplomatic relations with Israel in 1973, is perhaps the most vocal critic of Zionism in the hemisphere. In 1959, iconic guerrilla leader Che Guevara led a Cuban solidarity envoy to Gaza soon after the triumph of the Cuban revolution. In August of this year, former Cuban President Fidel Castro penned a columnin the country’s state newspaper titled “The Palestinian Holocaust in Gaza.” These are just a sampling of the latest pushes in Latin America to isolate Israel for its gross mistreatment of Palestinians.

Assertive diplomacy

This assertive diplomacy has a counterpart in the region’s press. Depictions of Palestinian suffering by Latin American journalists are not diluted by the lurking Israel-slanted bias of many US outlets.

While this summer The New York Times published a rash of articles full of false equivalencies and talk of “both sides” (for example, “Pause in the fighting gives civilians on both sides a moment to take stock” and “Neighborhood ravaged on deadliest day so far for both sides in Gaza”), the most common headline accompanying Latin American TV and newspaper reportage of this topic was “El Infierno de Gaza” — “The Gaza Hell.”

Press accounts, free of cant, honestly illuminating the degradations of Palestinian life, have helped an array of pro-Palestinian social movements in Latin America galvanize members of civil society. When coordinated protests against Israeli massacres in Gaza erupted across six continents on 26 July, Latin American cities exhibited some of the largest among them.

Heritage and history

Latin America as a whole hosts the largest population of diaspora Arabs in the world, a community dating back primarily to the late nineteenth and early twentieth centuries. This group has certainly played a prominent role in Palestinian solidarity efforts in the region. Chile, for instance, a country with half a million citizens with Palestinian lineage, has a Chile-Palestine Inter-Parliamentary Group comprising nearly 40 percent of parliament.

While commentators are right to point to the sizable Arab presence in Latin America when explaining the magnitude of its Palestinian solidarity, this element should not be overstated. Indeed, the links connecting the narratives of Latin American and Palestinian disenfranchisement transcend the particularities of a shared ethnicity.

One example of this link came in 2008 when Chilean President Michelle Bachelet granted 117 Palestinian refugees asylum in her country. During the welcoming ceremony, she compared her own experience of exile during the reign of Pinochet to the plights of displaced Palestinians. “I want to tell you that I know exactly how it feels to be a refugee in a strange country,” she said. “I know it because I lived that, I also was a refugee.”

This remark was no doubt intended to resonate with Chile’s Palestinians, whose participation in the country’s politics through elections and lobbying groups like the Palestine Federation of Chile is by no means negligible. Nevertheless, it also reflects a sense of solidarity that can be perceived across the region. One need only look at places like Bolivia, Cuba and Uruguay — countries with relatively small populations of Arab descendants — where support for Palestine is no less robust than in neighboring nations.

Nuisance to the powerful

One of the most brutal of the US and Israel-backed dictatorships in Latin America was the military junta that ruled Argentina from the mid-1970s into the early 1980s.

Despite “disappearing” as many as 30,000 of its people, torturing many others and eradicating all political parties and independent media, the regime received a green lightfor its “dirty war” against opponents from US Secretary of State Henry Kissinger. Later, it enjoyed a tight partnership with US President Ronald Reagan.

In Argentina, all dissent was repressed and a culture of fear prevailed. And yet, a protest movement based in the Plaza de Mayo — the historical epicenter of popular struggle in Argentina — eventually did take hold. It was led by a group of mothers whose daughters and sons were victims of the dictatorship. This group, named the Mothers of the Plaza de Mayo, staged weekly demonstrations beginning in the latter half of the regime’s tenure.

Every Thursday, the mothers marched somberly in the plaza, white handkerchiefs covering their heads, holding photos of their missing children. Through their highly visible actions, the mothers challenged and ultimately destroyed the dictatorship’s grip on power.

After the fall of military rule in Argentina, the mothers maintained their presence in the public sphere, continuing to demand official accountability for the state terrorism they personally endured, while also lending their support to a myriad of leftist causes. Today, they still gather each week in the Plaza de Mayo.

On a Thursday afternoon in mid-August, the mothers rallied together with Palestinian activists. The two groups began by forming a circle and took turns addressing the crowd on their overlapping causes. Both spoke of los desaparecidos, the disappeared. While this term is most commonly used by Latin Americans to describe a specific phenomenon — the victims of the violent regimes, plaguing their continent in the twentieth century — in this setting, the phrase was generalized.

Here, Palestinians were eulogized among the disappeared, their identities and voices beyond the bounds of state-sanctioned respectability, their very existence a nuisance to the powerful. To be a Palestinian, they declared, is similar to being a leftist in Argentina in the 1970s and ’80s. The women donning headscarves, clutching pictures of their long-deceased children, stood adjacent to the activists wearing kuffiyehs — Palestinian checkered scarves — hoisting signs with images of children killed in Gaza.

The moment of silence came at the end. Heads tilted downward with solemnity. The dead were mourned — all of them.

Andrew Klein is a freelance reporter currently filing for KPFA News from Buenos Aires. He has traveled extensively in Palestine and spent three months last year working in Shatila, a Palestinian refugee camp in Beirut.

“Pilegaarden” (Willow Farm)

Healthier, more productive pigs, more profit, and much less birth deformities; an important lesson for all farmers not to use GMO feed or glyphosate on their land.

I want to tell you what I have seen on my farm and about the on-farm and lab investigations carried out in collaboration with Professor Monika Krüger and other scientists.

My farm – ‘Pilegaarden’ – which translates as ‘Willow Farm’ – is an average Danish farm in the small village of Hvidsten. Our pigs are raised accordingly to United Kingdom regulations for pig housing, and exported to the UK for consumption.

Inside the pig farm is a straw-based system for the sows as well as a standard farrowing house.

I had read about the effects that GM feed has on rats in lab experiments (see [1] GM Soya Fed Rats: Stunted, Dead, or SterileSiS 33), so I decided to change the feed from GM to non-GM soy in April 2011 without telling the herdsman on the farm.

Instant benefits from non-GMO soy

Two days afterwards, he said to me: “You have changed the food.” He always notices whenever there is any problem with the feed and tells me. This time was different. Something very good was happening with the food as the pigs were not getting diarrhoea any more.

The farm was using two thirds less medicine, saving £7.88 per sow. Not just my farm but three other farms in Denmark that switched from GMO to non GMO feed have also seen the same.

Medication after the changeover in the weaners barn also went down dramatically by 66%. One type of antibiotic has not been used since.

The sows have higher milk production; we can tell because the sows are suckling one, two or three more piglets and have more live born pigs, on average 1.8 piglets more per sow. They wean 1,8 pigs more per litter, and have more live born pigs.

We have seen an aggressive form of diarrhoea disappear altogether from the farm. It affected young piglets in the first week of life, killing up to 30% of the animals. It has completely gone now for over three years.

Sows no longer suffer from bloating or ulcers and they have longer productive lives, only dropping in fertility after eight litters compared to 6 on GM soy.

So, a change to non-GM soy makes the herd easier to manage, improves the health of the herd, reduces medicine usage, increases production and is very profitable.

Glyphosate toxicity

Deformities in the pigs used to be very rare and I used to be proud to send Siamese twins to schools for classes because it was a ‘one in a million’ event. But then they became frequent.

So I read a lot on the subject and my suspicion fell on glyphosate. I read how glyphosate had been shown in scientific studies (see [2] Lab Study Establishes Glyphosate Link to Birth DefectsSiS 48, [3]) to cause deformities and noted it was the same type of deformities that I was seeing in my pigs.

I also observed deformities matching those found in anencephaly babies in Washington counties in US [4] that Don Huber talked about as well as the birth defects in Argentina [5, 6] (Argentinas Roundup Human Tragedy , SiS 48), as described by Dr Medardo Avila-Vasquez where high levels of glyphosate are used.

I had looked at studies showing that a 2-day exposure to 3.07 mg/l glyphosate herbicide caused only 10% mortality but caused malformations in 55% of test animals [7].

A toxicological study in 2003 led by Dr Dallegrave [8] found bone abnormalities, absence of bones or parts of bones, shortened and bent bones, asymmetry, fusions, and clefts in rats. So, after this I began to list all the deformities I saw in my pigs.

A catalogue of deformities in piglets

I decided to be on the safe side, by listing the clear deformities that cannot be missed, like a back that is totally kinked over (see Figure 1, above right). I have pictures of all the deformed piglets, which are born alive in most cases.

One had a 180° bend in one of its vertebra. There were also deformities in the soft tissue, and one without an anus. One had kidney problems; another had its stomach outside the body. One had a cranial deformity, with no eyes and its brain outside the head; this is very typical. One had no cranium at all.

Some are even messier. There was a piglet with only one eye, and one completely headless. There was a little nose, but it had no bones to grow on so it probably would have died just after birth. We also started counting deformities of the tail, which are never fatal but are actually spinal deformities.

I sent the deformed piglets to Germany to be analysed by Krüger at Leipzig University. She opened them up and took the organs including the lungs, liver, kidneys, muscles, nervous system, intestines and heart; and she found glyphosate in all of the organs (see Box). You can see some of them in the scientific paper I published with Krüger and other scientists [9].

Figure 1   List of documented deformities observed (with Chinese translations) in piglets born to sows fed a diet containing different amounts of glyphosate. Glyphosate is present in all animal feed (except organic) due to the indiscriminate use of Roundup pre-seeding, or as desiccant; manure has Roundup residues in it and is recycled in the feed.

Glyphosate detected in malformed piglets

A total of 38 deformed Danish one-day old piglets were euthanized and the tissues analysed for glyphosate using ELISA (enzyme-linked immunosorbent assay).

All organs or tissues had glyphosate in different concentrations. The highest concentrations were seen in the lungs ((0.4-80mg/ml) and heart (0.15-80 mg/ml). The lowest were in muscles (4.4-6.4 mg/g).

Rate of malformation increased to one out of 260 born piglets if sow feeds contain 0.87-1.13 ppm glyphosate in the first 40 days of pregnancy. In case of 0.25 ppm glyphosate one out of 1,432 piglets was malformed.

These piglets showed different abnormalities as ear atrophy, spinal and cranial deformations, cranium hole in head and leg atrophy; in one piglet only a single large eye developed. Piglets without trunk, with elephant tongue, and female piglet with testes were also present.

One malformed piglet showed a swollen belly and fore gut and hind gut were not connected.

The researchers note: “Further investigations are urgently needed to prove or exclude glyphosate in malformations in piglets and other animals.”

Teratogenic dose a fraction of the regulatory allowed dose

In addition to these experiments, I had over 30,000 piglets born over two years and therefore have statistical data that are not easily available in the lab and this is where farmers have the ideal opportunity to do their own testing.

I tested the food, the foetuses, the urine and the grains that came into the farm. To do the tests, I would take representative samples from the batches of food, mix them, and take 100 grams in a plastic bag of each to be tested, or 100 ml of liquids.

When taking muck and urine for testing, you need patience. Blood tests can be done by a vet. Send it for analyses to a lab that has the facilities to test glyphosate down to about 0.1ppb = 0.1 milligram per tonne. If tests are only detecting at above 0.1ppm = 0.1 grams per ton, it cannot show you what is in urine and muck. It costs about £30-50 for one test. Tests in oils might not be possible; you need to ask beforehand.

The results of the tests showed that with 0.06 mg/kg of glyphosate residue in the feed – much lower than the allowed 20 mg/kg – I was getting cranial and spinal deformities after two months of feeding (see Figure 2, above right). At 0.1 mg/kg I was also getting deformities, but not many so that one pig could alter the numbers.

But, at 0.2 mg/kg the deformities start to go up. At the maximum dose used (but still under 12% of the maximum permitted dose) of 2.26 mg/kg the numbers start to get very high.

Figure 2   Rates of cranial and spinal deformities in pigs fed increasing levels of glyphosate in feed

Fewer piglets per litter

I also got help from Thomas Böhn from Norway who told me to look at longer intervals. We got numbers after six months to see an accumulative effect. The story is exactly the same. There is a very clear difference between low and high levels of glyphosate.

We also looked at the numbers of pigs born in each litter, which was significantly less after eating food with higher levels of glyphosate (see figure 3). We found a significant average difference of 0.95 fewer pigs born per sow when glyphosate was eaten in feed, between ‘low’ and ‘high’ intakes.

This was measured as accumulated intake of glyphosate over a 35 day period – the last five weeks of pregnancy. The ‘low’ intake was defined as under 3 mg/kg body weight, and the high intake was 3-9 mg/kg body weight.

So with glyphosate present in the feed, we have fewer births, as well as the odd ones that are deformed.

In short, a five-fold increase in glyphosate levels from 0.2 to 1 part per million (ppm) resulted in a five-fold increase in cranial and spinal deformities at birth, five times times more abortions, and 0.95 less piglets born per litter.

Glyphosate has known toxicities at extremely low concentrations

We can also relate the actual levels of glyphosate in feed to the level in the urine. So for 1,132 ppb (or 1.13 ppm), there is 44 ppb (~ 4%) in the urine and 246.33 ppb (~22%) in dung.

When I tested my own urine, I found that I had 2.58 ppb – and that is not from eating GM contaminated feed but from eating normal food from the Danish shops.

This is already at the level of higher rates of abortions and deformities and probably also fertility problems. Is this why in the Western world we have a very big problem with fertility (see [9] Glyphosate/Roundup and Human Male InfertilitySiS 62)?

And at 1,000 ppb, glyphosate is patented by Monsanto as an antibiotic, actually killing the beneficial microorganisms. At 0.1 ppb (less than 1/25 the level measured in my urine) Roundup caused tumours in 80% of rats compared to 20% in the controls [10], which only developed them at 700 days.

To have that high level of glyphosate in my urine, I must have consumed at the level of about 0.2ppm or 2,000 times more than the test rats. So what does that mean for the rates of cancer (see [11] Glyphosate and Cancer, SiS 62)?

Figure 3   Rates of liveborn per sow after consuming low and high levels of glyphosate in feed in last 5 weeks of pregnancy; the amount of glyphosate is the total summed over the last 5 weeks

I have a short film about how it is to be a farmer, I always feel very bad about my pigs getting ill so I leave the film for people to see. These same things must be happening in Chinese farms also, as they are using the same feed as I used to.

Even non-GM soya contains glyphosate and we as farmers need to demand that it is not sprayed down with glyphosate, because it can affect people as well as pigs.

To conclude

Any farmer who switches away from GMOs and Roundup will experience improved health in their herd and crops.

I know of the scientific studies on malformations due to the chemical Roundup. I know that one in 80 people in certain towns in Argentina have the same defects after being exposed to the chemical. And I know of 14 Danish people born with deformities of the same type.

Now what I have seen in my pigs makes me wonder what we are doing – not just to them but to ourselves. And it scares me.

A farmer’s task is to provide nutritious and healthy food for consumers, GMOs and Roundup provide neither. We can look back to DDT and how we thought that was healthy. That should remind us that we cannot ignore the warning signs for glyphosate.

Ib Borup Pederson is a Danish pig farmer serving the UK market, now also a scientific researcher and campaigner.

This article is based on a lecture at the 1st Forum of Development and Environmental Safety, under the theme ‘Food Safety and Sustainable Agriculture 2014′, 25 – 26 July 2014, Beijing. It was originally published by the Institute for Science and Society.

References

  1. Ho MW. GM soya fed rats: stunted, dead or sterile. Science in Society 33, 4-6, 2007.
  2. Ho MW. Lab study establishes glyphosate link to birth defects. Science in Society 48, 32-33, 2010.
  3. Antoniou M. Habib MEM, Howard CV, Jennings RC, Leifert C, Nodari RO, Robinson CJ and Fagan J. Teratogenic effects of glyphosate-based herbicides: divergence of regulatory decisions from scientific evidence. J Environ Anal Toxicol 2012, S4, 006, doi:10,4172/2161-0525.S4-006.http://omicsonline.org/teratogenic-effects-of-glyphosate-based-herbicides-divergence-of-regulatory-decisions-from-scientific-evidence-2161-0525.S4-006.php?aid=7453
  4. Anencephaly Investigation, Washington State Department of Health, accessed 5 September 2014, http://www.doh.wa.gov/YouandYourFamily/IllnessandDisease/BirthDefects/AnencephalyInvestigation
  5. “Birth defects, cancer in Argentina linked to agrochemicals: AP investigation”, Michael Warren and Natacha Pisarenko, The associated Press, 20 October 2013,http://www.ctvnews.ca/health/birth-defects-cancer-in-argentina-linked-to-agrochemicals-ap-investigation-1.1505096
  6. Robinson C. Argentina’s Roundup human tragedy. Science in Society 48, 30-31, 2010.
  7. Lajmanovich RC, Sandoval MT, Peltzer PM. Induction of mortality and malformation inScinax nasicus tadpoles exposed to glyphosate formulations. Bull Environ Contam Toxicol2003, 70, 612-18.
  8. Dallegrave E, Mantese FD, Coelho RS, Pereira JD, Dalsenter PR, et al. The teratogenic potential of the herbicide glyphosate-Roundup in Wistar rats. Toxicol Lett 2003, 142, 45-52.
  9. Krüger M, Schrödl W, Pedersen I and Shehata AA. Detection of glyphosate in malformed piglets. J Eviron Anal Toxicol 2014, 4, 1000230, http://dx.doi.org/10.4172/2161-0525.1000230
  10. Ho MW. Glyphosate/Roundup & human male infertility. Science in Society 62, 14-17, 2014.
  11. Sôralini G-E. Clair E, Mesnage R, Gress S, Defarge N, Malatesta M, Hennequin D and de Vendômois JS. Republished study: long-term toxicity of a Rounup herbicide and a Roundup-tolerant genetically modified maize. Environmental Sciences Europe 2014, 26, 14, doi:10.1186/s12302-014-0014-5, http://www.enveurope.com/content/26/1/14
  12. Ho MW. Glyphosate and cancer. Science in Society 62, 12-14, 2014.

 

The Ebola Virus Pandemic: “A Weapon of Mass Destruction”?

September 20th, 2014 by Joachim Hagopian

First published by GR in August 2014

This year’s first outbreak of the hemorrhagic fever virus Ebola started in February in the West African nation of Guinea. It then began spreading to Liberia and, for the first time, to Sierra Leone and now Nigeria. With the possible spread to England in attempts to trace 30,000 people who might have been exposed, and now an American death in Nigeria and two more Americans afflicted with it here in the US, Ebola has rapidly grown into what could become a global epidemic with a potential capacity to wipe out millions.

According to recent statistics from the World Health Organization (WHO) released just last week, at least 672 people have died out of a total of 1,201 cases so far this year in West Africa. However, seven days later the number of fatalities has jumped to 887, a spike of over 200 deaths in just the last few days. [early August]

Because the incubation period may last ten days while the infected victim may not even be aware of any illness, the virus is highly contagious. Then what begins like typical flu symptoms of fever, later vomiting as the virus spreads rapidly inside the body causing people to succumb often within days of its onset. Victims literally die from internal bleeding that in the final stages can flow out of every orifice. It has the trappings of a ghastly zombie science fiction nightmare come true.

There is no standard treatment (other than isolating the infected and quarantining those at risk). Nor is there yet an official vaccine, although Reuters just announced that as early as next month the US government will commence testing an experimental Ebola vaccine on humans after positive results were found on primates. It has been reported that the National Institutes of Health (NIH) infectious disease unit and the US Food and Drug Administration (FDA) will be running vaccine trials “as quickly as possible.”

The Department of Defense and Centers for Disease Control (CDC) classify the Ebola virus as a biowarfare agent. Reports of up to 90% of humans infected die within a very short time. Therefore, it is a very real, extremely potent potential weapon of mass destruction.

Every single day Ebola keeps cropping up in different places, eight cases spreading into Africa’s most populated nation Nigeria, several more now have surfaced beyond the African continent with suspected new cases in Hong Kong and Saudi Arabia. At least six others fresh off flights from West Africa are currently being quietly tested at locations here in the US in New York, Philadelphia and Ohio. With all the latest news of the spreading outbreak understandably giving rise to public fear and panic that it is just a plane ride away now, millions if not billions on this planet are pondering whether the African pandemic might be rapidly turning into a global epidemic spreading to every corner of the earth. Of course to reduce these concerns, the World Health Organization (WHO) and US government are busily downplaying the risks to citizens here in North America.

Is it coincidence that the first two Americans suffering from the deadly disease are now inside the US border? Is it coincidence that the most deadly outbreak of the disease in history has admittedly now killed nearly 900 West Africans already this year? Over 200 more than just a few days ago? Is it coincidence that President Obama has just signed an executive order to have the power to begin rounding up American citizens with respiratory diseases against their will? Is it coincidence that FEMA roundups are about to begin in Los Angeles, deceiving homeless people with the carrot stick of a meal to corral them into those FEMA concentration camps and Halliburton refurbished, soon to no longer be empty prisons we’ve been hearing about?

Throughout this last century the US government and military have a notorious track record for delving into the darkest, most sinister realms in its pathological, “cutting edge” pursuit of amassing the most powerful destructive forces on earth… from torturous mind control methods to unlawful, deceptive drug experimentation on unsuspecting soldiers acting as involuntary guinea pigs, to manipulating extreme weather events used as offensive weapons to create killer storms and droughts, to the use of potently lethal electromagnetic radio waves to alter and disturb the human mind and behavior that conceivably can even cause heart attacks.

For many decades the US military has been systematically carrying out numerous highly secretive black ops programs, from raining poisonous metals down on unsuspecting Americans as sprayed chemtrails to using poor inner city mostly African Americans in St Louis as guinea pigs directly firing radioactive volleys from urban rooftops just to see how humans react to high doses of radiation. Also throughout the 1950’s into the early 1960’s there was extensive atomic bomb testing in the Nevada-Utah desert sites as well as experimental weapons testing still being detonated to this day in the South Pacific, all done knowing that downwind are unsuspecting, unprotected human victims. For four decades right up until 1972, 400 poor black sharecroppers in Tuskegee, Alabama were purposely infected syphilis just to study the effects. As if that was not enough, US government scientists infected Guatemalans in the 1940’s also with syphilis just to experiment with penicillin. This ultra-covert, highly unethical and illegal, malevolent practice of customarily misusing science, often at top universities with unlimited taxpayer funding to harness brilliant yet twisted scientific minds to unleash Nazi Dr. Mengele-type nightmarish experimentation on innocent human populations is nothing new. For obvious reasons it has largely been kept secret and hidden from public view and awareness. But enough concrete evidence has been uncovered over the years to show how willingly diabolical the US military consistently is toward harming even its own citizens.

Less hidden but far more devastating evil acts have been perpetrated by American armed forces on civilians throughout the world. Senselessly destroying Hiroshima and Nagasaki as densely populated Japanese cities became the first intended targets and human guinea pigs of the atomic bomb. And President Truman ordered it even knowing Japan had all but surrendered already. But even prior to the Enola Gay dropping the atomic bomb, the US has used chemical warfare killing people all over the globe with Monsanto made napalm bombs that in one single attack wiped out 100,000 Japanese citizens. Hundreds of thousands of Southeastern Asians were napalmed to death during the Vietnam War. White phosphorus has been used to melt human flesh in Iraq and Israel has used it against Palestinians. Millions and millions of innocent humans have been murdered as a result of these most heinous international crimes against humanity decade after decade after decade with complete impunity at the hands of both the US and Israeli military.

So developing biological weapons from collecting monstrously lethal specimens of the Ebola virus should come as no surprise. Or when considering this already long and extensive US military history, repeatedly guilty of human slaughter on such mammoth, unprecedented scale, it should not be so shocking to realize the military purpose of Ebola as yet another highly destructive weapon in its vast lethal arsenal could be potentially used to eliminate an enormous segment of this planet’s readily expendable current human population.

This year’s first outbreak of the hemorrhagic fever virus Ebola started in February in the West African nation of Guinea. It then began spreading to Liberia and, for the first time, to Sierra Leone and now Nigeria. With the possible spread to England in attempts to trace 30,000 people who might have been exposed, and now an American death in Nigeria and two more Americans afflicted with it here in the US, Ebola has rapidly grown into what could become a global epidemic with a potential capacity to wipe out millions. According to recent statistics from the World Health Organization (WHO) released just last week, at least 672 people have died out of a total of 1,201 cases so far this year in West Africa. However, seven days later the number of fatalities has jumped to 887, a spike of over 200 deaths in just the last few days.

Because the incubation period may last ten days while the infected victim may not even be aware of any illness, the virus is highly contagious. Then what begins like typical flu symptoms of fever, later vomiting as the virus spreads rapidly inside the body causing people to succumb often within days of its onset. Victims literally die from internal bleeding that in the final stages can flow out of every orifice. It has the trappings of a ghastly zombie science fiction nightmare come true.

In 1976 the Ebola outbreak first surfaced in Zaire (now the Republic of the Congo) and then concurrently in Sudan though with different strains, killing 280 people out of 318 diagnosed in Zaire (88% mortality rate) and 151 out of 284 in Sudan (at a killing rate of 53%). During the nearly four decades since those first outbreaks, little has been learned of the disease. The origin of the virus is believed to come from infected animals such as rats, monkeys and bats, all edible meat that are a main staple and part of many Africans’ diet. The so called bush meat can be a viral carrier. So humans remain at risk from animal to human transmission and of course now from human to human transmission, most often from exchange of bodily fluids.

There is no standard treatment (other than isolating the infected and quarantining those at risk). Nor is there yet an official vaccine, although Reuters just announced that as early as next month the US government will commence testing an experimental Ebola vaccine on humans after positive results were found on primates. It has been reported that the National Institutes of Health (NIH) infectious disease unit and the US Food and Drug Administration (FDA) will be running vaccine trials “as quickly as possible.”

This contagious, incurable, highly fatal disease along with the typical bleeding from the eyes has people around the world reacting in horror especially with this largest outbreak to date. Both the CDC and WHO have emphasized that there is no reason for panic as far more people die from the common flu every year than the less than 2000 people killed by Ebola since its African emergence nearly four decades ago. The total numbers show two out of three humans who have been diagnosed with the Ebola virus, die from it with 1,717 deaths recorded out of a total 2,586 cases thus far. In stark contrast, 500,000 people die annually from influenza and a total of nineteen million are believed to have succumbed from the flu.

That said, it is important to disseminate accurate information of what we have come to learn about Ebola. According to the Public Health Agency of Canada:

“ INFECTIOUS DOSE: 1 – 10 aerosolized organisms are sufficient to cause infection in humans.”

Canadian researchers separating pigs from monkeys by wired pens found that infected pigs transmitted the virus by air to the monkeys. Also the viral organism can survive outside the host for several days at normal room temperature, evidence that the virus can stay alive on door knobs and household surfaces and be contagious for a considerable length of time.

The increased near nonstop mainstream reporting about Ebola in recent weeks is undoubtedly in part government propaganda designed to frighten people as well as perhaps take some of the heat off its number one genocidal ally Israel. The security state typically exaggerates or fabricates crises after crises in order strengthen its control through fear tactics over the general population. It only solidifies the absolute authority and power of the police state. Add the media propensity to over sensationalize as a tool of state sponsored propaganda and sufficient excuse emerges to activate security forces to quell ensuing panic and disorder. That said, local citizens in all nations do need to stay informed of any real global danger if in fact an Ebola pandemic does break out in a neighborhood near you, whether by accident or by sinister government design.

Right in stride with the Ebola hype comes the signing of Obama’s latest executive order. “Revised List of Quarantinable Communicable Diseases” allows for the “apprehension, detention, or conditional release of individuals to prevent the introduction, transmission, or spread of suspected communicable diseases,” added to George Bush’s 2003 Executive Order 13295. This means that anyone with respiratory problems that might include bronchitis, COPD or pneumonia can potentially be rounded up at any time. This disinformation of protecting people under benign pretense is the deceptive bait by which the totalitarian police state closes in on its stranglehold of the American populace. Every week the government is ratcheting up conditions ripe for the next manufactured crisis on domestic soil that will ultimately pave the way for martial law and the FEMA roundups of American citizens. With these latest developments, we are one step closer.

Under CDC authority not just people with respiratory problems can be apprehended and detained against their will under the protocol of being quarantined. CDC asserts that any healthy American can be detained as well based on mere suspicion that he or she might have come into contact with an infected person. This loosening of the criteria for detaining individuals opens the floodgate for Big Brother to round up virtually anyone.

In other recent related news, along with people with respiratory problems, there is a current plan in place to soon be rounding up the homeless in Los Angeles and locking them up in FEMA concentration camps with implanted RFID chips. They will be baited with a promised meal. That famous poem by Martin Niemöller comes to mind about the passivity and denial of so many German citizens in response to the series of Nazi prewar mass roundups – “when they came for the homeless, I did not speak out because I was not homeless.” The Orwellian nightmare is officially underway.

In early August Dr. Kent Brantly, the American doctor who contracted Ebola while treating patients in West Africa, arrived in Atlanta and under police escort was rushed off to the home of the CDC Emory University Hospital. Today another American medical worker Nancy Writebol came in on a separate flight and was wheeled into Emory Hospital. Their arrival marks the first Ebola cases on US soil. Both were given an experimental drug in Liberia that apparently is improving their condition. Last Thursday before given the drug the doctor stated he felt he was dying but had already gained enough strength to walk into the hospital in Atlanta on his own. The new drug is called ZMapp and was developed by the San Diego biotech firm Mapp Biopharmaceutical Inc. after showing promising signs treating monkeys infected with Ebola.

No doubt the US government is highly invested in Ebola for both potential Big Pharma profits developing a vaccine as well as for a potential “final solution” as a convenient biowarfare global population-killer. Speaking of profits, Tekmira Pharmaceuticals, a company working on an anti-Ebola drug, just received a $1.5 million cash advance from another killer corporation Monsanto. In the past Tekmira was also awarded $140 million contract from the Department of Defense (formerly known more appropriately as the Department of War). In 2010 the CDC actually did acquire a patent on the strain that erupted in Uganda in 2007 that killed 39 out of 116 infected patients. The CDC patent owning that particular strain of Ebola from Uganda known as “EboBun” has the patent number CA2741523A1 and can be viewed here.

By filing for a patent on a product, in this case a highly lethal infectious disease, the US government is acquiring a governmentally enforced monopoly to exclusively profit from the “invention.” In the summary section of the EboBun patent, it stipulates that the US government in its patent ownership has complete legal control and ownership over all other strains of Ebola virus that share 70% and higher similarity. Thus, this deadly West African strain of Ebola will soon become the US government’s latest prize possession in biowarfare.

In bringing the two Ebola infected Americans back from West Africa to the CDC, in addition to optimizing their survival chance, the other all too obvious explanation is to harvest their Ebola cells for extraction that will then be used to patent the most deadly strain ever known to man. Infectious disease specialist Dr. Bob Arnot who worked on the ground in Africa with patients infected with Ebola virus recently went on television maintaining that “there is no medical reason to bring them here.” To make an exclusive claim of ownership of such a highly infectious disease stolen from the afflicted seems in and of itself invasively and exploitatively sinister. Of course it raises such red flag warnings and suspicion of how the virus might actually be used or more apt misused. Typically the government is quick to explore its military application as potentially the most powerful deadly biological weapon in the entire world.

Sierra Leone recently kicked out all US Ebola researchers from Tulane University and the US Army Medical Research Institute of Infectious Diseases (USAMRIID), a known center for biowar research headquartered at Fort Detrick, Maryland. Just prior to that event two weeks ago after three nurses died from the viral hemorrhagic fever, Sierra Leone nurses working in heavily infested Kenema district actually went on strike accusing the government’s Ministry of Health and Sanitation of mishandling the pandemic that is rapidly spreading. They complained that the medical workers caring for the ill are not properly protected and are suspicious that the American biowarfare team may be responsible for the recent surge in deaths. The Sierra Leone government then ordered the US bioweapons lab at Kenema to be moved due to the mounting anger of the local population blaming the Americans for infecting their citizens through their Ebola testing. Posted on the health ministry’s Facebook page is the conclusion that the diagnostic kits the US researchers have been using are fake and producing false results. It legitimately asks, “Have Tulane researchers done something to endanger public health?” Meanwhile, more people are becoming infected and dying there in that Sierra Leone district hospital than any other place on the planet.

Compounding the mystery, US mainstream media reported that the Sierra Leone leading doctor died from Ebola but the Minister of Health denied that claim. WHO is believed to be taking advantage of the crisis in medical services with pressure to deploy UN security forces in order to launch a massive vaccination (and possible infection) and quarantine campaign. In response, 700 soldiers from the Sierra Leone army have been deployed setting up roadblocks to help quarantine citizens, permitting only health personnel into the hardest hit areas. Troops in Liberia have also been sent to help contain the outbreak there.

The Minister also stated that all new confirmed cases will be admitted and treated at Kailahun Hospital, not trusting what has been occurring with the presence of the US biowarfare researchers at Kenema where rates of confirmed diagnosis have soared recently. Finally the Sierra Leone government is also demanding that the CDC send the biowar lab results to the African government for analysis, implicating that the US research group may be under investigation.

A doctor employed by the French charity organization Doctors Without Borders even stated that the locals’ perception that they will be killed in the Kenema hospital where the Americans have been conducting their research is “understandable,” given that the hospital has become the pandemic’s epicenter. Both the WHO and CDC documents admit that historically most of the Ebola victims have died at the Kenema hospital because of the questionable activities of medical staff. That sounds like an admission of guilt that the military biowarfare team instead of accurately diagnosing patients may have in fact contaminated them with the Ebola virus, possibly using the local Sierra Leone population as mere guinea pigs for their experimentation.

Back in 2009 Tulane University Ebola researchers received more than a $7 million dollar grant from NIH to fund the detection kits allegedly used in Sierra Leone. A 2007 Tulane University release entitled “New Test Moves Forward to Detect Bioterrorism Threats” boasts of an earlier $3.8 million NIH grant that led to early test trial success of “diagnostic test kits that will aid in bioterrorism defense against a deadly viral disease.” This document indicates that the Ebola biowarfare research team has been experimenting with its kits on Sierra Leone’s people for at least seven years before they were ultimately banished recently.

In another astonishing development, a rogue doctor with extensive experience treating Ebola victims, anonymously released what he calls a simple treatment for Ebola – massive amounts of Vitamin C. Similar but far more extreme than scurvy, the Ebola virus essentially drains the body of all Vitamin C, thus depriving oxygenated blood that bursts capillaries and triggers internal hemorrhaging that in effect causes victims to bleed to death. This Ebola specialist maintains that there is no need for a vaccine and warns against them, adding his opinion that the Ebola outbreak in Sierra Leone was actually caused by that biowarfare research team. The doctor recommends a high dosage treatment of 500,000 mg of Vitamin C per day, emphasizing that it is not a cure but will boost the immune system giving it the strength to kill off the Ebola virus in the body.

What is most certain in all these developing stories is the rapid unfolding of global destabilizing events and developments, bogus accusations and boldface lies streaming forth everyday from the propaganda mills of mainstream media and the US government.

But a closer examination of what is far more probable the actual truth indicates that so many of these simultaneous incidents are intimately related, and a mere connecting of dots spells an evil agenda promoting tighter control by a desperate security state that is now declaring war on all people who seek and speak the truth.

Joachim Hagopian is a West Point graduate and former US Army officer. He has written a manuscript based on his unique military experience entitled “Don’t Let The Bastards Getcha Down.” It examines and focuses on US international relations, leadership and national security issues. After the military, Joachim earned a masters degree in Clinical Psychology and worked as a licensed therapist in the mental health field for more than a quarter century. He now concentrates on his writing.

Ten years ago, the idea of the US government spying on its citizens, intercepting their emails or killing them with drones was unthinkable.

But now it’s business as usual, says John Kiriakou, a former CIA agent and torture whistleblower.

-

-
Kiriakou is now awaiting a summons to start a prison sentence. One of the first to confirm the existence of Washington’s waterboarding program, he was sentenced last week to two-and-a-half years in jail for revealing the name of an undercover agent. But even if he had another chance, he would have done the same thing again, Kiriakou told RT.

­RT: The judge, and your critics all seem to believe you got off lightly. Would you say you got off lightly?

JK: No, I would not say I got off lightly for a couple of very specific reasons. First of all, my case was not about leaking, my case was about torture. When I blew the whistle on torture in December 2007 the justice department here in the US began investigating me and never stopped investigating me until they were able to patch together a charge and force me into taking a plea agreement. And I’ll add another thing too, when I took the plea in October of last year, the judge said that she thought the plea was fair and appropriate. But once the courtroom was packed full of reporters last Friday she decided that it was not long enough and if she had had the ability to she would have given me ten years.

RT: And why did you, a decorated CIA officer, take such a strong stance against an agency policy? Did you not consider that there might be some come-back?

JK: I did. I took a strong stance and a very public one and that’s what got me into trouble. But honestly the only thing I would do differently is I would have hired an attorney before blowing the whistle. Otherwise I believe firmly even to this day I did the right thing.

RT: You have called it ironic that the first person to be convicted with regards to the torture program is the man who shed light on it. Do you believe the others, who put the program together, will ever face justice?

JK: I don’t actually. I think that president Obama just like president Bush has made a conscious decision to allow the torturers, to allow the people who conceived of the tortures and implemented the policy, to allow the people who destroyed the evidence of the torture and the attorneys who used specious legal analysis to approve of the torture to walk free. And I think that once this decision has been made – that’s the end of it and nobody will be prosecuted, except me.

RT: When you initially came out against torture, you said it was impractical and inefficient. Did you consider it immoral initially?

JK: I said in 2002 that it was immoral. When I returned from Pakistan to CIA headquarters early in the summer 2002, I was asked by a senior officer in the CIA’s counter-terrorist center if I wanted to be trained in the use of torture techniques, and I told him that I had a moral problem with these techniques. I believed that they were wrong and I didn’t want to have anything to do with the torture program.

RT: It’s no secret that Obama’s administration has been especially harsh on whistleblowers. But can the US afford leniency, in these security-sensitive times?

JK: I think this is exactly what the problem is. In this post 9/11 atmosphere that we find ourselves in we have been losing our civil liberties incrementally over the last decade to the point where we don’t even realize how much of a police state the United States has become.

Ten years ago the thought of the National Security Agency spying on American citizens and intercepting their emails would have been anathema to Americans and now it’s just a part of normal business.

The idea that our government would be using drone aircraft to assassinate American citizens who have never seen the inside of a courtroom, who have never been charged with a crime and have not had due process which is their constitutional right would have been unthinkable. And it is something now that happens every year, every so often, every few weeks, every few months and there is no public outrage. I think this is a very dangerous development.

RT: Obama’s tough stance, and harsh punishments for whistleblowers, has sent a message. Is he winning his fight against those who speak out?

JK: I don’t think he is winning this fight against whistleblowers, at least not over the long term, and I’ll tell you why.

President Obama has now charged seven people with violations of the Espionage Act. All previous presidents in American history combined only charged three people with violating the Espionage Act. And the Espionage Act is a WWI-era act that was meant to deter German saboteurs during that First World War. And now it is being used to silence critics of the government.

But so far all seven of these cases that have made their way into a courtroom have either collapsed of have been dismissed, including mine. All of the three espionage charges against me were dropped.

So, I think frankly the Obama administration is cheapening the Espionage Act. The Espionage Act should be used to prosecute spies and traitors, not to prosecute whistleblowers or people who are exercising their first amendment right to free speech.

RT: Do we still need whistleblowers? Are we going to see more of them coming out?

JK: I think we will see more whistleblowers and I think we need whistleblowers now more than ever before. Whether it’s in national security or whether it is in the banking industry, the American people have a right to know when there is evidence of waste, fraud, abuse, or illegality. If the Justice Department is not going to prosecute these cases, at the very least the American people need to know.

Donors Will Fail Gaza Again

September 19th, 2014 by Nicola Nasser

On 12 October, Cairo is due to host a conference, sponsored and chaired by Egypt and Norway, of international and Arab donors for the reconstruction of Gaza. This is their ostensible aim. But the reasons that the donors cited for not fulfilling earlier pledges, made in Paris in 2007 and Sharm El-Sheikh in 2009, still exist.

This means that the donors who attend the upcoming Cairo conference will probably make the same pledges they made at the two previous conferences and then once again fail to fulfil them.

Meanwhile, the Palestinian people under blockade in Gaza will remain in suspense, waiting for the next aggression to be unleashed on them by the Israeli occupation, purportedly in order to eliminate the causes that the donors cite for recycling their pledges for the reconstruction of Gaza that is unlikely to happen in the foreseeable future.

Fulfilment of the donors’ old/new pledges is still contingent politically on the imposition of the status quo in the West Bank on Gaza . This entails security coordination with the occupying power, the pursuit and elimination of all forms of resistance to the occupation, rendering all reconstruction activities subject to the approval of the Israeli security regime, and much more.

Even should these conditions be met, the donors’ fulfilment of their pledges will remain contingent on the Palestine Liberation Organisation’s (PLO) continued commitment to negotiations as its sole strategy, and to the agreements that led to the creation of the Palestinian Authority (PA).

All the evidence indicates that the PLO and the PA have spearheaded the battle to impose the donors’ conditions on their behalf. Beneath the rubric of “legitimacy”, “the national project” and “the single central authority” that “alone holds the powers to make decisions on war and peace,” the PLO and PA have demonstrated that they are ready to abide by the donors’ political conditions.

The irony is that Israel has never met the conditions it compelled the donors to impose, not just in order to proceed with the reconstruction of Gaza , but also on the PA in general.

Israel has never renounced violence. It repeatedly wages war and unleashes its instruments of state terrorism against the Palestinians under occupation. It has flagrantly and repeatedly violated every agreement signed with the PLO. It has not even reciprocated the PLO’s recognition of Israel , nor has it officially acknowledged the Palestinians’ right to establish a Palestinian state.

Currently, the occupation authorities are threatening to dissolve the Palestinian national reconciliation government if it does not assert its full authority over Gaza . The message was driven home by PA Deputy Prime Minister Mohammed Mustafa, who said that there would be no reconstruction unless his government can fully assert its control over Gaza .

However, all the evidence also indicates that the resistance is there to stay in Gaza and that its powers to resist the imposition of the donors’ conditions — on it and on Gaza — are increasing.

The only possible way to read all of the foregoing, and other facts, is that the reconstruction of Gaza under such conditions and circumstances will be deferred until further notice and that deferring reconstruction and linking it to a process of cloning the West Bank model in Gaza is actually a strategy that paves the way for yet another invasion of Gaza.

It is also a fact that reconstruction needs in Gaza are accumulating as a result of this strategy. Destruction in Gaza did not begin with the response to action against this strategy in 2007. The reconstruction of Gaza ’s airport and seaport, for example, has been pending since the occupation destroyed these facilities in 2002. Reconstruction dues from the destruction wrought by the Israeli assaults on Gaza in 2008-2009 and 2012 are also continuing to accumulate.

A recent report by the Palestinian Economic Council for Development and Reconstruction (PECDAR) estimates that it will cost around $8 billion to rebuild what was destroyed during the last Israeli attack on Gaza . The report says that this process would take five years if the occupation authority were to “fully” lift the embargo on Gaza , which is hardly likely to happen soon.

Clearly, the reconstruction of Gaza requires a new Palestinian strategy, one that draws a line between the grants donors offer and their political conditions, and that rejects once and for all any Palestinian commitment to those degrading conditions that, as the years since the so-called “peace process” began have proven, have brought more destruction than construction, and have served as the chief incubator of Palestinian divisions and not brought even a minimum degree of national benefit.

At the same time, any new government that emerges from a national partnership must embrace resistance against the occupation. The current national reconciliation government, with its six-month term and its principle tasks of preparing for presidential and legislative elections, is by definition an interim government and is not qualified to shoulder heavy and long-term burdens such as the reconstruction of Gaza and securing the end of the blockade.

Both of these tasks are humanitarian and national goals that are higher than any political or factional disputes. Yet the Palestinian presidency’s determination to toe the line with the donors’ conditions, which make no distinction between humanitarian needs and political ends, is a strategy that fails to discriminate between national needs and factional interests. It is a strategy that protracts the humanitarian disaster in Gaza.

Unfortunately, the need to separate politics — factional or otherwise — from the humanitarian issue does not appear to be on the agenda of either foreign and Arab donors, or of Palestinian President Mahmoud Abbas, in spite of the letter he sent to UN Secretary General Ban Ki-Moon on 30 July declaring Gaza a “disaster zone” in the grips of a “dangerous humanitarian crisis.”

This “dangerous humanitarian crisis” is the product of forms of collective punishment that were inflicted against the people of Gaza before the Palestinian rift and that grew worse afterwards. Any Palestinian assent to continuing to adhere to donors’ political conditions, which are responsible for perpetuating the collective punishment, is a form of Palestinian complicity in subjecting the people of Gaza to this punishment. The time has come for all Palestinian leaders to exonerate themselves from all charges of complicity in such punishment.

The collective punishments that have been and continue to be visited on Gaza are not acceptable, even on the pretext of punishing Hamas. Under the Geneva Conventions and before international criminal law they constitute a war crime inflicted on the civilian inhabitants of Gaza, who are protected by international humanitarian law, at least in theory.

To insist that Gaza’s reconstruction be linked to the reinstatement of the “full” authority of the Palestinian presidency and the PA over Gaza, and to the donors’ political conditions which, in fact, are the conditions of the occupying power, is merely another way to say that the reconstruction of Gaza should be linked to the imposition of Fatah’s factional agenda on Gaza.

It also means that civilians in Gaza are to be collectively punished for the factional disputes that Fatah has with Hamas, in which case it becomes very difficult to avoid pointing fingers of accusation at Palestinian complicity in the ongoing collective punishment of the people of Gaza, and more difficult yet to defend any possible Palestinian contribution to the perpetration of such a war crime.

As long as the current situation persists, reconstruction of Gaza will remain pending indefinitely, and the reconstruction burden will only grow. Eventually, the people of Gaza will have no alternative but to look for salvation through other means that they, alone, can control. The Palestinian presidency and its faction must decide to free themselves once and for all from their financial and political dependence on donors and the sterile “peace process” that has so far wrought only death, destruction and division.

It is not too late to opt for the national alternative, which is still available given good intentions, to save the people of Gaza , national unity, the resistance, and decision-making autonomy.

This alternative entails following through on implementation of the mechanisms for national reconciliation, activating the unified command framework for the PLO, agreeing on a new Palestinian strategy based on the principles of partnership and resistance, and creating a new national unity government committed to this strategy and qualified to shoulder such enormous tasks as the reconstruction of Gaza and lifting the blockade.

All of the foregoing requires no more than honest introspection, the prevalence of national conscience, and political free will.

Nicola Nasser is a veteran Arab journalist based in Birzeit, West Bank of the Israeli-occupied Palestinian territories ([email protected]).
 
This article was first published and translated from Arabic by Al-Ahram Weekly on September 19, 2014.

What has one of the most democratic countries of the Middle East, Syria, done to tick off some of its neighbors in the West, the fierce fighters for democracy? The irrationality and unscrupulousness of the approaches Western countries have taken to the Syrian crisis, when the same people who in Europe are considered terrorists are declared «freedom fighters» when it comes to Syria, becomes clearer in light of the economic dimension of the Syrian tragedy. There is every reason to think that by helping destroy its own cultural and historical roots in Syria, Europe is first and foremost fighting for energy resources. And a special role is played by natural gas, which is emerging as the main fuel of the 21st century. The geopolitical problems connected with its production, transportation and use are perhaps more than any other topic on the radar of Western strategists. 

In the apt expression of F. William Engdahl, «Natural gas is the flammable ingredient that is fueling this insane scramble for energy in the region.» A battle is raging over whether pipelines will go toward Europe from east to west, from Iran and Iraq to the Mediterranean coast of Syria, or take a more northbound route from Qatar and Saudi Arabia via Syria and Turkey. Having realized that the stalled Nabucco pipeline, and indeed the entire Southern Corridor, are backed up only by Azerbaijan’s reserves and can never equal Russian supplies to Europe or thwart the construction of the South Stream, the West is in a hurry to replace them with resources from the Persian Gulf. Syria ends up being a key link in this chain, and it leans in favor of Iran and Russia; thus it was decided in the Western capitals that its regime needs to change. The fight for «democracy» is a false flag thrown out to cover up totally different aims.

It is not difficult to notice that the rebellion in Syria began to grow two years ago, almost at the same time as the signing of a memorandum in Bushehr on June 25, 2011 regarding the construction of a new Iran-Iraq-Syria gas pipeline… It is to stretch 1500 km from Asaluyeh on the largest gas field in the world, North Dome/South Pars (shared between Qatar and Iran) to Damascus. The length of pipeline on the territory of Iran will be 225 km, in Iraq 500 km, and in Syria 500-700 km. Later it may be extended along the bottom of the Mediterranean Sea to Greece. The possibility of supplying liquefied gas to Europe via Syria’s Mediterranean ports is also under consideration. Investments in this project equal 10 billion dollars. (1)

This pipeline, dubbed the «Islamic pipeline», was supposed to start operation in the period from 2014 to 2016. Its projected capacity is 110 million cubic meters of gas per day (40 billion cubic meters a year). Iraq, Syria and Lebanon have already declared their need for Iranian gas (25-30 million cubic meters per day for Iraq, 20-25 million cubic meters for Syria, and 5-7 million cubic meters until 2020 for Lebanon). Some of the gas will be supplied via the Arab gas transportation system to Jordan. Experts believe that this project could be an alternative to the Nabucco gas pipeline being promoted by the European Union (with a planned capacity of 30 billion cubic meters of gas per year), which doesn’t have sufficient reserves. It was planned to run the Nabucco pipeline from Iraq, Azerbaijan and Turkmenistan through the territory of Turkey. At first Iran was also considered as a resource base, but later it was excluded from the project. After the signing of the memorandum on the Islamic Pipeline, the head of the National Iranian Gas Company (NIGC), Javad Oji, stated that South Pars, with recoverable reserves of 16 trillion cubic meters of gas, is a «reliable source of gas, which is a prerequisite for the building of a pipeline which Nabucco does not have».It is easy to observe that about 20 billion cubic meters per year will remain from this pipeline for Europe, which would be able to compete with Nabucco’s 30 billion, but not the 63 billion from the South Stream.

A gas pipeline from Iran would be highly profitable for Syria. Europe would gain from it as well, but clearly someone in the West didn’t like it. The West’s gas-supplying allies in the Persian Gulf weren’t happy with it either, nor was would-be no. 1 gas transporter Turkey, as it would then be out of the game. The new «unholy alliance» which formed between them shamelessly declared its goal to be «protecting democratic values» in the Middle East, although logically speaking the U.S. and its allies ought to begin this with their own partners in the coalition against Syria from among the monarchies of the Persian Gulf, which are questionable in this regard.

The Sunnite countries also see the Islamic Pipeline from the viewpoint of interconfessional contradictions, considering it a «Shiite pipeline from Shiite Iran through the territory of Iraq with its Shiite majority and into the territory of Shiite-friendly Alawite Asad». As renowned researcher on energy issues F. William Engdahl writes, this geopolitical drama is intensified by the fact that the South Pars field lies in the Persian Gulf directly on the border between Shiite Iran and Sunnite Qatar. But tiny Qatar, which is no match for Iran in power, makes active use of its connections with the military presence of the U.S. and NATO in the Persian Gulf. On the territory of Qatar are a command node of the Pentagon’s Central Command of the U.S. Armed Forces, the headquarters of the Head Command of the U.S. Air Force, the No. 83 Expeditionary Air Group of the British Air Force and the 379th Air Expeditionary Wing of the U.S. Air Force. Qatar, in Engdahl’s opinion, has other plans for its share in the South Pars gas field and is not eager to join efforts with Iran, Syria and Iraq. It is not at all interested in the success of an Iran-Iraq-Syria pipeline, which would be completely independent of the transit routes of Qatar or Turkey leading to Europe. In fact, Qatar is doing all it can to thwart the construction of the pipeline, including arming the «opposition» fighters in Syria, many of whom come from Saudi Arabia, Pakistan and Libya. (2)

Qatar’s resolve is fed by the discovery by Syrian geological exploration companies in 2011 of Syria’s own large gas-producing area near the Lebanese border, not far from the Mediterranean port of Tartus which Russia leases, and the detection of a significant gas field near Homs. According to preliminary estimates, these discoveries should substantially increase the country’s gas reserves, which previously amounted to 284 billion cubic meters. The fact that the export of Syrian or Iranian gas to the European Union could take place through the port of Tartus, which has ties to Russia, is unsatisfactory to Qatar and its Western patrons as well. (3)

The Arabic newspaper Al-Akhbar cites information according to which there is a plan approved by the U.S. government to create a new pipeline for transporting gas from Qatar to Europe involving Turkey and Israel. The capacity of such a pipeline is not mentioned, but considering the resources of the Persian Gulf and Eastern Mediterranean region, it could exceed that of both the Islamic Pipeline and Nabucco, directly challenging Russia’s South Stream. The main developer of this project is Frederick Hoff, who is «in charge of gas issues in the Levant» and a member of the U.S. «Syrian Crisis Committee». This new pipeline is to begin in Qatar, cross Saudi territory and then the territory of Jordan, thus bypassing Shiite Iraq, and reach Syria. Near Homs the pipeline is to branch in three directions: to Latakia, Tripoli in northern Lebanon, and Turkey. Homs, where there are also hydrocarbon reserves, is the «project’s main crossroads», and it is not surprising that it is in the vicinity of this city and its «key», Al-Qusayr, that the fiercest fighting is taking place. Here the fate of Syria is being decided. The parts of Syrian territory where detachments of rebels are operating with the support of the U.S., Qatar and Turkey, that is, the north, Homs and the environs of Damascus, coincide with the route that the pipeline is to follow to Turkey and Tripoli, Lebanon. A comparison of a map of armed hostilities and a map of the Qatar pipeline route indicates a link between armed activities and the desire to control these Syrian territories. Qatar’s allies are trying to accomplish three goals: «to break Russia’s gas monopoly in Europe; to free Turkey from its dependence on Iranian gas; and to give Israel the chance to export its gas to Europe by land at less cost». (4) As Asia Times analyst Pepe Escobar indicated, the Emir of Qatar apparently made a deal with the «Muslim Brotherhood» according to which it will support their international expansion in exchange for a pact of peace within Qatar. A «Muslim Brotherhood» regime in Jordan and in Syria, supported by Qatar, would abruptly change the entire geopolitical world gas market – decidedly in favor of Qatar and to the detriment of Russia, Syria, Iran and Iraq. It would also be a crushing blow to China. (5)

The war against Syria is aimed at pushing this project through, as well as at the breakdown of the agreement between Tehran, Baghdad and Damascus. Its implementation has been halted several times due to military action, but in February 2013 Iraq declared its readiness to sign a framework agreement which would enable the construction of the pipeline. (6) It is worth noting that after this, more and more new groups of Iraqi Shiites have risen up in support of Asad; as The Washington Post admits, they have «no little battle experience» in confronting Americans in their country. Along with fighters from Lebanon’s Hezbollah, they make an ever more formidable force. (7) The stakes in the «elimination game» started in Syria by the West over the gas pipeline continue to grow. The end of the European Union’s embargo on supplying weapons to the Syrian opposition, which according to the BBC the majority of EU member countries were against (8) (democracy, where are you?), might not be able to help the rebels.

As for civilization and justice, when profit is at stake, sentiment doesn’t matter. The main thing is not to play the wrong card in this unfair game that smells of blood and gas.

Notes

by Public Employees for Environmental Responsibility (PEER)

The White House has given final approval for dramatically raising permissible radioactive levels in drinking water and soil following “radiological incidents,” such as nuclear power-plant accidents and dirty bombs. The final version, slated for Federal Register publication as soon as today, is a win for the nuclear industry which seeks what its proponents call a “new normal” for radiation exposure among the U.S population, according Public Employees for Environmental Responsibility (PEER).

Issued by the Environmental Protection Agency, the radiation guides (called Protective Action Guides or PAGs) allow cleanup many times more lax than anything EPA has ever before accepted. These guides govern evacuations, shelter-in-place orders, food restrictions and other actions following a wide range of “radiological emergencies.” The Obama administration blocked a version of these PAGs from going into effect during its first days in office. The version given approval late last Friday is substantially similar to those proposed under Bush but duck some of the most controversial aspects:

In soil, the PAGs allow long-term public exposure to radiation in amounts as high as 2,000 millirems. This would, in effect, increase a longstanding 1 in 10,000 person cancer rate to a rate of 1 in 23 persons exposed over a 30-year period;

  • In water, the PAGs punt on an exact new standard and EPA “continues to seek input on this.” But the thrust of the PAGs is to give on-site authorities much greater “flexibility” in setting aside established limits; and
  • Resolves an internal fight inside EPA between nuclear versus public health specialists in favor of the former. The PAGs are the product of Gina McCarthy, the assistant administrator for air and radiation whose nomination to serve as EPA Administrator is taken up this week by the Senate.
  • Despite the years-long internal fight, this is the first public official display of these guides. This takes place as Japan grapples with these same issues in the two years following its Fukushima nuclear disaster.

“This is a public health policy only Dr. Strangelove could embrace. If this typifies the environmental leadership we can expect from Ms. McCarthy, then EPA is in for a long, dirty slog,” stated PEER Executive Director Jeff Ruch, noting that the EPA package lacks a cogent rationale, is largely impenetrable and hinges on a series of euphemistic “weasel words.”

“No compelling justification is offered for increasing the cancer deaths of Americans innocently exposed to corporate miscalculations several hundred-fold.”

Reportedly, the PAGs had been approved last fall but their publication was held until after the presidential election. The rationale for timing their release right before McCarthy’s confirmation hearing is unclear.

Since the PAGs guide agency decision-making and do not formally set standards or repeal statutory requirements, such as the Safe Drinking Water Act and Superfund, they will go into full effect following a short public comment period. Nonetheless, the PAGs will likely determine what actions take place on the ground in the days, weeks, months and, in some cases, years following a radiological emergency.

Copyright Public Employees for Environmental Responsibility (PEER) 2014

Europe 2020 – Community or Empire? Is the EU Exploding?

September 19th, 2014 by Global Europe Anticipation Bulletin (GEAB)

This title is inspired by Franck Biancheri first book (unpublished) written in 1992 and in which the author showed that the founding principles of the European project conceived at the end of the Second World War (a community of countries giving themselves the means to jointly build a lasting peace and a prosperous continent) could, if one were not careful, find themselves marginalised and the well-known reflexes of a Europe-empire (European colonisation, Napoleon, Hitler…) would get back on top. In this case Franck Biancheri believed that what would allow the European construction process to stay on the community track would be its democratisation.

A few years later, with the Maastricht Treaty which renamed the European Community the “European Union”Franck Biancheri, with his distrust of “unions” of all kinds, felt that this choice wasn’t very auspicious. 23 years later nothing has advanced on Europe’s democratisation front and the crisis provides a favourable context for the complete derailment of the community project. We will show which indicators enable us to say that this trend (which has always been there of course, but framed in a relatively efficient mechanism of safeguards) is in the process of re-emerging. But we refuse to put forward a final anticipation yet, preferring to focus on other indicators, as well, those which still enable us to believe that the trend will turn round (1).

If we speak of a“trend turnround” it’s that, after having spent almost a year watching Europe at the “Crossroads” (2) we consider that this summer’s end marks its commitment to the wrong path, that which leads towards the “tragic scenario” described by Franck Biancheri in his visionary work “The World Crisis: The Path to the World Afterwards“ (3) in which he put forward Europe’s considerable advantages in the face of the crisis and its potential to participate in the emergence of a “world afterwards” as desirable; but also the major risk for Europe and the Europeans that their rulling elite, undemocratic (in Brussels) or non-European (in the capitals), proves to be incapable of building on the crisis to complete this still unfinished positive European construction project (4).

As our loyal readers know, we analyze the Ukrainian crisis as an operation led by the US and implemented by a handful of well-placed cronies in European decision-making circles with the objective, to summarize, of sealing Europe’s destiny to the Western camp’s led by the US. This operation has been run as a blitzkrieg with a total lack of response on the European side which has suddenly found itself almost at war with Russia without knowing why. When the Europeans woke up from the first shock, another battle, quite difficult to follow, took place amongst the ruling classes, between European states and at the core of public opinion between the “anti-Russians” and “pro-Russians”, but in fact particularly between the Western ideologues and the defenders of the European continent’s independence.

In the last two GEAB issues we focused on the fact that the “conditions for a jolt” had been met, noting the indicators of a European regaining of control of affairs. But summer has gone by, with the loss of vigilance that characterizes this time of year. And with summer’s end we discover a rather sad landscape a priori, especially on three points: the new French government reshuffle, Juncker’s Commission project and NATO’s high Mass in Newport. We will try to make some sense of these three, events then we will review the season’s other important themes (Iraq, Brazil’s general elections, the government reshuffle in Japan) read in the light of major global geopolitical reconfiguration henceforth endeavouring to identify the indicators hastening the world’s bipolarisation – or those of progress in the emergence of a multipolar world. So we will see that it’s not only Europe which risks sliding towards the temptation of empire.
Europe is playing its role in this painful birth of tomorrow’s world, but it’s certain that the increased risk of global bipolarization feeds and is fed by an ideology of power (Europe-empire) at the core of its elite (5).

Our reasoning is that the EU’s explosion (6) can give rise to two kinds of reaction:

. be delighted and resume the European construction project where it was when it derailed (when the Wall fell), setting off again with a reduced and highly integrated core of member states (Euroland) to build the stage of political and democratic union which was blocked at the time (Europe-community);

. or be frightened and block the explosion process underway by strengthening all the founding resources of the second construction period (1989 – 2014): ultra-liberalism, indebtedness, enlargement, Westernism (Europe-empire)

In both cases we believe that the politician is in the process of returning to Europe. But whether it’s the first or second scenario which appears, this politician won’t have the same characteristics of course.

Both sides are currently facing off in the EU’s corridors of power, both at national and European level. We believe that the Europe-empire track is in the process of gaining the upper hand but have not yet despaired of seeing Europe-community win ultimately.

EU explosion: Scottish referendum, Eastern European countries’ failed integration

Yes, the EU is exploding. We have already amply described the challenging of numerous policies by the member states, in particular the free movement of goods and people in the Schengen zone (7); or further, the UK’s project to leave the EU, a structuring power of the EU since its birth in 1992.

Scottish referendum:

We must now add the likely breakup of the UK caused by the Scottish referendum to this list. Many months ago we took the risk of anticipating a victory for the “yes” vote. Now, we offer a further anticipation: whether the yes vote wins or not, in any case this referendum will transform the UK. London had hoped that a resounding victory for the no vote would reinforce the kingdom’s union but, with the certainty of a very tight result, Cameron has already had to make so many concessions to the Scots (8) that the other members of the union (Wales and Northern Ireland) are already on the starting blocks to get the same advances in autonomy (9).

That said, in line with the principle of political anticipation according to which major trends shouldn’t be blocked but exploited, we believe that the UK would benefit from a shift towards a federal structure. We have often said that centralized countries are no longer adapted to the challenges of the 21st century world.

Besides, the English are opportunists and know how to bounce back. By way of proof, the turning round of their financial centre towards Islamic bonds and the Yuan (10) which is saving the City. Federalization of the UK would give its elite a good opportunity to show how capable they are of taking advantage of such a twist of fate.

Anyway, federalization of the UK changes the game considerably for the EU.

Failed Eastern European countries’ integration:

The EU is equally in danger of splitting on its Eastern front.

Today, in effect, the EU in crisis seems less and less attractive to the Eastern countries and some, without questioning their European affiliation, are starting to pay attention to what’s happening with the previous invader, Russia. Victor Orban’s Hungary is the furthest down this path and we would do well to look at the ideas of this policy in more detail, which has nothing of a dictator about it, even if he has the air of a strongman about him, concerned for his country’s independence… But in Europe these last few years, looking towards the East has been considered high treason.

Others, in the light of the clear European political weakness particularly in terms of security and defence policy have, for example, set about discussing their own defence system amongst themselves. Thus the Visegrad Group (whose members include Hungary, but also Slovakia which recently said that it didn’t want foreign troops on its territory (11)), has been working for several years to put a defence and security system in place which, in a way, makes them autonomous (12).

We are at this point now clearly as a direct consequence of the EU’s incapacity to offer any sort of European defence project likely to reassure countries of Europe’s borders.

Bulgaria, now wants to cooperate with Russia in the construction of the South Stream gas pipeline which bypasses the Ukraine. But since the Ukrainian crisis Brussels has prohibited it from building its section (13). However, Bulgaria has two interests in its construction: first, it guarantees it an energy supply and second, it adds a not insignificant source of financing thanks to the collection of tolls on Russian gas.

Eastern European countries’ participation rate in the last European elections is a clear indication of the extent of the failure in integrating these countries. Integration took place too quickly on purely mercantile and not political considerations, these countries often mixing the objective of EU integration with that of NATO integration; as for economic union they have often experienced it, rightly, as an invasion of Western businesses that destroyed their local economy.

If the Ukrainian crisis perhaps provides an opportunity to establish a European defence in the remaining hope that it should be done in consultation with and not opposition to Russia, any failure on this point leads us to a view that certain countries will between now and 2020, which again would be a big failure for this EU which has continued to enlarge Europe in rejecting any project to increase integration, especially political and democratic.

Notes:

(1) Normally we choose a scenario, but in this case we haven’t. We have left our readers to make their own choice.

(2) A word which often appears in the GEAB; in 2013 especially.

(3) And which deserves re-publication halfway through the period covered (2010-2020), a re-publication which the editor, Anticipolis, has agreed to undertake. A re-reading of this book in the light of the dramatic events which dominate the news in 2014 does not encourage optimism.

(4) In fact, the European construction project ground almost completely to a halt after the Maastricht Treaty: with economic union achieved, the only future project which has emerged since is monetary union whose implementation necessitated a continuation of the work towards economic governance, tax and political union, and democratisation. But we stopped in midstream… and the flood is arriving.

(5) The historical parallels are many. Parallel with the Soviet Union: the Western powers that are no longer leading the global economic race and who, like the USSR in the 50s prefer to build a wall between them and judged this competition unfair; but also parallel with the rise in Nazism: a capitalist economic-political system whose excesses provoke strong rejection and gradually develops the ideology of power justifying the concentration of power and money characteristic of its functioning. Just as the Nazi ideology was in effect really shared in all the European corridors of power and not only in Germany, the ideology of power peddled by the US attracts many Europeans close to or within the corridors of power, in particular in Brussels (but not only). After all, this sort of ideology was European before being American and the people who supported it consider that the US is only an extension of Europe and that the two must unite indissolubly to defeat China’s emergence in particular, who frightens them most of all. Thus, one can suspect certain European technocrats of seeing the signing of the free trade treaty with the US as a natural enlargement of Europe to the US…from the Rockies of Europe to the Balkans!

(6) In many previous GEAB issues we anticipated this explosion of the EU, whilst showing that the EU wasn’t Europe, that it was a form of organization born of the Maastricht Treaty, which had failed, and that one could positively welcome the birth of Euroland in the end of the EU. This emergence of a European project alternative to the EU started with the management of the Euro crisis which has, in effect, accelerated the structuring of a Eurozone governance. But if a Euro crisis naturally reinforced the Eurozone, a geopolitical crisis like the one created by the Euro-Russian one, reinforces the EU… and all its faults.

(7) For example: Deutsche Welle, 22/10/2012

(8) Source : DailyAdvance, 14/09/2014

(9) Source : BBC, 09/09/2014

(10) Source : Forbes, 14/09/2014

(11) Source : Reuters, 04/06/2014

(12) Source : Polish Prime Minister, 14/10/2013

J-31 chino vs F-35 estadounidense

September 19th, 2014 by Valentin Vasilescu

China cuenta con 580 aviones para garantizar la supremacía aérea, con aviones de cuarta generación derivado del Su-27SK / Su-30 MKK (J-11, J-16) y J-10 .. Mientras  Corea del Sur y Japón tienen, entre ellos, 590 aviones, superior en términos de aviónica y armamento a China, sumado al contingente estadounidense con 260 aviones desplegados en los dos países oa bordo de uno o dos portaviones asignados a la flota séptima de los EE.UU. . Además, Corea del Sur y Japón ya han ordenado 40-50 Americana stealth F-35 aviones.

Por su parte, la industria de la aviación india está adqueriendo  la tecnología de la asimilación de la caza furtivo ruso, el Sukhoi T-50, que será producida bajo el nombre HAL FGFA (250-280 aviones). Por eso, en los últimos meses, una asistencia discreta fue proporcionada Rusia a China para transferir tecnología rusa para avanzar en la prueba e ir directamente a la producción en serie del avión stealth prototipo J-31. En los próximos años, al menos 500 aviones J-31 equipará a la fuerza aérea china.


Rusia es partidaria de fomentar la exportación de la aeronave china J-31, para que se convierta, con el avión deSu-50 T, un competidor de cara q los aviones estadounidenses F-35.

Para compensar el abrumador poder del monomotor F-35 (Pratt & Whitney F135 19.000 kgf.), El J-31 está equipado con dos motores WS-13 de 8700 kgf, una copia al ruso RD-93 MiG-29 K / MiG-35. Con el fin de competir con el F-35 en el mercado mundial, los chinos necesitan que  el ruso les permita construir bajo licencia, 117 motores S Saturno Su-35, mucho más potente, con un empuje de 15.800 kgf. El mega-contrato por valor de 400 mil millones firmado con Rusia a principios de mayo, mostró lo que era el lado de China a partir de ese momento de la imposición de sanciones por parte de Occidente a la parte rusa. Las dos superpotencias han acordado no competir en el mercado aeroespacial.
El J-31 es una alternativa más modesta en términos de aviónica, pero es un 60% del precio de un F-35. Ambos aviones llevan dos compartimentos en el casco para llevar dos misiles  de mediano alcance aire-aire  bombas . Ellos, ambos, tienen 6  pilons exteriores, con una capacidad de 8.6 toneladas.
La estrategia de China para la comercialización de los aviones J-31 también es interesante. Además de 500 aviones de la Fuerza Aérea de China, otros 120 J-31 son de tres compañías chinas. El portaaviones chino Liaoning, llamado Varyag originalmente cuenta actualmente con 30 aviones J-15 (similar al Su-33) y se utiliza como buque escuela para la formación de pilotos de portaaviones. Una copia modificada de Liaoning está en construcción avanzada en los astilleros de Dalian, mientras que el tercer portaaviones, mucho más grande, se está construyendo en los astilleros de Shanghai.

China se convertirá, a finales de este año, en la economía mundial que está dispuesto a invertir tanto dinero como los americanos en el proyecto de caza de sigiloy en la industria de la aviación, ya que está previsto que exporten se al menos 600 aviones J-31. El precio de un avión estadounidense F-35 es superior a 120 millones. A este precio, fuera de los Estados Unidos, sólo los países ricos entre los países de la OTAN, como Italia, Inglaterra, los Países Bajos, Noruega y Turquía pueden permitirse el lujo de comprarlo. España, Portugal y Grecia, frente a una profunda crisis financiera, no planean comprar F-35.

Los ex países comunistas que bordean Rusia, se convirtieron en miembros de la OTAN, ni pueden soñar con algo así, o conseguir el permiso de Estados Unidos para comprar aviones chinos similar. A partir del próximo año Rusia desarrollará su masivo ejército de aviones stealth Su T-50, equivalente,al F-22 estadounidense   se exportará  a los países de la CEI (Comunidad de Estados Independientes).  Ucrania , Georgia y Moldavia se han unido recientemente a la UE. Por lo tanto, en contra de los antiguos países comunistas, los países no alineados tienen libertad de elección y son un blanco para los chinos con este avión.

Pakistán, el socio más cercano de China, recientemente renunció a comprar 36-70 aviones J-10, para reorientase en el J-31. Como  Israel ya ha encargado 75 F-35 estadounidense, Irán también parece muy interesado en la compra del mismo número de aviones J-31. Los compradores potenciales podrían incluir el Africa del Sur (miembro de los BRICS como China) que ha retirado sueco JAS-39 Gripen . Angola, el estado con la mayor tasa de crecimiento de la economía mundial durante la última década (20% entre 2005-2007) con el  petróleo , gas y diamantes, tomó acciones en el Banco Portugués de ahorrar la antigua potencia colonial, Portugal, el fantasma de la bancarrota. Angola ha comenzado un plan para la compra de 12 aviones Su-30 MKI, Su-27 SM 7, 15  Su-25y ha destinado dinero para continuar con J-31. Con este plan de compra, el equilibrio de poder en  África del Sur y el Oeste está cambiando a expensas de las antiguas ciudades occidentales.
Egipto, a quien Estados Unidos ha cortado la ayuda militar anual que consistió en la entrega de aviones F-16, y Azerbaiyán, que tiene, en los últimos años, un superávit de las exportaciones de gas que  opera en la región del Mar Caspio, tiene estrechas relaciones con Pakistán y estaría interesado en este avión. Venezuela con Brasil (Estado de otros BRICS, constructor de varios tipos de aeronaves Embraer) no sólo quiere comprar, sino también producir la aeronave bajo licencia, tuvo que competir con los  militares con productos de mercado de Estados Unidos en América América Central y del Sur.

Valentin Vasilescu 

Traducido del rumano por Avic -  Red Internacional
Articulo em francés :

America Created Al-Qaeda and the ISIS Terror Group

September 19th, 2014 by Garikai Chengu

Much like Al Qaeda, the Islamic State (ISIS) is made-in-the-USA, an instrument of terror designed to divide and conquer the oil-rich Middle East and to counter Iran’s growing influence in the region.

The fact that the United States has a long and torrid history of backing terrorist groups will surprise only those who watch the news and ignore history.

The CIA first aligned itself with extremist Islam during the Cold War era. Back then, America saw the world in rather simple terms: on one side, the Soviet Union and Third World nationalism, which America regarded as a Soviet tool; on the other side, Western nations and militant political Islam, which America considered an ally in the struggle against the Soviet Union.

The director of the National Security Agency under Ronald Reagan, General William Odom recently remarked, “by any measure the U.S. has long used terrorism. In 1978-79 the Senate was trying to pass a law against international terrorism – in every version they produced, the lawyers said the U.S. would be in violation.”

During the 1970′s the CIA used the Muslim Brotherhood in Egypt as a barrier, both to thwart Soviet expansion and prevent the spread of Marxist ideology among the Arab masses. The United States also openly supported Sarekat Islam against Sukarno in Indonesia, and supported the Jamaat-e-Islami terror group against Zulfiqar Ali Bhutto in Pakistan. Last but certainly not least, there is Al Qaeda.

Lest we forget, the CIA gave birth to Osama Bin Laden and breastfed his organization during the 1980′s. Former British Foreign Secretary, Robin Cook, told the House of Commons that Al Qaeda was unquestionably a product of Western intelligence agencies. Mr. Cook explained that Al Qaeda, which literally means an abbreviation of “the database” in Arabic, was originally the computer database of the thousands of Islamist extremists, who were trained by the CIA and funded by the Saudis, in order to defeat the Russians in Afghanistan.

America’s relationship with Al Qaeda has always been a love-hate affair. Depending on whether a particular Al Qaeda terrorist group in a given region furthers American interests or not, the U.S. State Department either funds or aggressively targets that terrorist group. Even as American foreign policy makers claim to oppose Muslim extremism, they knowingly foment it as a weapon of foreign policy.

The Islamic State is its latest weapon that, much like Al Qaeda, is certainly backfiring. ISIS recently rose to international prominence after its thugs began beheading American journalists. Now the terrorist group controls an area the size of the United Kingdom.

In order to understand why the Islamic State has grown and flourished so quickly, one has to take a look at the organization’s American-backed roots. The 2003 American invasion and occupation of Iraq created the pre-conditions for radical Sunni groups, like ISIS, to take root. America, rather unwisely, destroyed Saddam Hussein’s secular state machinery and replaced it with a predominantly Shiite administration. The U.S. occupation caused vast unemployment in Sunni areas, by rejecting socialism and closing down factories in the naive hope that the magical hand of the free market would create jobs. Under the new U.S.-backed Shiite regime, working class Sunni’s lost hundreds of thousands of jobs. Unlike the white Afrikaners in South Africa, who were allowed to keep their wealth after regime change, upper class Sunni’s were systematically dispossessed of their assets and lost their political influence. Rather than promoting religious integration and unity, American policy in Iraq exacerbated sectarian divisions and created a fertile breading ground for Sunni discontent, from which Al Qaeda in Iraq took root.

The Islamic State of Iraq and Syria (ISIS) used to have a different name: Al Qaeda in Iraq. After 2010 the group rebranded and refocused its efforts on Syria.

There are essentially three wars being waged in Syria: one between the government and the rebels, another between Iran and Saudi Arabia, and yet another between America and Russia. It is this third, neo-Cold War battle that made U.S. foreign policy makers decide to take the risk of arming Islamist rebels in Syria, because Syrian President, Bashar al-Assad, is a key Russian ally. Rather embarrassingly, many of these Syrian rebels have now turned out to be ISIS thugs, who are openly brandishing American-made M16 Assault rifles.

America’s Middle East policy revolves around oil and Israel. The invasion of Iraq has partially satisfied Washington’s thirst for oil, but ongoing air strikes in Syria and economic sanctions on Iran have everything to do with Israel. The goal is to deprive Israel’s neighboring enemies, Lebanon’s Hezbollah and Palestine’s Hamas, of crucial Syrian and Iranian support.

ISIS is not merely an instrument of terror used by America to topple the Syrian government; it is also used to put pressure on Iran.

The last time Iran invaded another nation was in 1738. Since independence in 1776, the U.S. has been engaged in over 53 military invasions and expeditions. Despite what the Western media’s war cries would have you believe, Iran is clearly not the threat to regional security, Washington is. An Intelligence Report published in 2012, endorsed by all sixteen U.S. intelligence agencies, confirms that Iran ended its nuclear weapons program in 2003. Truth is, any Iranian nuclear ambition, real or imagined, is as a result of American hostility towards Iran, and not the other way around.

America is using ISIS in three ways: to attack its enemies in the Middle East, to serve as a pretext for U.S. military intervention abroad, and at home to foment a manufactured domestic threat, used to justify the unprecedented expansion of invasive domestic surveillance.

By rapidly increasing both government secrecy and surveillance, Mr. Obama’s government is increasing its power to watch its citizens, while diminishing its citizens’ power to watch their government. Terrorism is an excuse to justify mass surveillance, in preparation for mass revolt.

The so-called “War on Terror” should be seen for what it really is: a pretext for maintaining a dangerously oversized U.S. military. The two most powerful groups in the U.S. foreign policy establishment are the Israel lobby, which directs U.S. Middle East policy, and the Military-Industrial-Complex, which profits from the former group’s actions. Since George W. Bush declared the “War on Terror” in October 2001, it has cost the American taxpayer approximately 6.6 trillion dollars and thousands of fallen sons and daughters; but, the wars have also raked in billions of dollars for Washington’s military elite.

In fact, more than seventy American companies and individuals have won up to $27 billion in contracts for work in postwar Iraq and Afghanistan over the last three years, according to a recent study by the Center for Public Integrity. According to the study, nearly 75 per cent of these private companies had employees or board members, who either served in, or had close ties to, the executive branch of the Republican and Democratic administrations, members of Congress, or the highest levels of the military.

In 1997, a U.S. Department of Defense report stated, “the data show a strong correlation between U.S. involvement abroad and an increase in terrorist attacks against the U.S.” Truth is, the only way America can win the “War On Terror” is if it stops giving terrorists the motivation and the resources to attack America. Terrorism is the symptom; American imperialism in the Middle East is the cancer. Put simply, the War on Terror is terrorism; only, it is conducted on a much larger scale by people with jets and missiles.

Garikai Chengu is a research scholar at Harvard University. Contact him on [email protected]

The Hermes 900 was among the drones used to bomb Gaza this summer. (Tal Inbar)

Less than one month after killing more than 2,100 Palestinians in Gaza, including more than 500 children, Israel is hosting its annual drone conference.

Organized in partnership with the US embassy in Tel Aviv, “Israel Unmanned Systems 2014” offers Israeli military firms an opportunity to flaunt the performance of their products, many of which were tested on Palestinians in the besieged Gaza Strip this summer.

Palestine has long served as a laboratory for Israel’s ballooning “homeland security” industry to test and perfect weapons of domination and control, with disenfranchised and stateless Palestinians serving as their lab rats.

Speaking to the German magazine Der Spiegel last month, Avner Benzaken, head of the Israeli army’s “technology and logistics” division — a unit “comprised largely of academics who also happen to be officers” — explained the benefits of this occupation.

“If I develop a product and want to test it in the field, I only have to go five or ten kilometers from my base and I can look and see what is happening with the equipment,” said Benzaken. “I get feedback, so it makes the development process faster and much more efficient.”

Easy access to a captive population to experiment on allows Israeli weapons manufacturers to market their products as “combat-proven,” a coveted label that gives Israel a competitive edge in the international arms trade. Israel’s suppression technology is then exported to regimes that are similarly invested in subjugating the poor and marginalized.

This dystopian arrangement has paved the way for Israel, a country the size of New Jersey, to rank among the globe’s top five largest arms exporters and to become the world’s number one exporter of unmanned aerial vehicles (UAVs), or drones.

“Combat-proven”

One of the sponsors of this year’s drone conference is G-NIUS. Formed as a joint venture between two of Israel’s largest arms companies — Elbit Systems and Israel Aerospace Industries (IAI) — G-NIUS develops unmanned ground vehicles for the Israeli army.

Thanks to the Gaza assault, G-NIUS can now add “combat-proven” to the resumé of its unmanned Armored Personnel Carrier (APC), which was deployed operationally in Gaza this summer, marking the first time a remote controlled and unmanned APC has ever “participated in combat,” according to Israel Defense.

Those attending the drone conference were scheduled to visit G-NIUS on Monday, 15 September to get a first-hand look at the machines used to assist in Gaza’s destruction.

They were also scheduled to visit Israel’s largest developer of military technology, Elbit Systems, which benefited enormously from the summertime offensive.

Elbit’s stock jumped to its highest level since 2010 during the Gaza slaughter, a phenomenon Bloomberg Businessweek attributed to investor speculation that the Haifa-based company would see increasing demand for its products from governments impressed by its blood-soaked performance.

One product likely to use the Gaza bloodshed as a selling point is Elbit’s Hermes 900, which was deployed operationally for the first time during Operation Protective Edge.

The Hermes 900 is a larger and more advanced version of the Hermes 450, an aerial attack and surveillance drone that was used by the Israeli army to deliberately target civilians in Gaza during Israel’s 2008-2009 onslaught, according to Human Rights Watch.

Elbit drones were also used to kill civilians in Israel’s war on Lebanon in 2006, including Red Cross workers, ambulance drivers and dozens of people fleeing their homes for refuge from relentless Israeli bombardment.

Even before it helped Israeli soldiers reduce Gaza to rubble, the Hermes 900 was winning lucrative contracts.

In July, the Swiss government purchased the Hermes 900 system for $280 million. And earlier this year, the Brazilian government purchased a fleet of Hermes drones, including the Hermes 900, to help crush the massive protests that erupted across Brazil against the World Cup.

After participating in Israel’s 51-days of terror on Gaza this summer, the Hermes 900 can join its predecessors in the “combat-proven” camp, which is sure to boost demand.

Also likely to profit from its role in turning Gaza into a graveyard is Elbit’s Skylark mini-UAV, a hand-launched surveillance drone. Though it has been used in Gaza in the past, Operation Protective Edge was the first time the Skylark was deployed in large numbers to assist the invading ground forces.

Roy Riftin, a general and chief artillery officer in the Israeli army, told Defense News that the Skylark was instrumental in “serving up targets of opportunity” for Israeli gunners.

Weapons testing

Drone makers were’t the only ones to profit from the Gaza massacre.

Mired by debt prior to the Gaza onslaught, Israel Military Industries (IMI) was on life support. The company’s slump was so severe, the Israeli government planned to privatize it by 2016 and was offering $370,000 severance packages to any employee willing to retire early.

But now things are looking up for IMI.

During Israel’s military assault on Gaza, IMI employees worked nonstop to ensure an endless flow of 5.56 mm bullets and Kalanit and Hatzav tank shells to Israeli forces, reported Haaretz.

The Kalanit and Hatzav tank shells detonate in midair, blanketing the people and structures below with deadly bomblets. The Kalanit, an Israeli army favorite, is so popular that it was awarded Israel’s esteemed “Defense Prize” in 2011. Though they have been used in the past, Operation Protective Edge marked the first time the Kalanit and Hatzav shells were deployed on a colossal scale.

IMI also tested several new weapons during the Gaza slaughter, including its MPR-500 multipurpose rigid bomb, a 500-pound precision-guided explosive so powerful it can penetrate a meter of reinforced concrete. After deploying the MPR-500 the first time in an operational capacity against the structures and bodies of the people of Gaza this summer, demand for the bomb skyrocketed, with 5.6 billion shekels ($1.5 billion) worth in back orders in early August.

Getting in on the action

Meanwhile, foreign military contractors are aiming to cash in on the next slaughter.

Doron Shalev, business development manager at BAE Systems Rokar, a subsidiary of the Anglo-American firm BAE Systems that specializes in developing GPS navigation for artillery, is already angling for new business opportunities from the Israeli war machine in the aftermath of the Gaza slaughter.

Writing in Israel Defense, Shalev notes that Israel’s use of indiscriminate artillery, most heavily in the Shujaiya and Rafah areas of Gaza, provoked the ire of the Obama administration. To avoid a similar “controversy” in a future attack on Lebanon, Shalev suggests Israel invest in the type of navigation systems that he happens to sell, understanding full well that Israel is itching to attack Hizballah.

“During the last operation, artillery fire was admittedly employed on a relatively large scale, but it is important to bear in mind that it was employed under relatively favorable conditions,” argues Shalev. “It is important to understand that the next conflict will be different and that the Gaza Strip theater is not in any way similar to Lebanon. For this reason, we must ensure that the right lessons are being drawn and that the artillery layout is being prepared effectively for the next challenge rather than for the previous challenge.”

Lockheed Martin, the world’s largest “defense” contractor, is also looking to get in on the action, having just formed a subsidiary inside Israel. “The move is part of a wider push by Lockheed Martin to seek overseas defense contracts amid a slowdown in US military spending,” reported The Wall Street Journal.

Meanwhile, the besieged and devastated Gaza Strip remains buried under four million tons of rubble as the death merchants responsible parade around Israel’s annual drone festival bragging about their successes in an effort to export their products.

War is a racket indeed.

As the stand-off between Russia and the West continues, one organisation seems to be completely off the radar, and yet has managed to make great strides in its development and growth. This organisation is the Shanghai Cooperation Organisation (SCO), an intergovernmental group of Central Asian countries aiming to promote cooperation between its six member states:Russia, China, Kazakhstan, Uzbekistan, Kyrgyzstan and Tajikistan. The SCO’s main goal has been to serve as a forum to ease tensions in the region. In the organisation’s 2002 charter “confidence-building measures” were set as the alliance’s first priority. A key aspect of this strategy is the fight against the so-called “three evils:” terrorism, extremism and separatism.

Western media rarely reports on this organisation, however, during its annual summit which took place between 11 to 12 September in Tajikistan, SCO suggested and enacted some note-worthy proposals. The two-day forum was attended by regional leaders, including Russian President Vladimir Putin, and his Chinese and Iranian counterparts, Xi Jinping and Hassan Rouhani. In a major step forward in expanding its regional clout, the SCO finalised procedures for taking in new members, with India, Pakistan, and Iran first on the list. Indeed expanding the SCO is a major priority for the organisation. Teng Jianqun of the China Institute of International Studies said recently that“enlargement has become absolutely necessary” for the SCO.

SCO summit meeting in Dushanbe, September 11, 2014

SCO summit meeting in Dushanbe, September 11, 2014

The reasoning behind the need for expansion is obvious. If the SCO is to have real weight on the international arena and become a truly prestigious organisation that is able to rival NATO, it requires additional members. If India, Pakistan, Iran and Mongolia were all to become permanent members, which looks likely, the group would then control 20 percent of the world’s oil and half of all global gas reserves. On top of that, the bloc would represent about half of the world’s population. This would fortify SCO’s reputation as a dominant organisation, Additionally, Turkey could become a member as well. Its leadership has long been seeking to join and Turkish-speaking governments are likely to support their petition.

Though terrorism and regional security (especially in Afghanistan) remains top of SCO’s agenda, events occurring in Ukraine are certainly having an influence on the SCO members. The aggressive nature of Western actions towards Russia has certainly united the SCO members. What links them all – whether members or observers – is the rejection of Western-dominated institutions, such as the World Bank or the International Monetary Fund, which are all US-based. The SCO, like the BRICS with the establishment of their Development Bank, sees itself as a forum against the Western dominated global order.

Before the summit, Chinese President Xi Jinping met with President Vladimir Putin for bilateral talks. Putin stated that Russia “attaches importance to and appreciates China’s stances and proposals on the Ukraine issue.” He said that Russia was willing to continue to communicate with China over the situation in Ukraine. Putin also suggested that China and Russia should “enhance coordination on international and regional affairs.” Promoting the SCO fits China and Russia’s shared goal ofcreating an Asian security architecture independent of the United States and its allies.

While the main emphasis was on security concerns, the SCO summit also encouraged further economic cooperation among its members. Economic integration has become an increasingly large part of the SCO agenda, especially as China promotes its idea for a Silk Road Economic Belt that would include the SCO members and observer states. China has already confirmed that it will allocate $5 billion worth of credit for the SCO member countries to implement joint projects. The two dominant players of the group, China and Russia also put the final touches to a new energy partnership. Recently, Russia began constructing its section of the East Route of the China-Russia natural gas pipeline. Both leaders want the SCO to become a stronger organisation, able to guarantee the stability and development of all its members.

Russia will act as the SCO’s President until the next summit in 2015. The country has already outlined plans for this period to make broader use of national currencies in settlements. Prospects are good for launching large multilateral projects in transport, energy, innovative research and technology, agriculture, and the peaceful use of outer space. The SCO Business Council, Interbank Consortium, and Energy Club are at the forefront of expanding practical cooperation among member states. Steps will also be taken to establish relations with the Eurasian Economic Union, which currently consists of Russia, Kazakhstan and Belarus, with Armenia and Tajikistan likely to join in the near future.

Overall, the future of the SCO looks promising. A combination of new members and a determination to make the organisation a genuine important and influential bloc is likely to ensure that the SCO will continue to develop and expand. The ambition to create a truly dominant organisation free of any Western influence may become a reality in the near future.

Alexander Clackson is the founder of Global Political Insight, a London-based think tank and a political media organisation.

In 1707 a shaky union was set up that made Scotland a part of the United Kingdom. Scottish parliamentarians were bribed with vast sums of money and lucrative pension schemes to move their seats to Westminster, London. 

It was a sell out of the Scottish electorate that would later prompt its country’s best-loved poet, Robert Burns, to claim about Scottish politicians:

“We’re bought and sold for English gold.

Such a parcel of rogues in a nation.”

It was colonial expansionism by other means than the barrel of a gun. Empires come and go, and now there is a real chance Scotland will regain its independence. Dennis Canavan, chairman of “Yes scotlande-e1410736627399Scotland,” is calling for a referendum on who should rule the country. On September 18, 2014, the voting electorate will decide whether they want to remain part of the union or manage their own economy. There is division now, as there was in 1707, but this time Scottish voters have a unique opportunity to express their wishes through the ballot box.

This does not mean that England has been lax regarding check book diplomacy. A lot of big money has been thrown behind a “Vote No Borders” and “Better Together” campaign. Scottish people must have sensed a strange irony when they learned that the company behind this campaign is London-based, especially since those in favor of independence know it to be Westminster that has kept Scotland a poor partner in the union. Until recently BBC reports were almost completely partial to the “No” campaign. This was coupled with a faux grass-roots promotion of its corporate line, which amply demonstrated the bigotry of the government’s main media mouthpiece and was exposed by Craig Murray.  Only when it became evident that this campaign had backfired did the BBC start to present more balanced reporting.

scotlandn-e1410736790910David Cameron added his voice to the “No” campaign, which gave clear and substantial kudos to the “Yes” movement. He promised to Scotland some pie in the sky for keeping the union intact, including greater ability to raise its own taxes and more devolution should voters say No, failing to note that, with a Yes vote, they would get whatever they want. A last-minute bribe, however, was hardly likely to win over a skeptical and aware public, which knows that British rule and government have had more than 300 years to make Scotland an equal partner in the union. Support for Conservatives north of the border has long been in decline, David Mundell being the only Tory Member of Parliament (MP) who currently represents a Scottish constituency in the UK.

While the Liberal Democrats are a spent force, as might be expected, Labor has acted no better than the Tories, with the Scottish-born former UK prime minister Gordon Brown speaking out enthusiastically on behalf of the No campaign. Brown, the man who presided over the banking crisis bailout at taxpayers’ expense, has also written a book called My Scotland, Our Britain, promoted in anarticle for The Guardian. He argues with a politician’s devotion to rhetoric rather than substance while calling to his aid 18th century Scottish economical philosophers, Adam Smith and David Hume. His thesis is that these two famous men laid the groundwork for what is now called “social capital”: a wishy-washy term that means so many different things to so many different people, it is worthless as a yardstick for anything.

Brown singularly fails to mention the former Scottish coal miner, Keir Hardie, the most famous pioneer of the Labor movement and first Labor MP. Hardie was a pacifist who had opposed both the Boer War and the First World War. He worked on behalf of the suffragettes, and his contribution to the labor and working-class movement was enormous. The mine owners, or as Brown might like to think of them, “social capitalists,” had blacklisted young Keir Hardie and his brothers as agitators. Even more shamefully, Brown helped Tony Blair to dismantle the last vestige of socialism in the party Keir Hardie had founded, and Brown voted enthusiastically for the War in Iraq. Between them, these two prime ministers turned Labor into another neo-conservative party.

Keir Hardie was a believer in Scottish independence and abolition of the monarchy. He famously caused uproar in the House with a speech that criticized the privileges and sycophancy which were about to be bestowed on the newly-born Edward (later Edward VIII) because parliament would not approve, at the same time as congratulating the prince, a message of condolence to the families of 251 coal miners killed at Pontypridd.

scotlandf-e1410736988130Should the Yes campaign succeed, Alex Salmond, the Leader of the Scottish National Party (SNP) and Member of the Scottish Parliament, will almost certainly head the new government. Mr. Salmond appears to be quite an establishment figure. Like David Cameron and all prime ministers since the Lockerbie bombing, Salmond has opposed a public inquiry into a tragedy for which Abdelbaset al Megrahiwas blamed and imprisoned when it is widely believed today that Megrahi was in no way involved. Though Salmond will get his assured place in history with a Yes vote, he will not be head of parliament indefinitely, and one day the Scottish people might choose to elect another Kier Hardie to bring real justice to the impoverished.

If Scotland votes Yes and goes independent, the issue of Royal Palaces will almost certainly come under scrutiny. The Royal Family has holiday homes at Balmoral Castle, Aberdeenshire and Holyrood Palace, Edinburgh. Prince Charles and the Duke of Edinburgh are quite often seen in kilts, though lederhosen might be more appropriate apparel considering the ancestry of the Royals.

Another issue that will come to the fore with a Yes vote is Britain’s nuclear arsenal Trident, which is located at Faslane/Coulport, near to Glasgow but quite far from Westminster. It is of no real benefit to Scotland having the naval base there; in fact, this puts communities at risk in the event of enemy attack. The Thames estuary seems a much more favorable location for such dangerous weapons if our English parliament does not come to its senses with a unilateral dismantling of these gross threats to humanity.

Voting Yes to independence could also be good for England. Here in England, David Cameron is doing all he can to dismantle the National Health Service (NHS) and hive off the more lucrative parts to private enterprise, while students are leaving university with loan debts of some £30,000 and no realistic means of paying them off. By contrast, Scotland has a free (Yes, free!) university educational system. Pledges have been made to extend Scotland’s support, not only for education, but also for the NHS. If Scotland continues to set such a fine example, people in England will seriously consider moving north and those voters who remain will start asking their elected parliamentary representatives why we cannot manage our economy like the Scots.

Aired on Australia’s ABC TV in February 2014

NotInMyName!

Children as young as 12, taken from home at night, blindfolded, handcuffed and imprisoned. Berlin 1933? West Bank, Israel 2014

UNICEF estimates that over the past decade an average of 700 children a year have been arrested by ISRAELI forces in this manner.

The Israeli military is facing a backlash at home and abroad for its treatment of children in the West Bank, occupied territory.

Coming up, a joint investigation by Four Corners and an Australian newspaper reveals evidence that shows the army is targeting Palestinian boys for arrest and detention. Reporter John Lyons travels to the West Bank to hear the story of children who claim they have been taken into custody, ruthlessly questioned and then allegedly forced to sign confessions before being taken to court for sentencing.

He meets Australian lawyer Gerard Horton, who’s trying to help the boys who are arrested, and talks to senior Israeli officials to examine what’s driving the army’s strategy.

While many of us rely on grass-fed beef as a source of healthful, properly raised meat, that option of healthy eating may just move down a peg. Why? Not because cattle may have to switch to GM grain, but rather because cattle may be forced to indulge in genetically modified grass.

The Scotts ‘Miracle-Gro’ Company which created genetically modified RoundUp-Ready Kentucky Bluegrass has announced that it will conduct field trials at the homes of Scotts’ employees. What’s more, they can do so without any government oversight because there are no laws that prohibit or limit the planting of GMO grass.

We already know that RoundUp ready crops have been linked (retracted, but read more on that here) via independent peer reviewed studies to inflammatory, genotoxic, neurotoxic, carcinogenic, and endocrine disrupting diseases, as well as infertility. RoundUp also chelates important minerals from the body, robbing you of your good health.

Now, cattle will graze upon GMO Kentucky Bluegrass and people will ingest the RoundUp chemicals sprayed on the cow’s favorite meal.

You can guess who is behind this latest GMO development.

Scotts is Monsanto’s exclusive agent for the marketing and distribution of consumer RoundUp.

We are running out of time to try and get Scott’s from being able to market and sell this latest GMO product. You can sign this petition which will be sent to Hagedorn, along with the CEOs of Lowe’s and Home Depot who are expected to sell the GMO grass.

Read: The GMO Lawn Engineered to Eat Copious Amounts of Pesticides

“…GMO Roundup Ready grass will result in a further increase in the use of Roundup, which will contaminate our groundwater and drinking water. Imagine your children & pets frolicking around in a sea of herbicidal poison. Because of inevitable contamination, the grass is likely to be eaten by grass grazing animals. There has been no toxicity testing and the potential harm to animals eating this GMO grass is unknown. Will we be saying good-bye to pasture raised meat? Lastly, it is a scientific fact that weeds will evolve to develop resistance to Roundup, leading to ever increasing amounts being applied.”

Additionally, you can request that your grocery store only carry certified GMO-free grass-fed beef. The game is changing yet again as biotech tries to infiltrate every conceivable agricultural market on the planet.

While Jim Hagedorn, Chairman & Chief Executive Officer of The Scotts Miracle-Gro Company, is likely doing a happy promenade, those who love their grass-fed beef and rely upon it as a healthier source of meat can kiss it goodbye.

Additional Sources:

Psrast

BusinessInsider

Web.MIT.edu

The US Central Intelligence Agency is frustrated for being asked to train the ISIL terrorist group and at the very same time to combat it, a former CIA contractor says.

Steven D. Kelley made the remarks in a phone interview with Press TV from Anaheim, California, on Thursday.

On Wednesday, the US House approved President Barack Obama’s strategy to train and arm “moderate” militants in Syria to tackle the threat of ISIL. The Pentagon plans to train and arm 5,000 militants in Syria as part of the Obama administration’s long-term strategy to confront ISIL.

“[T]he CIA is being faced with their current task of continuing to arm and train the rebels, which they’ve admitted to doing – the so-called Free Syrian Army , and at the same time being asked to combat the group ISIL, which it is  getting harder and harder for them to mask that it’s essentially the same group,” Kelley said.

“The CIA, of course, are not stupid people. When they are asked to do this task they do it very well. They’ve said they have spent this time training these rebels in Jordan [and] they’re doing a very good job. And now they are being asked to combat these very same rebels and yet they are still being asked to continue with the training in Jordan. It’s almost like they know that if they were to try to attack ISIL, the best things to do is to probably to start with their bases in Jordan,” he added.

The ISIL terrorists, who were initially trained by the CIA in Jordan in 2012 to destabilize the Syrian government, control large parts of Syria’s northern territory. ISIL sent its fighters into Iraq in June, quickly seizing large swaths of land straddling the border between the two countries.

“One thing that should be noted is that even within the CIA, and this is something that most people don’t take into consideration, there are multiple factions. There’s a faction that is more New World Order, and there is the one that is more pro-constitution.  So there’s always going to be that distinction,” he stated.

“But, I think, it’s a matter of logic. You’ve got people that are having a very hard time spinning the same kind of nonsense that the White House seems to be convincing them to produce every day and the CIA is not quite the same at lying quite so well as the White House is,” Kelley noted.

“They [the CIA] are very openly still supporting the very same group that they are trying to combat, and this is why they’re showing such exasperation for being asked to combat the group and at the very same time feeding it with the other hand,” he concluded.

Syria has been gripped by deadly unrest since 2011. According to reports, the United States and its regional allies – especially Qatar, Saudi Arabia, and Turkey – are supporting the militants operating inside the country.

According to the United Nations, more than 190,000 people have been killed and millions displaced due to the turmoil that has gripped Syria for over three years.

The absence of America’s so-called “intelligence” regarding the downing of Malaysia Airlines MH17 over Ukraine in a 34 page Dutch Safety Board preliminary report raises serious questions about the credibility and legitimacy of both America’s political agenda, and all agencies, organizations, and political parties currently behind it.

The report titled, “Preliminary Report: Crash involving Malaysia Airlines Boeing 777-200 flight MH17″ (.pdf), cites a wide variety of evidence in its attempt to determine the cause of flight MH17′s crash and to prevent similar accidents or incidents from occurring again in the future. Among this evidence includes the cockpit voice recorder (CVR), the flight data recorder (FDR), analysis of recorded air traffic control (ATC) surveillance data and radio communication, analysis of the meteorological circumstances, forensic examination of the wreckage (if recovered and possible foreign objects if found), results of the pathological investigation, and analysis of the in-flight break up sequence.

Satellite images are referenced in regards to analyzing the crash site after the disaster, however, no where in the report is mentioned any evidence whatsoever of satellite images of missile launchers, intelligence from the United States regarding missile launches, or any information or evidence at all in any regard suggesting a missile had destroyed MH17. In fact, the report concludes by stating:

This report is preliminary. The information must necessarily be regarded as tentative and subject to alternation or correction if additional evidence becomes available. Further work will at least include the following areas of interest to substantiate the factual information regarding:

  • detailed analyses of data, including CVR, FDR and other sources, recorded onboard the aircraft;
  • detailed analyses of recorded ATC surveillance data and radio communication;
  • detailed analyses of the meteorological circumstances;
  • forensic examination of wreckage if recovered and possible foreign objects, if found;
  • results of the pathological investigation;
  • analyses of the in-flight break up sequence;
  • assessment of the operator’s and State of Occurrence’s management of flight safety over a region of conflict or high security risk;
  • any other areas that are identified during the investigation.

With the black boxes in hand and a wealth of data from multiple sources both onboard the aircraft and from the ground in both Ukraine and Russia, the Dutch Safety Board was still hesitant to draw any conclusions and insisted that none be jumped to.

The report specifically mentions information collected from Russia, including air traffic control and radar data – both of which were publicly shared by Russia in the aftermath of the disaster. The report also cites data collected from Ukraine air traffic controllers. The United States however, apart from providing technical information about the aircraft itself considering it was manufactured in the US, provided absolutely no data in any regard according to the report.

Missing US Intel Points to Fabrications  

4534532Had the US actually possessed any credible information to substantiate its claims that MH17 was shot down by a missile, such evidence surely would have been submitted to and included in the Dutch Safety Board’s preliminary reporting. That it is predictably missing confirms what commentators, analysts, and politicians around the world had long since suspected – the West’s premature conclusions regarding MH17′s demise were driven by a political agenda, not a factually based search for the truth. The evidence that MH17 was shot down by a missile as the West insisted is missing because it never existed in the first place.

That the Dutch Safety Board possesses such a vast amount of information but is still unable to draw anything but the most tentative conclusions, exposes the alleged certainty of Western pundits and politicians in the hours and days after MH17′s loss as an utterly irresponsible, politically motivated, exploitation of tragedy at best, and at worst, exposing the West – NATO in particular – as possible suspects in a crime they clearly stood the most to benefit from.

Fabrications Establish Motive

In the wake of the MH17 tragedy, the West would rush through a series of sanctions against Russia as well as justify further military aid for the regime in Kiev, Ukraine and the literal Neo-Nazi militant battalions serving its pro-Western agenda amid a brutal civil war raging in the country’s eastern most provinces. With sanctions in hand, and the war raging on in earnest, the MH17 disaster dropped entirely out of Western narratives as if it never occurred. Surely if the West had solid evidence implicating eastern Ukrainian rebels and/or Russia, the world would never have heard the end of the MH17 disaster until the truth was fully aired before the public.

When Dutch investigators published their preliminary report, the West merely reiterated its original claims, simply imposing their contradictory nature upon the report – most likely believing the public would never actually read its 34 pages.

For example, Reuters in a report titled, “Malaysia: Dutch report suggests MH-17 shot down from ground,” would brazenly claim:

Malaysia Airlines flight MH17 broke apart over Ukraine due to impact from a large number of fragments, the Dutch Safety Board said on Tuesday, in a report that Malaysia’s prime minister and several experts said suggested it was shot down from the ground.

The title of Reuters’ propaganda piece directly contradicts its first paragraph which reveals “experts,” not the actual Dutch Safety Board report, claimed it was “shot down from the ground,” while the report itself says nothing of the sort. The experts cited by Reuters in fact had no association whatsoever with the preliminary report and instead are the same mainstay of cherry picked commentators the West constantly defers to while building up and perpetuating utterly fabricated narratives to advance its agenda globally.

The lesson to be learned from the MH17 disaster is that real investigations and their subsequent conclusions take time – weeks or even months. Anyone drawing immediate conclusions within hours or days after an event like the MH17 disaster are exploiting tragedy at best, and at worst implicate themselves as suspects having created it in the first place to serve as impetus for further chaos, conflict, and confusion.

Those incapable of resisting the need to jump to conclusions are those who are least suitable to lead. The United States, United Kingdom, and the European Union have proven beyond a shadow of a doubt that they are at best tasteless, irresponsible, politically motivated exploiters of human tragedy, and at worst, the prime suspects of a heinous act of mass murder aimed at perpetuating their agenda of war and carnage in Ukraine and beyond.

Tony Cartalucci, Bangkok-based geopolitical researcher and writer, especially for the online magazine New Eastern Outlook”.

Ideology, Islam and Obama: Going to War on a Misunderstanding

September 19th, 2014 by Binoy Kampmark

“In conclusion, neither ISIS, nor John Kerry nor al-Azhar and certainly not the Saudi ruling dynasty speak on behalf of the ‘true Islam.”  - As’ad AbuKhalil, Sep 15, 2014

They are all rounding it up, but the criticism about the Obama administration’s specific understanding about its cavalry charge against the Islamic State has kept the political scene busy for the last few days.  What, exactly, are the confused members of the White House leadership and staff up to?

Obama’s own statement at issue is that “ISIL is not ‘Islamic’.”  The presumption here is that religions exclude violence, which is tantamount to saying that the religions of the Book were all, from the start, peace loving experiments of the human spirit.  “No religion condones the killing of innocents, and the vast majority of ISIL’s victims have been Muslim.”  The logic, taken to its absurd end, implies that a state like Israel would not be Jewish even as it bombs Gaza to smithereens. This is bound to surprise even the less convinced members of the Knesset.

Obama’s statement on the Islamic State forces involves the usual tender jabs that one has come to expect from Presidential rhetoric, certainly of the weeding sort.  Be careful to delegitimise a political force, not a religion – after all, the Pew Research Centre suggests that Islam is gaining adherents at breakneck speed.

Be careful to highlight the nasty, the impudent and the vicious aspects of the pretenders – for the Obama administration, these people are merely head sawing murderers in fancy dress rather than ideologues with any genuine claim to religious credit.  He doesn’t even want to give them credit for actually being serious.  It is a policy that has currency with such individuals as Alan Noble, co-founder and managing editor of Christ and Pop Culture.  “They depend on ‘the feeling of Muslims that we belong to them’, but if these terrorists are seen as pariahs, heretics, they lose their appeal.”[1]

There is also another point Obama has stressed. He has shown a certain reluctance to use the term “Islamic state”.  “And ISIL is certainly not a state. It was formerly al-Qaeda’s affiliate in Iraq, and has taken strife of sectarian strife and Syria’s civil war to gain territory on both sides of the Iraq-Syrian border.”

Shades of the disastrous American involvement in Vietnam come to mind – one where the war makers in Washington proved deeply unclear about the most basic lexical constructions.  Could it be Viet Cong, Viet-Minh or a trendy nickname?  If one is engaged in a war, it might help to identify some correspondence between word and reality – a disjuncture between the two might excite a numb postructuralist junkie, but hardly a superpower bent on world policing.

Zack Beauchamp, writing in Vox, began a piece with the muddying suggestions of what name to use in this enemy Washington is eager to stop.  “The Islamic State in Iraq and Syria…. wait.  Stop.  I was going to start describing it, but I got hung up on the name. That’s because the question of what to call the militant group operating in Iraq and Syria is extremely controversial.”[2]

Beauchamp also gets excited by what exactly constitutes “al-Sham”, the linguistic limb that seems to be distorting the entire animal that is ISIS or ISIL.  Some in the traditional European orientation go for “the Levant”; Syrian journalist Hassan Hassan suggests that the common Arabic appellation here is narrower – one confined to Syria.

The boffins of the US press establishment have tended to shine in speculation and ignorance.  This is to be expected – if the President bungles, the press will duly follow.  Chuck Todd at Meet the Press thought he had indulged in something of a brainwave when suggesting that Obama prefers ISIL to ISIS for one obvious reason – the former ignores the Syrian sting in the organisation’s tail.[3]  When it came to Rwanda, the Clinton administration avoided the ‘g’ (genocide) word, fearing the pressures of the Genocide Convention. Now, Syria is being avoided like the rhetorical plague.

Harris Faulkner of Fox News offered a zany interpretation on Outnumbered running counter to the trimming version offered by Todd: “Levant is a bigger territory.  That’s why they want to embrace the name and it includes many, many more countries than just Syria.”[4] Sheer, geographically aware genius.

There are legitimate claims that Obama did not merely misstep, but fell flat on his face.

For former M-16 agent Alastair Crooke’s claim is that Obama has stumbled into an ideological morass by hoping to disentangle a type of Islam from, well, a type of Islam.  For one, there is no ‘true Islam’ within the confines of a religion that wears numerous “faces”.[5]

What Obama seems to have missed is that paradox, claims Crooke, of the Wahhabists – that they, in their dead certainties, claim to be the only true Islamists on a rather confused bloc.  The messy is rendered certain, maintained by assumptions of fanatical virtue.  But even more importantly, the protean variations of Islam are repudiated in favour of a clear message.  “Wahhabis claim,” argues As’ad AbuKhalil, “that they represent the ‘true Islam’ when the strength of Islam throughout the ages is that there is no such thing as ‘the true Islam’.”[6]

Such is the point – for AbuKhalil, it is the infantile idea enrapturing American pundits that Islam is easily captured by a spatial, geographical metaphor.  “For Western media, Islam is an office with fancy headquarters where bureaucrats issue fatwas around the clock.” It is no such thing, mind bending in its variability and disagreements, and whole heartedly at odds with notions of a supreme, illuminating truth.  That is not something the President wishes to engage in – after all, Washington is very much an item with those problematic Saudi Wahhabis.  They claim to know something we don’t.

Notes

If you read enough news and watch enough cable television about the threat of the Islamic State, the radical Sunni Muslim militia group better known simply as IS, you will inevitably encounter a parade of retired generals demanding an increased US military presence in the region. They will say that our government should deploy, as retired General Anthony Zinni demanded, up to 10,000 American boots on the ground to battle IS. Or as in retired General Jack Keane’s case, they will make more vague demands, such as for “offensive” air strikes and the deployment of more military advisers to the region.

But what you won’t learn from media coverage of IS is that many of these former Pentagon officials have skin in the game as paid directors and advisers to some of the largest military contractors in the world. Ramping up America’s military presence in Iraq and directly entering the war in Syria, along with greater military spending more broadly, is a debatable solution to a complex political and sectarian conflict. But those goals do unquestionably benefit one player in this saga: America’s defense industry.

Keane is a great example of this phenomenon. His think tank, the Institute for the Study of War (ISW), which he oversees along with neoconservative partisans Liz Cheney and William Kristol, has provided the data on IS used for multiple stories by The New York Timesthe BBC and other leading outlets.

Jack Keane (Screenshot: Fox News)

Keane has appeared on Fox News at least nine times over the last two months to promote the idea that the best way to stop IS is through military action—in particular, through air strikes deep into IS-held territory. In one of the only congressional hearings about IS over the summer, Keane was there to testify and call for more American military engagement. On Wednesday evening, Keane declared President Obama’s speech on defeating IS insufficient, arguing that a bolder strategy is necessary. “I truly believe we need to put special operation forces in there,” he told host Megyn Kelly.

Left unsaid during his media appearances (and left unmentioned on his congressional witness disclosure form) are Keane’s other gigs: as special adviser to Academi, the contractor formerly known as Blackwater; as a board member to tank and aircraft manufacturer General Dynamics; a “venture partner” to SCP Partners, an investment firm that partners with defense contractors, including XVionics, an “operations management decision support system” company used in Air Force drone training; and as president of his own consulting firm, GSI LLC.

To portray Keane as simply a think tank leader and a former military official, as the media have done, obscures a fairly lucrative career in the contracting world. For the General Dynamics role alone, Keane has been paid a six-figure salary in cash and stock options since he joined the firm in 2004; last year, General Dynamics paid him $258,006.

Keane did not immediately return a call requesting comment for this article.

Disclosure would also help the public weigh Keane’s policy advocacy. For instance, in his August 24 opinion column for The Wall Street Journal, in which he was bylined only as a retired general and the chairman of ISW, Keane wrote that “the time has come to confront the government of Qatar, which funds and arms IS and other Islamist terrorist groups such as Hamas.” While media reports have linked fundraisers for IS with individuals operating in Qatar (though not the government), the same could be said about Saudi Arabia and Kuwait, where many of the major donors of IS reportedly reside. Why did Keane single out Qatar and ignore Saudi Arabia and Kuwait? Is it because his company, Academi, has been a major business partner to the United Arab Emirates, Qatar’s primary rival in the region?

Other examples abound.

Anthony Zinni (Screenshot: Charlie Rose)

In a Washington Post story about Obama’s decision not to deploy troops to combat IS, retired Marine General James Mattis was quoted as a skeptic. “The American people will once again see us in a war that doesn’t seem to be making progress,” Mattis told the paper. Left unmentioned was Mattis’s new role as Keane’s colleague on the General Dynamics corporate board, a role that afforded Mattis $88,479 in cash and stock options in 2013.

Retired General Anthony Zinni, perhaps the loudest advocate of a large deployment of American soliders into the region to fight IS, is a board member to BAE Systems’ US subsidiary, and also works for severalmilitary-focused private equity firms.

CNN pundit Frances Townsend, a former Bush administration official, has recently appeared on televisioncalling for more military engagement against IS. As the Public Accountability Initiative, a nonprofit that studies elite power structures, reported, Townsend “holds positions in two investment firms with defense company holdings, MacAndrews & Forbes and Monument Capital Group, and serves as an advisor to defense contractor Decision Sciences.”

Fran Townsend (Screenshot: CSPAN)

“Mainstream news outlets have a polite practice of identifying former generals and former congress members as simply ‘formers’—neglecting to inform the public of what these individuals are doing now, which is often quite pertinent information, like that they are corporate lobbyists or board members,” says Jeff Cohen, an associate professor of journalism at Ithaca College.

Media outlets might justify their omissions by reasoning that these pundits have merely advocated certain military strategies, not specific weapons systems, so disclosure of their financial stake in the policy need not be made. Yet the drumbeat for war has already spiraled into calls for increased military spending that lifts all boats—or non-operational jets for that matter.

When the Pentagon sent a recent $2 billion request for ramped-up operations in the Middle East, supposedly to confront the IS issue, budget details obtained by Bloomberg News revealed that officials asked for money for additional F-35 planes. The F-35 is not in operation and would not be used against IS. The plane is notoriously over budget and perpetually delayed—some experts call it the most expensive weapon system in human history—with a price tag now projected to be over $1 trillion. In July, an engine fire grounded the F-35 fleet and again delayed the planned debut of the plane. How it ended up in the Pentagon’s Middle East wish list is unclear.

“I think an inclination to use military action a lot is something the defense industry subscribes to because it helps to perpetuate an overall climate of permissiveness towards military spending,” says Ed Wasserman, dean of the UC Berkeley Graduate School for Journalism. Wasserman says that the media debate around IS has tilted towards more hawkish former military leaders, and that the public would be best served not only with better disclosure but also a more balanced set of opinions that would include how expanded air strikes could cause collateral civil casualties. “The past fifty years has a lot of evidence of the ineffectiveness of air power when it comes to dealing with a more nimble guerrilla-type adversary, and I’m not hearing this conversation,” he notes.

The pro-war punditry of retired generals has been the subject of controversy in the past. In a much-cited 2008 exposé, The New York Times revealed a network of retired generals on the payroll of defense contractors who carefully echoed the Bush administration’s Iraq war demands through appearances on cable television.

The paper’s coverage of the run-up to a renewed conflict in the region today has been notably measured, including many voices skeptical of calls for a more muscular military response to IS. Nonetheless, the Times has relied on research from a contractor-funded advocacy organization as part of its IS coverage. Reports produced by Keane’s ISW have been used to support six different infographics used for Times stories since June. The Times has not mentioned Keane’s potential conflict of interest or that ISW may have a vested stake in its policy positions. The Public Accountability Initiative notes that ISW’s corporate sponsors represent “a who’s who of the defense industry and includes Raytheon, SAIC, Palantir, General Dynamics, CACI, Northrop Grumman, DynCorp, and L-3 Communication.” As the business network CNBC reported this week, Raytheon in particular has much to gain from escalation in Iraq, as the company produces many of the missiles and radar equipment used in airstrikes.

In addition to providing reports and quotes for the media, ISW leaders have demanded a greater reaction to IS from the Obama administration. In The Weekly Standard this week, ISW president Kim Kagan wrote that President Obama’s call for a limited engagement against IS “has no chance of success.”

ISW’s willingness to push the envelope has gotten the organization into hot water before. In 2013, ISW suffered an embarrassing spectacle when one of its analysts, Elizabeth O’Bagy, was found to have inflated her academic credentials, touting a PhD from a Georgetown program that she had never entered.

But memories are short, and the media outlets now relying heavily on ISW research have done little to scrutinize the think tank’s policy goals. Over the last two years, ISW, including O’Bagy, were forcefully leading the push to equip Syrian rebels with advanced anti-tank and anti-aircraft weaponry to defeat Bashar al-Assad.

For Keane, providing arms to Syrian rebels, even anti-American groups, was a worthwhile gamble. In an interview with Fox Business Network in May of last year, Keane acknowledged that arming Syrian rebels might mean “weapons can fall into radical Islamists’ hands.” He continued,

“It is true the radical Islamists have gained in power and influence mainly because we haven’t been involved and that is a fact, but it’s still true we have vetted some of these moderate rebel groups with the CIA, and I’m convinced we can—it’s still acceptable to take that risk, and let’s get on with changing momentum in the war.”

That acceptable risk Keane outlined has come to fruition. Recent reports now indicate that US-made weapons sent from American allies in the region to Syrian rebels have fallen into the hands of IS.

Keane, and ISW, is undeterred. The group just put out a call for 25,000 ground troops in Iraq and Syria.

I’ve been rovin’ around Europe for a while and the star of the show is definitely The Caliph. Former Abu Bakr al-Baghdadi has totally outstripped Vladimir Putin as Doctor Evil of the hour. Where’s a good ol’ Cold War 2.0 when you need it? Well, upstaged by the Pentagon’s “long war” – our familiar GWOT (Global War on Terror).

First Obama promised there would be no ground troops to fight The Caliph- as in a re-invasion of Iraq. Then General Martin Dempsey, chairman of the Joint Chiefs of Staff, said that if the current gambit of Obama’s self-defined “Don’t do Stupid Stuff” foreign policy doctrine does not work – and it won’t – he’ll go for ground troops, embedded or otherwise.

Right on cue, The Caliph went to Hollywood, releasing the trailer of The Caliphate’s upcoming mega-production, Flames of War. It looks like it was directed by Michael Bay (Fall, 2014). Will that go straight to Netflix?

You just can’t beat the Marvel Comics school of geopolitics.

Confide in me, baby 

Meanwhile, in Paris, President General Francois Hollande is itching to deploy his Rafales and get into a new war – considering that’s about the only thing that could lift the mood of a wretched president, whose administration has barely survived a “confidence” vote; compare that “confidence” with the nasty epithets with which his team is showered by largely unemployed, taxed to death or swamped by red tape Parisians.

Obama has already sent 475 extra military “advisers” to Baghdad and Iraqi Kurdistan. There are at least 1,600 US military already on the ground in Iraq. That’s how Vietnam started. The CIA, supported by unmatched ground intel, swears there are exactly 31.785 jihadis fighting for The Caliph. Well, roughly. Two-thirds of these are supposed to be in Syria. So the new war, in fact, is all across “Syraq”. Or what The Caliph calls IS, Islamic State, his own private emirate.

The no less meticulous Dempsey, for his part, is sure it will take up to five months to train and weaponize a new bunch of “moderate” rebels to fight the Caliph. Wait a minute; foolish global public opinion was supposed to believe the previous “moderate” rebels – supported by Qatar – would one day fulfill the “Assad must go” Obama mandate. Well, they didn’t.

“Our” bastards at the petrodollar racket known as GCC (Gulf Cooperation Council) have duly promised to help Obama’s new war, alongside Egypt, Jordan, Lebanon and Iraq. Turkey will only get involved in the “humanitarian” front – while allowing smuggled oil sold by The Caliph’s goons into its territory.

The members of the wretched Arab League have solemnly promised to be “determined” in cutting off the flux of weapons and cash to The Caliph show. Yet they would never have the balls of the Kurdish peshmerga, who have just killed the Mosul chief of IS. This kind of ground intel, plus following the money, as in the oil smuggling routes, would finish off the Caliphate in no time. But that’s not what endless GWOT is all about.

Caliph, give us a hand 

With such an array of Hollywood thrills on show, who cares about Ukraine? Well, it may have been snuffed out of the news cycle after the latest nasty package of US/EU sanctions, but it’s back in the spotlight this Thursday, as Ukrainian oligarch turned president Petro Poroshenko visits The Caliph’s nemesis in Washington.

So expect a frantic rerun of Evil Empire rhetoric – plus ample indignation caused by the Russian “invasion” of Ukraine. That will last barely a day. “Don’t Do Stupid Stuff” changes its tune like surfing on iTunes. And the tune now is the “Syraq” offensive; yet another Obama “kinetic” operation, Billy Idol’s Rebel Yell remixed.

That leaves plenty of space for US Think Tankland to carp that Russia “aggression” will profit from the new tune to “advance” in Central and Eastern Europe, and the China “threat” will profit to “dominate” the Western Pacific. So what’s more crucial for the Empire of Chaos; Russia, China or “Syraq”? They don’t have a clue. They are just trying not to do “stupid stuff”.

For all that volcanic Beltway paranoia, the Big Picture in the long run spells out Moscow expanding its Pipelineistan nodes throughout Eastern Europe all the way to Western Europe, thus enlarging, commercially, its “soft” zone of influence. No “invasion” required.

On Ukraine, the Big Picture spells out the European Union mired in a horrendous crisis, under a third recession in five years, obviously without the cash, not to mention the will, to pay Ukraine’s humongous bills. Sooner – with negotiations starting this Saturday in Berlin – or later the EU will have to find an accommodation with Moscow to guarantee its precious gas supplies.

That leaves warmongering NATO – as in the EU under the Pentagon’s thumb. All rhetoric about that puny “rapid reaction force” aside, the fact is that the North Atlantic Treaty Organization won’t have the balls to confront Russia, via troops deployed in Ukraine. And there will be no Obama “Stupid Stuff” aerial bombing of federalists in Donbass – as if Russophones in Ukraine defending their land and their language against a form of slow motion ethnic cleansing could be compared to The Caliph’s multinational goons in “Syraq”. US public opinion very well knows – well, maybe not – that people in Donbass are not threatening to cross into El Paso tomorrow.

So much hard work to pivot from GWOT to the Big Boys in Eurasia. So little time – and competence. The Caliph’s goons have announced on the record they would go for beheading Putin. If only the Pentagon would subcontract the job.

Pepe Escobar is the author of Globalistan: How the Globalized World is Dissolving into Liquid War (Nimble Books, 2007), Red Zone Blues: a snapshot of Baghdad during the surge (Nimble Books, 2007), and Obama does Globalistan (Nimble Books, 2009).

Ukrainian President Poroshenko in Washington

September 19th, 2014 by Stephen Lendman

previous article discussed his three-day North American tour. His illegitimacy doesn’t matter.

Nor his hardline anti-democratic fascist ideology, lawlessness or war without mercy against Ukrainian citizens.

He was treated like visiting royalty. Obama warmly greeted him at the White House. In late August, press secretary Josh Earnest issued a statement saying:

“President Obama will host President Petro Poroshenko of Ukraine at the White House on Thursday, September 18.”

“The visit will highlight the United States’ firm commitment to stand with Ukraine as it pursues democracy, independence, and stability.”

“President Obama looks forward to discussing with President Poroshenko efforts to pursue a diplomatic resolution to the crisis in eastern Ukraine as well as our continued support for Ukraine’s struggle to defend its sovereignty and territorial integrity.”

On September 18, Earnest reaffirmed US support, saying:

“The United States is firmly committed to supporting Ukraine as it works to establish security and stability, respond to humanitarian and reconstruction needs, conduct democratic elections and carry out constitutional reforms, restore its economy, and combat corruption.”

“Along with our international partners, including the IMF, the United States is committed to supporting Ukraine’s reform agenda while also ensuring that Ukrainians are able to determine their future without intimidation or outside coercion.”

Obama gave Poroshenko new security guarantees. Poroshenko asked for them. Especially ones related to “defense.” He “received a positive answer,” he said.

Both countries partner against democratic freedoms. Ukraine’s fascist government excludes them.

It prohibits democracy. It’s verboten. Illegitimate hardline rule prevails.

Obama supports, encourages and demands anti-democratic governance.

He presides over America’s police state apparatus. He wants Ukraine governed the same way.

He wants its economy crippled under IMF debt bondage. The late Bob Chapman once said “(t)he idea is to bring on perpetual economic and financial crisis so that the IMF’s work is never completed.”

Crippled economies masquerade as stable ones. “The IMF (is) the New World Order’s Gestapo.”

It “sets up formerly sovereign states as supplicant members of (US-controlled) world government.”

Washington’s “goal is a world bank to control all nations monetarily and financially.”

“Every major event is planned as are many smaller ones.”

“Nothing is ever as it seems to be.” Reality is polar opposite proliferated myths. Monied interests run things.

America bears full responsibility for global wars, instability, insecurity and human misery. Its Western partners, Israel and other rogue allies share it.

It’s way too late for scattered reforms. Major change is needed. Ordinary people have power when they use it.

Nonviolent disruptive power works best. Electoral politics doesn’t work. Rare exceptions prove the rule.

The late Chicago community organizer Saul Alinsky (1909 – 1972) once said the best way to beat organized money is with organized people.

It’s always bottom up. It’s never top down. It’s verboten in Ukraine and America. Their political systems are too corrupted to fix.

They show how power corrupts and absolute power does so absolutely.

On September 18, Poroshenko addressed a joint session of Congress. He lied suggesting Ukraine is “on the forefront of the global fight for democracy.”

He ludicrously claimed “freedom…is at the core of (its) existence today.”

He called Washington’s coup elevating fascist putschists to power “the most heroic story of the last decade.”

It showed “sacrifice, dedication and the unbreakable will to live free,” he claimed.

“The defenders of freedom were willing to sacrifice their lives for the sake of a better future.”

He claimed they did it with “sticks and shields.” He ignored Western trained neo-Nazi Ukrainian snipers murdering dozens of Maidan police and ordinary people.

Over 100 died. They were killed in cold blood. Washington’s dirty hands orchestrated what happened.

Poroshenko referred to the “Heavenly Hundred.”

“We revere them as true national heroes,” he said. They’re not martyrs. They’re victims of fascist viciousness.

Poroshenko didn’t explain. Nor his US or other Western partners. MSM scoundrels regurgitate official Big Lies.

Poroshenko’s address repeated one after another. Truth was systematically buried.

Congress wholeheartedly approves. So does Obama and top administration officials.

Poroshenko turned truth on its head claiming Russia invaded Ukraine. It’s waging war, he said. It “brought (the country) to the brink of its survival.”

You can’t make this stuff up. Truth is polar opposite Poroshenko’s Big Lies. He gets marching orders from Washington.

He salutes and obeys. Ukraine is America’s newest colony. Poroshenko is a convenient stooge leader.

He serves at Washington’s discretion. He’ll continue doing so as long as he remembers who’s boss.

He asked Congress “not to let Ukraine stand alone in the face of (nonexistent Russian) aggression.”

America committed to “stand behind Ukraine’s territorial integrity.”

“Democracies must support each other,” he said. “They must show solidarity in the face of aggression and adversity.”

“The (nonexistent) aggression against Ukraine has become one of the worst setbacks for the cause of democracy in the world in years.”

“The outcome of today’s war will determine whether we will be forced to accept the reality of a dark, torn, and bitter Europe as part of a new world order.”

Young Ukrainian army recruits “are the only thing that now stands between the reality of peaceful coexistence and the nightmare of a full relapse into the previous century and a new cold war,” he claimed.

War they’re “fighting today is not only Ukraine’s war.”

“It is Europe’s, and it is America’s war, too. It is a war of the free world – and for a free world!”

Poroshenko shamelessly claimed “Russian aggression” threatens “global security everywhere.”

“If they are not stopped now, they will cross European borders and spread throughout the globe.”

It bears repeating. You can’t make this stuff up. Poroshenko’s Big Lies didn’t rise to the level of bad fiction.

He asked Congress for more military support. He met with John Kerry. He got pledges to supply it.

According to Ukraine’s National Radio Company, Washington will provide “$350 million worth of military (and) technical assistance in 2015.”

It includes “anti-tank weapons, counter-artillery radars, unmanned aerial vehicles, and communications equipment.”

“This is stated in a bill posted on the Web site of the U.S. Senate Committee on Foreign Relations, which was filed on September 17 by U.S. Senators Robert Menendez and Bob Corker.”

“The document is to be tabled by the Senate Foreign Relations Committee on Thursday just hours after Ukrainian President Petro Poroshenko addresse(d) a joint meeting of Congress.”

He thanked Washington for aid supplied. “Ukraine has the right to defend her territory,” he said. He “urge(d) America to lead the way!”

He ludicrously claimed Ukraine “always had a special bond” with America. Today it’s Washington’s “natural and consequential” regional partner.

It’s not “circumstantial,” he said. We’re “in the same boat,” he added.

At a time of “existential crisis, Ukraine’s choice was the same as America’s: freedom, democracy, and the rule of law,” he claimed.

It bears repeating what other articles stressed. Ukraine is the epicenter of European fascist reemergence.

Its lawlessness, belligerent, anti-democratic and fascist. Its no-holds-barred barbarity matches some of the world’s worst.

Its egregious human rights record reveals its dark side. Police state ruthlessness is official policy. So is state terror. War on fundamental freedoms persist.

Ukrainian democracy is pure fantasy. Fascist thugs run things. They represent mob rule. Unchecked power defines them.

They’re ruthless. They tolerate no opposition. It’s systematically eliminated.

Rogue states operate this way. Putschist ones have no legitimacy. Ukraine is one of the worst.

Washington provides wholehearted support. It encourages Kiev’s high crimes. It funds them.

It wants democracy advocates entirely eliminated. Vicious state terror tactics target them ruthlessly.

Western propaganda suppresses reality. Illegitimate putschist power is called democracy.

Mass murder is called self-defense. Freedom-fighting democrats are called “terrorists.”

Poroshenko wants more military aid. Southeastern Ukrainian self-defense forces battered Kiev’s troops.

They’re in disarray. They’re regrouping. They’re preparing for more conflict.

Ukraine needs “a strong army,” Poroshenko claimed.

“I see it as my utmost duty to rectify the damage done to the Ukrainian military and to give Ukraine a strong, modern army that we can be proud of.”

To wage premeditated naked aggression. To brutalize Ukrainian citizens.

To commit more mass murder. To tolerate no opposition.

To crush democracy advocates once and for all. To institutionalize fascist rule.

To ally with Washington and rogue EU partners against Russia. To risk East/West confrontation in the process.

Poroshenko urged closer US/Ukrainian military ties. He wants “special security and defense status.”

Receiving it means the “highest level of interaction with a non-NATO ally.”

In November 2002, a NATO/Ukraine Action Plan was instituted.

In February 2005, Ukraine became the first post-Soviet Commonwealth of Independent States (CIS) nation to join NATO’s Partnership for Peace initiative.

In April 2005, it joined NATO’s Intensified Dialogue program.

In March 2008, it sent an official Membership Action Plan (MAP) application letter to Brussels.

It’s the first step to joining NATO. Washington supports it later. Not now. So do other key NATO member states.

Russia categorically opposes incorporating Ukraine into the Alliance. Both nations share a nearly 1,500 mile land and sea border.

Moscow won’t tolerate US-controlled NATO bases on its borders. Or encroaching multiple nuclear armed long-range missiles targeting its heartland.

It calls Ukrainian NATO membership “a direct (national security) threat.” It does so for good reason.

After his 2010 reelection, then Ukrainian President Viktor Yanukovych called Kiev/NATO relations “well-defined.”

He saw no reason for Ukraine to join NATO. Membership might “emerge at some point,” he explained.

“(W)e will not see it in the immediate future,” he stressed. Ukraine would remain a “European non-aligned state,”

On June 3, 2010, Ukraine’s parliament excluded “integration into Euro-Atlantic security and NATO membership.”

It prohibited Ukrainian membership in any military bloc. It permitted cooperation alone with ones like NATO.

That was then. This is now. Poroshenko and Washington intend incorporating Ukraine into NATO.

Expect it at America’s discretion. Expect strong Russian opposition. It remains to be seen precisely how Moscow will react.

Ukraine is its red line. Putin won’t let it be crossed. He won’t compromise Russia’s security.

His strategy will be revealed in the fullness of time. It bears repeating what other articles stressed.

America’s quest for unchallenged global dominance threatens humanity.

Potential East/West confrontation looms. World peace hangs by a thread.

Stephen Lendman lives in Chicago. He can be reached at [email protected]. His new book as editor and contributor is titled “Flashpoint in Ukraine: US Drive for Hegemony Risks WW III.” http://www.claritypress.com/LendmanIII.html Visit his blog site at sjlendman.blogspot.com.

Listen to cutting-edge discussions with distinguished guests on the Progressive Radio News Hour on the Progressive Radio Network. It airs three times weekly: live on Sundays at 1PM Central time plus two prerecorded archived programs.

Israeli Incremental Genocide

September 19th, 2014 by Jamal Kanj

It goes without saying that Gaza has taught the Israeli military a new lesson: the days of swift Israeli wars are over. While mostly one-sided, Israel has never before fought a war that lasted 50 days. The Palestinians (besieged by brothers and foes) were of no military match to Israel’s most sophisticated US technology. But as in 2006 Lebanon war, the human factor rendered the best technology obsolete.

There were many parallels between summer 2006 and current war. Regretfully, in both cases, Israeli wanton destruction was received with indifference from the official Arab regime system.

It is no secret that some Arab governments were more interested in seeing Hizbollah degraded in 2006 than protecting innocent Lebanese civilians. In the last two months, the official Arab regime too disliked Hamas more than they cared about Palestinian life.

This time in Gaza, and unlike the last two confrontations in 08/09 and November 2012 – Palestinians seemed united at the negotiation table and on the battlefield. Ultimately, forcing the Egyptian mediator to back off from imposing the Israeli conditions and address the core issue that caused this war: the years old Israeli military blockade on Gaza.

After reaching ceasefire, Israeli Prime Minister Benjamin Netanyahu took the airwaves proclaiming winning the war. On the other side, Palestinians took to the streets celebrating the end of Israeli aggression and their victory.

It is definitely debatable as to who won the war. If winning is to be measured by the number of civilians killed and the damage left behind, Israel is by far the winner. If winning or losing was measured by objectives, Israel was undoubtedly the bigger loser.

For Israeli attempts to weaken Hamas has failed. Hamas which saw decline in its popularity before the war gained impressive approbation in most recent polling. The organisation was persona non grata in Egypt, but now it appeared to have reconciled with the regime.

Just like the Israeli war against Lebanon in 2006 where instead of weakening Hizbollah, the war propelled the party to become a major power-broker in local politics and emerged as a regional force to contend with.

In Gaza, the well-pampered Israeli soldiers were not prepared for the new tactics and the intricate underground fortification systems. In the face-to-face combat and as technology becomes useless, the craven Israeli soldier was of no match to the more determined Palestinian fighter.

According to eye witness accounts reported in the online Daily Beast last week, one fighter codenamed Abu Muhammad described the underground war, “First we targeted the tanks and the jeeps with IEDs. Some of our people would come out of the ground, attack the soldiers and then disappear back into a tunnel and others surprised them from empty houses.”

Following heavy military losses, Netanyahu ordered his army to withdraw. He pulled his negotiation team from Cairo and insisted no ceasefire unless Israel’s conditions for the invasion were met: disarmament of Gaza, return the remains of the purportedly dead Israeli soldiers and destruction of underground fortifications.

After Netanyahu’s ceasefire terms were rejected, Israel intensified its air raids against civilians targeting homes of supposed Palestinian leaders and levelled large residential towers. Facing defiant Palestinians and his demoralised public, Netanyahu was forced eventually to accept a ceasefire including the easing of the military siege on Gaza.

It is delusional however to believe for a moment that Israel would honour its obligations under the ceasefire agreement. Losing in public polling, Netanyahu is predisposed to tighten, not ease the military blockade, in order to placate his right wing voters.

Meanwhile, Netanyahu lies to his people about winning a war without achieving one single objective and deceives the world with a ceasefire while maintaining a silent war of special “starvation diet” and carrying out “incremental genocide” against more than 1.7 million human beings.

Mr Kanj (www.jamalkanj.com) writes regular newspaper column and publishes on several websites on Arab world issues. He is the author of “Children of Catastrophe,” Journey from a Palestinian Refugee Camp to America. A version of this article was first published by the Gulf Daily News newspaper.

Wendy Sherman is Under Secretary of State for Political Affairs. On September 16, she spoke at Georgetown University.

She claimed Washington “cares about the Middle East because of (its) economic, political, and security interests…”

“Its rich spiritual and ethnic traditions…” It’s Israel’s home and America’s Gulf partners.

It’s “where values we cherish are under intense strain.” Washington “is alarmed and moved to act by the upheaval” roiling the region.

America “must show the way.”

Fact check

America covets Middle East oil. It wants unchallenged regional control.

It wants independent governments toppled. It wants pro-Western vassal states replacing them.

It wants Israeli rivals removed. It wants democracy avoided at all costs.

America’s cherished values include wealth, power and privilege alone. It doesn’t give a damn about “rich spiritual and ethnic traditions.” It never did. For sure not now.

Sherman regurgitated Big Lies Obama repeated one after another in his September 10 address.

Great powers honor their commitments and principles, she said. We’ll “move forward…to end conflicts,” she claimed.

We’ll

“improve governance; increase economic opportunities; highlight the value of education; and enhance respect for democratic institutions, including freedom of the press, religious liberty, human rights, and the rule of law.”

“America’s policy is to assist those who believe, as we do, that people of different nationalities, ethnicities and creeds can live alongside one another constructively and in peace.”

Longstanding US regional and global policies are polar opposite Sherman’s Big Lies.

She repeated one after another. She sounds like her boss (John Kerry), Obama, and other top administration officials.

Permanent war is official US policy. Escalating it is planned. ISIS “fighting has just begun,” it says.

It’s gaining new recruits at a remarkable clip. They’re US shock troops against Assad.

Its proxy army. Its dagger against legitimate Syrian governance. Its regime change plan.

TheNational is an Abu Dhabi, UAE English languish daily broadsheet.

On September 17, it headlined “Rebels on Syria’s southern front ‘closer to the doorstep of Damascus,’ ” saying:

“Western and Arab military advisers based in Amman have quietly stepped up their role on Syria’s southern front, helping win recent advances for opposition factions.”

“After weeks of heavy fighting, rebel groups announced the seizure of 80 per cent of Qunietra province on Saturday, including areas along the border with Israel.”

Doing so can aid southern-based ISIS, Jabhat al-Nusra, Al Qaeda and likeminded groups advance north to Damascus.

They could establish reliable supply routes. They’ll be able to aid other opposition groups on Damascus’ Southern and Western fronts.

Seizing Damascus is key to toppling Assad. Opposition commanders say increased Southern Syria international support they’re getting is crucial in aiding their latest advances.

According to one unnamed anti-Assad commander:

“Efforts to bring us together on the southern front have been inconsistent but all countries are moving in that direction.”

“They now want us united and those efforts have been reflected on the outcome of recent battles, including the latest in Qunietra.”

“We are now more organized and this is reflected in our work and the implementation of our plans.”

“There is a centralized command, which is giving better results. Things are more under control.”

Changes unfolded gradually since June. They’re coincidental with increasing ISIS, Jabhat al Nusra and Al Qaeda strength.

According to another opposition commander:

“There is increased cooperation (among) countries supporting Syria, and increased cooperation among rebel factions.”

“There are also promises of quality weapons, and of increased amounts or weaponry, although we have not seen deliveries yet.”

Opposition groups believe things in southern areas are shifting their way.

According to Deraa-based anti-Assad commander Col. Nijem Abu Al Majd:

“We see this as a turning point in our operations in the south. We have control over most of the key areas and have destroyed two important regime army brigades.”

So-called Syrian National Coalition (SNC) “moderates” called rebel progress a “strategic victory.”

They’re “closer to the doorsteps of Damascus,” they say.

Former Syrian Air Force Brig. General Assad Al Zaubi called captured Qunietra one of the most important victories since conflict began in the south.

“It helps the rebels in southern Syria create a direct line to the south-western countryside of Damascus,” he said.

“They now have made at least a partial connection to the outskirts of Damascus.”

They “now have more room for maneuver in southern Syria, while the regime’s presence and mobility has been seriously diminished,” he claims.

Moon of Alabama (MoA) reported the above information. It did so two days earlier.

It explained what should be widely reported. Jabhat al-Nusra and other anti-Syrian forces are trained and equipped at the Amman-based Arab/American Military Operations Command (MOC) center.

US special forces and CIA operatives are heavily involved. So is Israel in supporting extremist anti-Assad rebel groups.

Opposition groups moved into Quneitra governate. It’s in Southwest Syria. A partially executed spring 2013 plan began. It was later aborted.

“Quneitra governate is a strip next to the Israel occupied Golan heights with a southern border to Jordan and a north western border with Lebanon,” said MoA.

Anti-government forces cooperated against Assad. Seven rebel groups comprising the Islamic Front aided them.

Washington backed them. So did Saudi Arabia. Qatar supplied $20 million.

Combined forces infiltrated through Daara. They moved northwest along Israel’s border. The IDF supplied artillery support against Syrian units.

It’s providing medical treatment for injured opposition fighters. UN authorities evacuated peacekeepers from “the Syrian side of the Golan Heights demarcation line,” said MoA.

Rebels control the one Israeli/Syrian border crossing. They “control a 40 miles long, three miles wide strip…”

It runs “from Jordan along the Golan frontier up to Lebanon.” It may be used to launch attacks on Damascus from the south. It’s a short 40 miles away.

Syria won’t easily contest these anti-government forces. Israeli “anti-air and artillery fire” support them.

Obama intends bombing Syria. Doing so could open a route from Quneitra governate to Damascus. According to MoA:

“Recent truce agreements between the US supported Syrian Revolutionary Front and ISIS in the area south of Damascus may have been concluded with these attack plans in mind.”

Combined air and ground attacks could “seriously degrade” Syrian forces. Doing so could facilitate a “destructive push into Damascus.”

If Assad’s forces attack US warplanes entering Syrian airspace, it’ll be pretext for Obama to wage all-out war.

He’ll claim just cause to do it. He’ll get away with it because who’ll stop him.

He’ll ravage and destroy Syria more than already. He’ll go all-out to oust Assad. Israel partners with Washington to do it.

It attacked Syria sporadically for years. It’s doing it again now. It actively aids opposition fighters.

It protects them from Syrian government attacks. Its forces need to counterattack in Quneitra.

If southern approaches to Damascus aren’t secured, Israeli-protected opposition forces could advance toward Damascus.

Perhaps seize part of the city. Use it to launch more aggressive attacks.

Seizing surrounding areas would be catastrophic. Losing Damascus would be worst of all.

It would be game changing. It could turn Syrian victory into defeat. It could end up ousting Assad.

It would mean replacing him with pro-Western stooge governance. It would eliminate another Israeli rival.

It would isolate Iran. It would be disastrous for ordinary Syrians.

It would give America another regional colony. It would advance it closer to total Middle East control.

Hopefully it won’t happen. It’s vital to prevent it. The fullness of time alone will tell either way.

A Final Comment

On Wednesday, House Republicans and Democrats voted 273 – 156 to support anti-Assad groups. They did so without approving funding.

They authorized Obama to arm and train rebel fighters. To accept foreign financing. To wage war on Syria short of full authorization of force.

According to House Minority Leader Nancy Pelosi (D. CA):

Legislation enacted “is not to be confused with any authorization to go further. I will not vote for (US) combat troops to be engaged in war.”

She stopped short of expressing support for Obama’s planned bombing campaign. Failure to oppose it means backing what demands preventing.

Rep. Barbara Lee (D. CA) expressed thoughts few House or Senate members explain.

She called enacted legislation “more complex than just an up-or down vote on arming and training” anti-Assad forces.

“The consequences of this vote, whether it’s written in the amendment or not, will be a further expansion of a war currently taking place and” Washington’s involvement in it.

Congress moved one step closer toward approving Washington’s direct involvement in Obama’s three-and-a-half year proxy war.

They did it despite bipartisan misgivings about chances for success. They’re concerned about another war dragging on for years.

About one with no clear strategy to win. Or what happens when conflict ends. In a statement after the House vote, Obama said:

“There will be no US military personnel in Syria as part of this program.”

“We’ve learned over the last decade, and through our successful campaign to degrade al-Qaeda, that it is more effective to use America’s unique capabilities to take out terrorist targets in support of our partners’ efforts on the ground to secure their own future.”

Amendment legislation was part of a short-term spending bill. It lets Washington operate through mid-December.

On Thursday, Senate members are expected to approve similar legislation.

Obama declared war on Syria. The Islamic State is the pretext. Syria is the target. Regime change is the objective.

It’s replacing governance the vast majority of Syrians support. It’s replacing it with what they deplore.

What they won’t tolerate. What they’ll contest to control their own lives, welfare and futures.

They’re up for grabs. Obama’s war on humanity threatens them. They’re in the eye of the storm.

Their survival depends on confronting Obama’s aggression. Stopping it matters most of all.

Stephen Lendman lives in Chicago. He can be reached at [email protected]. His new book as editor and contributor is titled “Flashpoint in Ukraine: US Drive for Hegemony Risks WW III.” http://www.claritypress.com/LendmanIII.html Visit his blog site at sjlendman.blogspot.com. Listen to cutting-edge discussions with distinguished guests on the Progressive Radio News Hour on the Progressive Radio Network. It airs three times weekly: live on Sundays at 1PM Central time plus two prerecorded archived programs.

A Losing Bet

In 2011, the New York Times wrote:

“Money is pouring in” from investors even though shale gas is “inherently unprofitable,” an analyst from PNC Wealth Management, an investment company,  wrote to a contractor in a February e-mail. “Reminds you of dot-coms.”

“The word in the world of independents is that the shale plays are just giant Ponzi schemes and the economics just do not work,” an analyst from IHS Drilling Data, an energy research company,  wrote in an e-mail on Aug. 28, 2009.

***

“And now these corporate giants are having an Enron moment,” a retired geologist from a major oil and gas company  wrote in a February e-mail about other companies invested in shale gas.

***

Deborah Rogers, a member of the advisory committee of the Federal Reserve Bank of Dallas, [and a]  former stockbroker with Merrill Lynch … showed that wells were petering out faster than expected.

“These wells are depleting so quickly that the operators are in an expensive game of ‘catch-up,’ ” Ms. Rogers wrote in an e-mail on Nov. 17, 2009, to a petroleum geologist in Houston, who wrote back that he agreed.

***

A review of more than 9,000 wells, using data from 2003 to 2009, shows that — based on widely used industry assumptions about the market price of gas and the cost of drilling and operating a well — less than 10 percent of the wells had recouped their estimated costs by the time they were seven years old.

***

“Looks like crap,” the Schlumberger official wrote about the well’s performance, according to the regulator, “but operator will flip it based on ‘potential’ and make some money on it.”

In 2012, the New York Times